Search

The COVID-19 epidemic has had a significant effect on China's economy and mainly on foreign trade enterprises. This virus has affected the social economy and business performance, becoming a primary test of governance aptitude and the national governance system. As a result, a neural network can be used to study and analyze the economic and social development during the COVID-19 epidemic. Good nonlinear forecasting can be achieved using neural network techniques since they overcome the limitations of traditional forecasting methods. Economic forecasts usually have great uncertainty and are affected by factors with complex relationships. However, using the B.P. network on economic forecasts can have a good forecasting effect. Economic analysis in the context of the new crown epidemic will provide more reference to future complex emergencies. However, countermeasures have been established based on financial institutions, governments, and enterprises. These measures are formulated to cope with the challenges faced by foreign trade enterprises based on the scrutiny of international public emergencies. They include exploration of international cooperation, advancing the new open economy system, speeding up transformation and upgrading, and perfecting the public safety emergency system. Other measures include cooperatively promoting high-quality development of foreign trade enterprises, enabling internal capacities to improve management capabilities, and establishing an external environment based on environmental perfection of the rule of law and policy. [ABSTRACT FROM AUTHOR]

Maternal nutritional status during pregnancy is the key to determining the health of newborns, especially the nutritional intervention in the third trimester of pregnancy. In this study, we observed the difference between 62 pregnant women who received nutritional management and care and 46 pregnant women who did not in the third trimester and found that the use of nutritional management and care could improve maternal nutritional status, reduce the risk of hyperglycemia, and increase pregnancy weight gain. Meanwhile, nutritional management and care helped to mitigate the negative psychology of pregnant women, increase the spontaneous labor rate, and reduce the risk of macrosomia and low-birth-weight infants. In terms of newborns, nutritional management and care improved their weight, height, head circumference, and so on, providing a more reliable guarantee for their physical health. According to the above results, we believe that nutritional management and care should be popularized in obstetrics and gynecology. [ABSTRACT FROM AUTHOR]

Considering the escalating prevalence of high-risk pregnancies encountered in clinical settings, the imperative to safeguard the well-being and survival of both high-risk pregnant women and their babies represents a hotspot of clinical research. This study investigated the clinical effects of an innovative care model for high-risk pregnancies, specifically a combination of staged nursing and nutritional interventions, on maternal nutritional status. Initially, 96 pregnant women were assigned randomly into two groups: a control group receiving routine care and a research group benefiting from the combined approach of staged nursing and nutritional interventions. Comparative analysis revealed that the research group experienced a significant reduction in labor duration and a decrease in the incidence of adverse pregnancy outcomes, thereby highlighting the efficacy of this combined approach in enhancing the safety of childbirth for high-risk pregnancies. Additionally, the research group exhibited more significant improvements in nutritional status than the control group, further endorsing the combined approach as a more effective and reliable safeguard for the health of high-risk pregnant women. Therefore, the implementation of staged nursing in conjunction with nutritional interventions is advocated for use during childbirth in high-risk pregnancies. [ABSTRACT FROM AUTHOR]

In this paper, we present a quantum multi-signature scheme based on Bell state. It allows n ( n > 1 ) signers sign a same file in random order. Bell states are used as information carriers and transmitted among verifier, requester, and signers. In this way, the verifier can verify the correctness of the signature. It is shown that our scheme satisfies the unforgeability and nondeniability of a secure quantum signature in theory and can resist collusive attack. In addition, only the Hadamard operator and four Pauli operators are used to generate a signature, which makes our scheme more feasible. [ABSTRACT FROM AUTHOR]

Time series of large samples of instantaneous velocity fields with a 7.26δ0.99×1.18δ0.99 size in a turbulent boundary layer have been obtained by experimental measurement using time-resolved particle image velocimetry (TRPIV) with a four-camera array. The resultant experimental Reynolds number (Reτ) is 1046. The continuous spatial wavelet transform has been employed to convert the streamwise velocity fluctuations into multi-scale components in the streamwise direction at all wall-normal positions. The distribution of turbulence kinetic energy across all spatial scales and all wall-normal positions are determined from the multi-scale wavelet coefficients. The continuous temporal wavelet transform has also been utilized to resolve the temporal series of longitudinal velocity fluctuations into multi-scale temporal components at all wall-normal positions. The use of the multi-scale wavelet coefficients delivered the turbulent kinetic energy distribution across all temporal scales and all wall-normal positions. Moreover, the distribution of multi-scale flatness factors with spatial scales and normal position, before and after removal of multi-scale coherent structures, has been calculated. The turbulent structures are detected by zero-crossing the wavelet coefficients. The conditional sampling scheme and spatial phase-locked method have been employed to establish typical multi-scale structures at different wall-normal positions. The universality of the small-scale structures has been confirmed where the associated vorticity is characterized by an alternating positive and negative quadrupole along the longitudinal direction and wall-normal direction, while the streamlines can be considered a dynamic system composed of a saddle point and focal points. The scaling exponent Ϛ(p), before and after the removal of the coherent structures, has been calculated, confirming that the multi-scale coherent structures are responsible for the anomalous scaling law. [ABSTRACT FROM AUTHOR]

Propylene is a significant basic material for petrochemicals such as polypropylene, propylene oxide, etc. With abundant propane supply from shale gas, propane dehydrogenation (PDH) becomes extensively attractive as an on-purpose propylene production route in recent years. Nitrogen-doped carbon (NC) nanopolyhedra supported cobalt catalysts were synthesized in one-step of ZIF-67 pyrolysis and investigated further in PDH. XPS, TEM and N2 adsorption-desorption were used to study the influence of carbonization temperature on as-prepared NC supported cobalt catalysts. The temperature is found to affect the cobalt phase and nitrogen species of the catalysts. And the positive correlation was established between Co0 proportion and space time yield of propylene, indicating that the modulation of carbonization temperature could be important for catalytic performance. [ABSTRACT FROM AUTHOR]

Objective: Our present study intended to examine the associations of RPEL1 and miR-1307 gene polymorphisms (rs4917385 and rs7911488) with susceptibility, glucocorticoids (GCs) efficacy, anxiety, depression, and health-related quality of life (HRQoL) in Chinese systemic lupus erythematosus (SLE) patients. Methods: Initially, 1000 participants (500 SLE cases and 500 controls) were recruited for the case–control study. Then, 429 cases who received GCs were followed through 12 weeks to explore GCs efficacy, depression, anxiety, and HRQoL. We selected the iMLDR technique for genotyping: RPEL1: rs4917385 (G/T) and miR-1307: rs7911488 (A/G). Results: The minor G allele of rs7911488 reduced the risk of SLE (p =.024). Four haplotypes consisting of rs4917385 and rs7911488 were associated with SLE susceptibility (p <.025). Both rs4917385 and rs7911488 were associated with anxiety symptoms and physical function (PF) in SLE patients (p <.025). The rs4917385 was associated with depression and its improvement. No statistical significance was found between RPEL1 and miR-1307 gene polymorphisms with GCs efficacy. Meanwhile, additive interaction analysis showed a significant association between RPEL1 and miR-1307 gene polymorphisms with tea consumption in anxiety. Conclusion: RPEL1 and miR-1307 gene polymorphisms (rs4917385 and rs7911488) might be related to SLE susceptibility in Chinese population. Additionally, the two polymorphisms were possibly associated with depression, anxiety, and HRQoL in Chinese SLE population. [ABSTRACT FROM AUTHOR]

Three types of tilapia scale gelatins (hot water-pretreated gelatin, HWG; acetic acid-pretreated gelatin, AAG; and pepsin enzyme-pretreated gelatin, PEG) were extracted and their gel strength, foaming properties, and emulsifying properties were analyzed. They had different gel strength values: AAG (370 ± 10 g Bloom) > HWG (320 ± 10 g Bloom) > PEG (280 ± 10 g Bloom). The creaming index values of tilapia scale gelatin-stabilized fish oil-loaded emulsions were dependent on gelatin type (HWG ≈ AAG > PEG) at low gelatin concentration (2 mg/mL), whereas they were similar and low (8–10 %) at high gelatin concentration (10 mg/mL). Extraction methods had no consistently significant effects on the gelatin foaming properties. In summary, tilapia scale gelatins had better gel strength and foaming properties and similar or even better emulsifying properties than mammalian gelatins. Therefore, tilapia scales could be a potential source of gelatins to replace mammalian gelatins. • Tilapia scale gelatins were extracted using three different pretreatment methods. • Hot water- and pepsin-pretreated gels were the finest and coarsest, respectively. • These gelatins had better or comparable gel strength than commercial mammalian ones. • These gelatins had better foaming properties than some reported mammalian ones. • These gelatins had comparable emulsifying properties to some reported mammalian ones. [ABSTRACT FROM AUTHOR]

Encapsulation is an efficient protection method for oil in both liquid (e.g., emulsion) and solid (e.g., capsule) forms. In this work, we mainly explored the effect of different Span surfactants (Span 20, Span 40, Span 60, and Span 80) on the properties of fish oil-loaded sodium alginate/Span-stabilized emulsions and calcium alginate/Span capsules. For emulsions, different Span surfactants induced different initial droplet sizes and emulsion creaming stability. The emulsifying stability of Span surfactants for sodium alginate/Span-stabilized emulsions was: Span 40 < Span 20 < Span 80 < Span 60. For capsules, a Span addition could decrease the water content and change the particle morphologies. Compared with the calcium alginate capsule (12.2 %), the Span 60 addition increased the fish oil loading ratio (20.2 %). Moreover, the addition of Span 20, Span 60, and Span 80 decreased the production of primary lipid hydroperoxides of the capsules. Span surfactants had different effects on the free fatty acid release of calcium alginate capsules in the gastrointestinal digestion process, such that: Span 40 > Span 80 > control > Span 20 > Span 60. This work suggests that Span surfactants are capable of adjusting and optimizing the properties of emulsions and capsules for potential food applications. [Display omitted] • Emulsifying stability of Span chemicals were: Span 40 < Span 20 < Span 80 < Span 60. • Alginate capsule water contents: Span 20 < Span 40 < Span 60 < Span 80 < control • Span 60 increased oil loading ratio of capsule from 12.2 % ± 1.8 % to 20.2 % ± 1.4 %. • Span 20, Span 60, and Span 80 decreased the peroxide values of capsules. • Fatty acid release from capsules: Span 40 > Span 80 > control > Span 20 > Span 60 [ABSTRACT FROM AUTHOR]

Anopheline mosquitoes rely on their highly sensitive chemosensory apparatus to detect diverse chemical stimuli that drive the host-seeking and blood-feeding behaviors required to vector pathogens for malaria and other diseases. This process incorporates a variety of chemosensory receptors and transduction pathways.We used advanced in vivo gene-editing and -labeling approaches to localize and functionally characterize the ionotropic coreceptor AcIr76b in the malaria mosquito Anopheles coluzzii, where it impacts both olfactory and gustatory systems. AcIr76b has a broad expression pattern in female adult antennal grooved pegs, coeloconic sensilla, and T1 and T2 sensilla on the labellum, stylets, and tarsi, as well as the larval sensory peg. AcIr76b is colocalized with the Orco odorant receptor (OR) coreceptor in a subset of cells across the female antennae and labella. In contrast to Orco and Ir8a, chemosensory coreceptors that appear essential for the activity of their respective sets of chemosensory neurons in mosquitoes, AcIr76b-/- mutants maintain wild-type peripheral responses to volatile amines on the adult palps, labellum, and larval sensory cone. Interestingly, AcIr76b-/- mutants display significantly increased responses to amines in antennal grooved peg sensilla, while coeloconic sensilla reveal significant deficits in responses to several acids and amines. Behaviorally, AcIr76b mutants manifest significantly female-specific insemination deficits, and although AcIr76b-/- mutant females can locate, alight on, and probe artificial blood hosts, they are incapable of blood feeding successfully. Taken together, our findings reveal a multidimensional functionality of Ir76b in anopheline olfactory and gustatory pathways that directly impacts the vectorial capacity of these mosquitoes. [ABSTRACT FROM AUTHOR]

Objective To investigate the associations of mitochondrial DNA (mtDNA) genetic variants with SLE susceptibility, glucocorticoid (GC) efficacy and prognosis. Methods Our study was done in two stages. First, we performed whole mitochondrial genome sequencing in 100 patients and 100 controls to initially screen potential mtDNA variants associated with disease and GC efficacy. Then, we validated the results in an independent set of samples. In total, 605 SLE patients and 604 normal controls were included in our two-stage study. A two-stage efficacy study was conducted in 512 patients treated with GCs for 12 weeks. We also explored the association between mtDNA variants and SLE prognosis. Results In the combined sample, four mtDNA variants (A4833G, T5108C, G14569A, CA514-515-) were associated with SLE susceptibility (all P BH < 0.05). We confirmed that T16362C was related to efficacy of GCs (P BH = 0.014). Significant associations were detected between T16362C and T16519C and the efficacy of GCs in females with SLE (P BH < 0.05). In the prognosis study, variants A4833G (P BH = 0.003) and G14569A (P BH = 9.744 × 10−4) substantially increased SLE relapse risk. Female patients harbouring variants T5108C and T16362C were more prone to relapse (P BH < 0.05). Haplotype analysis showed that haplogroup G was linked with SLE susceptibility (P BH = 0.001) and prognosis (P BH = 0.013). Moreover, mtDNA variant–environment interactions were observed. Conclusion We identified novel mtDNA genetic variants that were associated with SLE susceptibility, GC efficacy, and prognosis. Interactions between mtDNA variants and environmental factors were related to SLE risk and GC efficacy. Our findings provide important information for future understanding of the occurrence and development of SLE. [ABSTRACT FROM AUTHOR]

• Three failure modes of strata due to exfiltration of defective pipeline were identified. • The erosion behaviors and macro- and micro-failure mechanisms were disclosed. • A modified analytical model for evaluating the elliptical loosening zone was proposed. • The effects of critical factors on soil erosion and ground collapse were quantified. Exfiltration of defective water pipelines is one of the leading causes contributing to the frequent ground collapses in congested urban areas; hence, revealing the failure evolution and mechanism of this hazard is essential to its prevention and mitigation. In this study, comprehensive experimental model tests were conducted first to characterize the evolution of soil erosion and ground collapse due to exfiltration of shallowly buried defective water pipes and examine the effects of six critical parameters, i.e., opening size and location, pipe pressure and buried depth, groundwater level, and exfiltration condition. Three failure behaviors of strata around leaking waterpipe were identified, i.e., minor disturbance (slight), formation and collapse of an erosion cavity (moderate), and soil fluidization (severe). Moreover, the ground loosening zone induced by cavity collapse could be roughly estimated using the modified flow ellipsoid theory; soil fluidization would occur once the ratio of water pressure head inside the pipe to its buried depth was greater than 2. Subsequently, a validated computational-fluid-dynamics and discrete-element-method (CFD–DEM) coupling method was employed to explore the microscopic mechanism of cavity erosion under the exfiltration flow. It was disclosed that the formation and expansion of a temporary cavity resulted from internal soil erosion, including the emigration of massive fine particles and aggregation of coarse particles around the defective pipe. Finally, the numerical simulation results indicated that cavity erosion would be exacerbated by increasing flow velocity and particle size-ratio, reducing soil fines content, and changing the opening from the pipe crown to its invert. [ABSTRACT FROM AUTHOR]

Orientational ordered soft matter possessing diverse microstructures has become a focal point of scientific research and technological exploration, thanks to its advancements in serving as an indispensable optical platform enabling propagation of light with multidimensional and manipulatable states. Herein, a facile way is developed to manipulate the in‐plane light beam transition dynamics by harnessing a time‐variable nematic liquid crystal (NLC) film through the electrical‐field‐induced topological defects. The results show that the dynamic change of optical branched flow is associated with the growth in the correlation length of optical potential and the reduction in the density of topological defects. The optical branching can continuously transform to deterministic and tunable beam steering at the low‐defect‐density regime through annihilation kinetics of defects. The explored soft matter system provides an excellent planar platform for the fundamental physics of light interacting with topological defects and may offer new perspectives for novel optics elements toward the applications of soft matter photonics. [ABSTRACT FROM AUTHOR]

Based on a Nd:LaMgAl11O19 (Nd:LMA) disordered crystal, we have experimentally demonstrated a diode-pumped high-repetition-rate Q-switched laser, which can operate at 1056, 1083 nm, or 1056 and 1083 nm, respectively, using a SF6 prism to adjust the cavity loss. For the three states, the characteristics of the Nd:LMA laser including the average output power, pulse width and frequency repetition rate have also been investigated in details. For 1056 nm, the Q-switched laser is obtained in the absorbed pump power range of 3.0–5.0 W. When the absorbed pump power is 5.0 W, the corresponding output power, pulse width and frequency repetition rate are 404 mW, 2.64 µs and 157.8 kHz, respectively. For 1083 nm, the Q-switched laser is achieved at the absorbed pump power of 6.2 W, and the corresponding output power, pulse width and frequency repetition rate are 201 mW, 3.93 µs and 101.9 kHz, respectively. For 1056 and 1083 nm, the Q-switched laser is achieved at the absorbed pump power of 6.2 W, and the corresponding output power, pulse width and frequency repetition rate are 406 mW, 2.52 µs and 101.5 kHz, respectively. [ABSTRACT FROM AUTHOR]

The development of genipin modification methods has attracted much attention to improve the functional properties of proteins in the fields of food science. In this work, two types of pH-responsive genipin-crosslinked bovine bone gelatin conjugates with high surface hydrophobicity were developed for emulsion stabilization. One was genipin molecule-crosslinked gelatin conjugates prepared at acidic pH and the other was genipin macromer-crosslinked gelatin conjugates prepared at neutral and basic pH. The degrees of crosslinking increased with the increase of preparation pH. They increased with the increase of genipin-to-gelatin mass ratios at acidic pH, whereas decreased with the increase of genipin-to-gelatin mass ratios at neutral and basic pH. The surface hydrophobicity values, molecular weights, and emulsifying properties (creaming stability, emulsion activity index, and emulsion stability index) of the obtained conjugates increased with the increase of both preparation pH and genipin-to-gelatin mass ratios. This work provided useful knowledge to understand how the preparation parameters (preparation pH and genipin-to-gelatin mass ratio) and genipin structures (molecule and macromer) affect a protein's degrees of crosslinking, physicochemical properties, and emulsifying properties. [Display omitted] • Two types of genipin-crosslinked gelatin conjugates were obtained at different pH. • Effect of genipin-to-gelatin ratio on the degrees of crosslinking depended on the pH. • 1-to-1 and n-to-1 crosslinking occurred at acidic pH. • 1-to-1, n-to-1, and macromer-to-1 crosslinking occurred at neutral and basic pH. • Conjugates prepared with pH 9.0 or 1:50 (ratio) induced the best emulsion stability. [ABSTRACT FROM AUTHOR]

With the increasing demand for renewable and clean energy, highly efficient and low-cost electrocatalysts for oxygen evolution reaction (OER) have attracted great interest in the field of hydrogen energy. In this work, we report a novel strategy to prepare graphene (Gr, rather than graphene oxide)-supported highly efficient catalyst for OER. Gr-supported Co 3 O 4 free-standing nanosheets (Gr@eCo 3 O 4) are fabricated by electrodeposition. SiO 2 is used as a template for co-electrodeposition, and is further etched by alkali. Gr provides large electrochemical surface area and abundant catalytically active sites, as well as enhances the conductivity of Co 3 O 4. Meanwhile, the charge transfer kinetics of OER is improved on Co 3 O 4 electrodeposited on Gr. Gr@eCo 3 O 4 exhibits superior OER performance with a Tafel slope of 45 mV dec−1 at 10 mA cm−2. [Display omitted] • Electrodeposition of Gr@eCo 3 O 4 nanosheets with SiO 2 as a template. • Co 3 O 4 is tightly bonded to Gr and the size of Co 3 O 4 is small. • Electrons interaction and charge transfer in Gr@eCo 3 O 4 nanosheets. • Electrodeposited Gr@eCo 3 O 4 nanosheets exhibit highly efficient catalytic activity. [ABSTRACT FROM AUTHOR]

[Display omitted] Herein, a safe desolvation and crosslinking method was developed to prepare food-grade bovine bone gelatin (BBG) nanoparticles for Pickering emulsion stabilization. The nanoparticle-like structures were formed by adjusting pH 9.0 and adding ethanol, and then stable nanoparticles were formed by using N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide (EDC) and N -hydroxysuccinimide (NHS) as crosslinker. Compared with other pH (2.5, 5.0, 7.0, and 12.0), pH 9.0 was the appropriate pH to prepare BBG nanoparticles. Individual nanoparticles (6.50 nm in height), oligomeric nanoparticles (13.42–22.52 nm in height), and polymeric nanoparticles (obvious liquid-precipitate separation) were formed at EDC·HCl/NHS concentrations of 6, 9–12, and 15–20 mg/mL, respectively. The oligomeric nanoparticles induced the highest emulsion creaming stability. The emulsion creaming ability increased with the increase of BBG nanoparticle concentrations. Low NaCl concentration (e.g., 100 mmol/L) could increase the emulsion creaming stability. Finally, 4 °C was the best storage temperature for fish oil-loaded Pickering emulsions. [ABSTRACT FROM AUTHOR]

Background: The dried bark of Cinnamomum zeylanicum is a well-known medicinal constituent owing to its latent health benefits. The establishment of a wide-ranging and objective quality assessment method is a tricky to be solved instantly by cinnamon and other medicinal and edible herbs. Objectives: The objective was to introduce the analytic hierarchy process (AHP) to estimate widely and compare the quality of cinnamon decoction pieces. Materials and Methods: The chemical, morphological, and biological indexes of different batches of cinnamon decoction pieces are determined, and then a multi-criteria quantitative assessment model for the quality estimation of cinnamon decoction pieces is documented by adopting AHP. Results: The complete appraisal outcomes of AHP model are dependable with objective evaluation, and the results are unbiased and steady. Conclusion: The AHP multi-criteria quantitative evaluation model can be agreeably adapted to the quality evaluation of multi-component Chinese herbal decoction pieces, providing a new evidence for the quality evaluation of traditional Chinese medicine. [ABSTRACT FROM AUTHOR]

Objective: Esophageal schwannoma (ES) are rare and mostly benign neurogenic tumors. The clinical misdiagnosis rate of it is high. In this study, the clinicopathologic features of ES in mainland China were studied to better understand the disease and improve the diagnosis and treatment rate. Methods: A systematic review was conducted in accordance with PRISMA guidelines. The keywords "esophageal schwannoma", "esophageal neurinoma" and "esophageal neurilemoma" were searched for databases such as Pubmed, EMbase, Wanfang Database and Chinese National Knowledge Infrastructure. The search time frame for database was until July 2019. Combined with our patient, the clinicopathological data and the diagnosis and treatment of ES were summarized. Results: ES occurs in the upper part of the mediastinum and in the thoracic esophagus in most patients in the neck, upper and middle segments. CT and PET/CT examinations can be used for diagnosis, but the differentiation value of both benign and malignant ES is similar. The histopathological findings of forceps biopsy specimens are often difficult to diagnose, and deep tissue biopsies may increase pathological accuracy. EUS-FNA is also recommended for ES diagnosis, but it may also be misdiagnosed. Pathological features include a fusiform arrangement in a palisade-like structure or a tumor cell arranged in a network to form a loose structure. ES characteristic immunohistochemistry results showed that S-100 protein has strong immunological activity. Conclusion: The definitive diagnosis requires immunohistochemistry, especially immunological reaction with S-100 protein. The appropriate treatment plan should be selected according to the diameter of the lesion. The overall prognosis of ES is good, but attention should be paid to follow-up. [ABSTRACT FROM AUTHOR]

In this study, carbon aerogel (CA) were obtained by inexpensive bacterial cellulose (BC) hydrogel freeze-dried and carbonized under N 2 atmosphere. Then nickel sulfide (NiS)/CA composite aerogel electrodes with different contents were successfully prepared by a one-step solvothermal method. The morphology, phases and surface electronic state of these electrodes were characterized by SEM/TEM, XRD and XPS, respectively, and their electrocatalytical properties for methanol oxidation were investigated by cyclic voltammetry (CV) in the alkaline media of methanol. The NiS particles dispersed uniformly on CA, and the obtained material maintained the reticulated porous structure of BC. The methanol oxidation peak current density of CNS-0.5 at 0.8 V reached 43 mA/cm2 (263 mA/mg). After 1000 cycles, the peak current density retained 92% of the initial state. The composite electrode has good catalytic activity and good cycle performance for methanol catalysis. Nickel sulfide with high crystallinity transforms to nickel oxide with low crystallinity after a long cycle test, which results in excellent cycle performance of the composite. NiS/CA electrodes have the potential for application in portable or wearable devices. • Carbon aerogel (CA) was prepared by using bacterial cellulose hydrogel carbonized. • NiS/CA composite electrodes have electrical conductivity, light, flexibility. • Low loaded NiS/CA has good electrocatalytic performance for methanol oxidation. • The peak current density retained 92% of the initial cycle after sweep 1000 times. [ABSTRACT FROM AUTHOR]

Background: Chronic postsurgical pain (CPSP) is common and would reduce the quality of life of patients. Transversus abdominal plane (TAP) block has been widely used in lower abdominal surgery and many researches demonstrated that it could improve acute postsurgical pain. We aim to determine whether TAP block could improve chronic postoperative pain at 3 months and 6 months after colorectal surgery. Methods: A total of 307 patients received selective colorectal surgery under general anesthesia between January, 2015 and January, 2019 in a single university hospital were included: 128 patients received TAP block combined with patient-controlled intravenous analgesia (PCIA) for postsurgical analgesia (group TP) and 179 only administrated with PCIA (group P). Main outcome was the NRS score of pain at 3 months after colorectal surgery. The data was analyzed by two-way repeated measures anova and the chi-square test. Results: The NRS score at rest and during movement was decreased significantly at 24 h after surgery (rest NRS 1.07 ± 1.34 vs 1.65 ± 1.67, movement NRS 3.00 ± 1.45 vs 3.65 ± 1.89; all P = 0.003) in group TP than those of group P. There was no significant difference of NRS score at 48 h after surgery (P > 0.05). At 3 months after surgery, the NRS score during movement was also lower in group TP than that in group P (0.59 ± 1.23 vs 0.92 ± 1.65, P = 0.045). There was no significant difference of NRS score at 6 months after surgery (P > 0.05). The prevalence of CPSP was 19.5% (25/128) in group TP and 20.7% (37/179) in group P at 3 months after surgery. 13.2% (17/128) of patients suffered from CPSP in group TP and 13.9% (25/179) in group P at 6 months after surgery. Both at 3 months and 6 months after surgery, there was no statistical difference of the prevalence of CPSP between the two groups (all P > 0.05). Conclusions: TAP block reduced NRS during movement at 3 months after surgery but did not reduce the incidence of CPSP at 3 months and 6 months after selective colorectal surgery. [ABSTRACT FROM AUTHOR]

Hepcidin, a multifunctional hormone oligopeptide, not only exhibits a regulatory role in iron metabolism, but also participates in the regulation of teleostean immunity. In this study, ORF sequence of WR-hepcidin was 258 bp and encoded 85 amino acid residues. Tissue-specific analysis revealed that the highest expression of WR-hepcidin was observed in liver. Aeromonas hydrophila challenge can sharply increased WR-hepcidin mRNA expression in liver, trunk kidney and spleen. The purified WR-hepcidin fusion peptide can directly bind to A. hydrophila and Streptococcus agalactiae , reduce the relative bacterial activity, limit bacterial growth and attenuate their dissemination to tissues in vivo. In addition, the treatment of WR-hepcidin fusion protein can diminish the production of pro-inflammatory cytokines. These results indicated that WR-hepcidin can play a negative regulatory role in bacteria-stimulated pro-inflammatory cytokines production and MyD88-IRAK4 activation. • We characterized a novel hepcidin gene in hybrid crucian carp. • The up-regulation of WR-hepcidin was observed following bacterial challenge. • WR-hepcidin can bind to gram positive and gram negative bacteria. • WR-hepcidin can restrict the bacterial growth and reduce bacteria-stimulated inflammatory response. [ABSTRACT FROM AUTHOR]

The research of the interaction between proteins and functional active substances in the protein nanoparticles is a research hotspot in the field of food science. Gelatin type had a significant effect on the structural and functional properties of gelatins. Herein, the interaction mechanism of curcumin with four types of gelatins (bovine bone gelatin, BBG; cold water fish skin gelatin, CFG; fish gelatin, FG; and porcine skin gelatin, PSG) and the structural and functional properties of gelatin/curcumin nanoparticles were explored. All four types of gelatins could be applied to prepare gelatin/curcumin nanoparticles with an amorphous state of curcumin. The nanoparticle sizes were not dependent on the molecular weight of gelatins. The stability of gelatin/curcumin nanoparticle solutions was dependent not on the nanoparticle size but on the gelatin type. The binding affinity between gelatins and curcumin was dependent on gelatin type and the number of binding sites was nearly 1. The main binding forces to form gelatin-curcumin nanoparticles were hydrogen bonds, Pi-alkyl interaction, and Pi-anion interaction. The nanoparticulation increased the surface hydrophobicity of BBG, FG, and PSG, whereas it decreased the surface hydrophobicity of CFG. The nanoparticulation increased the surface tension of gelatins and decreased the dynamic interfacial tension of gelatins. The functional properties were dependent on both gelatin type and nanoparticulation. CFG/Cur nanoparticulation could not change the creaming stability, whereas other gelatins/curcumin nanoparticulation significantly increased creaming stability than the corresponding gelatins. This work provided the basic knowledge to illustrate the interaction and application of protein nanoparticles for Pickering emulsion stabilization. [Display omitted] • Curcumin could be encapsulated into gelatin nanoparticles of four types of gelatins. • The nanoparticle sizes were not dependent on the molecular weight of gelatins. • The number of binding sites between gelatins and curcumin was nearly 1. • Binding forces were hydrogen bonds, Pi-alkyl interaction, and Pi-anion interaction. • Gelatins/curcumin nanoparticulation significantly increased creaming stability. [ABSTRACT FROM AUTHOR]

Fish, as top predators in aquatic ecosystems, play an important role in maintaining the structure and functioning of these ecosystems, making their diversity a topic of great interest. This study focused on the Yangtze River Basin to investigate the fish community structure and diversity using environmental DNA (eDNA) technology. The results showed that a total of 71616 fish operational taxonomic units (OTUs) and 90 fish belonging to 23 families were detected, with the Cyprinidae family being the dominant group, followed by the Cobitidae, Amblycipitidae, etc. Compared to historical traditional morphological fish surveys, the quantity of fish detected using eDNA was relatively low, but the overall distribution pattern of fish communities was generally consistent. The highest fish Shannon-Wiener diversity index in the Yangtze River Basin sites reaches 2.60 with an average value of 1.25. The fish diversity index was higher in the downstream compared to the middle and upstream regions, and there were significant differences among different sampling sites. Significant environmental factors influencing α-diversity included chlorophyll-a, chemical oxygen demand, dissolved oxygen, total nitrogen, and elevation. Non-metric multidimensional scaling (NMDS) analysis revealed significant differences in fish community composition between the upstream and middle/lower reaches of the Yangtze River, while the composition of fish communities in the middle and lower reaches was more similar. Redundancy analysis (RDA) indicated that total organic carbon (TOC) was positively correlated with fish community distribution in the upstream, while water temperature and NO 3 –N were negatively correlated with fish distribution in the upstream. NH 3 –N and COD Mn were negatively correlated with fish distribution in the middle and downstream regions, indicating a relatively severe water pollution in these areas. Additionally, fish communities in the Yangtze River displayed a typical distance decay pattern. • EDNA revealed fish community structure and diversity in the Yangtze River. • Yangtze River has notable fish diversity differences, particularly downstream. • Multiple environmental factors jointly affect fish diversity in the Yangtze River. [ABSTRACT FROM AUTHOR]

Bacterial infection may be involved in the entire process of tissue carcinogenesis by directly or indirectly affecting the occurrence and development of tumors. Porphyromonas gingivalis (P.gingivalis) is an important pathogen causing periodontitis. Periodontitis may promote the occurrence of various tumors. Gastrointestinal tumors are common malignant tumors with high morbidity, high mortality, and low early diagnosis rate. With the rapid development of molecularbiotechnology, the role of P.gingivalis in digestive tract tumors has been increasingly explored. This article reviews the correlation between P.gingivalis and gastrointestinal cancer and the pathogenesis of the latter. The relationship among P.gingivalis, periodontal disease, and digestive tract tumors must be clarifiedthrough a multi-center, prospective, large-scale study. [ABSTRACT FROM AUTHOR]

Although the affinity of metallocorroles to axial ligands is quite low, this is not the case when the chelated element is phosphorus. This work is hence focused on the mechanism of ligand exchange of six‐coordinate phosphorus corroles as a tool for affecting their chemical and physical properties. These fundamental investigations allowed for the development of facile methodologies for the synthesis of a large series of complexes and the establishment of several new structure/activity profiles that may be used to understand and predict spectroscopic features and for tailor‐made modification of photophysical and electrochemical properties. This is exemplified by the facile access to complexes with terminal groups that are of large potential for practical applications based on click chemistry, optical imaging, and surface science. [ABSTRACT FROM AUTHOR]

Objective: In this work, the relationship between octamer binding transcription factor 4 (OCT-4) expression and the clinicopathological features of cervical cancer (CC) is evaluated in detail. Methods: The library databases Pubmed, Embase, Cochrane library, Wan Fang and Chinese National Knowledge Infrastructure (CNKI) were searched for research related to these concepts published from the time the databases were established until May 2018. The obtained studies are screened, extracted, and evaluated according to the inclusion and exclusion criteria, and meta-analysis is carried out via RevMan 5.3. Results: Ten case-control studies, including 408 cases of CC, 164 cases of cervical intraepithelial neoplasia (CIN), and 148 cases of normal cervix, are included in the analysis. Results show that OCT-4 levels are statistically significantly different between the CC and normal cervical tissue groups (odds ratio (OR) = 15.59, 95% confidence interval (CI): 8.70, 27.94), the CC and CIN groups (OR = 5.64, 95% CI: 3.23, 9.86), the CIN and normal cervical tissues groups (OR = 7.13, 95% CI: 2.41, 21.05), and the CC well/moderately differentiated and poorly differentiated groups (OR = 0.44, 95% CI: 0.24, 0.81). OCT-4 is not statistically significantly different between CIN I + II and CIN III tissues (OR = 0.40, 95% CI: -0.02, 0.81), the CC lymphatic and non-lymphatic metastasis groups (OR = 1.93, 95% CI: 0.83, 4.47), the FIGO I and FIGO II groups (OR = 0.79, 95% CI: 0.29, 2.13), and the adenocarcinoma and squamous cell carcinoma groups (OR = 1.55, 95% CI: 0.70, 3.44). Conclusions: The available evidence suggests that OCT-4 expression is associated with CC malignancy and histological differentiation. This finding, however, is subject to quantitative studies and quality tests. [ABSTRACT FROM AUTHOR]

Highlights • We validated that the combined usage of direct sequencing and MLPA can achieve a high detection rate in Chinese Han PJS patients. • We found significantly more splice mutations in Chinese Han PJS patients. • We suggest that wide usage of enteroscopy would be helpful in PJS surveillance. Abstract Background The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. Aims To test the efficacy of the combination in Chinese patients with PJS. Methods PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. Results We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. Conclusion The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance. [ABSTRACT FROM AUTHOR]

We experimentally demonstrated a high-efficiency passively Q-switched Yb:CaYAlO4 (Yb:CYA) laser based on a semiconductor-saturable absorber mirror (SESAM), and the output characteristics of the laser including the average output power, repetition frequency, pulse duration, pulse energy and pulse peak power were investigated by adopting output mirrors with different transmittances. When the transmittance of the output mirror was 5% and the pump power was set at about 7.76 W, a maximum average output power of as high as 2.480 W was achieved with a slope efficiency and light-to-light efficiency of the Q-switched Yb:CYA laser of up to 37.1% and 31.2%, respectively. [ABSTRACT FROM AUTHOR]

• Gelatin is a versatile encapsulating material for various emerging nanocarriers. • Formation, property, structure, and stability of nanocarriers are discussed. • Gelatin is often combined with other biomaterials for synergistic efficiency. • Gelatin nanocarriers can deliver bioactives for functional food applications. Gelatin has long been used as an encapsulant agent in the pharmaceutical and biomedical industries because of its low cost, wide availability, biocompatibility, and degradability. However, the exploitation of gelatin for nanodelivery application is not fully achieved in the functional food filed. In this review article, we highlight the latest work being performed for gelatin-based nanocarriers, including polyelectrolyte complexes, nanoemulsions, nanoliposomes, nanogels, and nanofibers. Specifically, we discuss the applications and challenges of these nanocarriers for stabilization and controlled release of bioactive compounds. To achieve better efficacy, gelatin is frequently used in combination with other biomaterials such as polysaccharides. The fabrication and synergistic effects of the newly developed gelatin composite nanocarriers are also present. [ABSTRACT FROM AUTHOR]

Age related macular degeneration is one of the most common causes of vision loss in the elderly. Long noncoding RNAs (lncRNAs) serve important roles in regulating gene expression by acting as competing endogenous RNAs (ceRNAs). However, the roles of specific lncRNAs and their associated ceRNA function induced by clusterin in cultured retinal pigment epithelial (RPE) cells remain to be fully elucidated. Based on high throughput sequencing data from RPE cells treated with or without clusterin, the present study identified differentially expressed mRNAs, lncRNAs and microRNAs (miRNAs). A lncRNA-mRNA-microRNA (miRNA) network (ceRNA network) was subsequently constructed based on the bioinformatic database miRanda and miRNA targets database miRTarBase. These results demonstrated the expression pattern of several lncRNAs, and a clear clusterin-associated ceRNA network in RPE cells, which included 75 lncRNAs and 32 miRNAs in RPE cells induced by clusterin. Collectively, the present study uncovered and characterized via bioinformatics the global properties of the ceRNA network in human RPE cells in response to clusterin. These results may aid in the elucidation of the molecular mechanisms of clusterin in age-related macular degeneration. [ABSTRACT FROM AUTHOR]

The cardio-ankle vascular index (CAVI) is a measure of global arterial stiffness. We hypothesized that CAVI is associated with left ventricular (LV) function and geometry in individuals without structural heart disease. We measured CAVI in 600 participants (mean age 60.3±14.6 years, 54% men) without history of atherosclerotic cardiovascular disease who were referred for transthoracic echocardiography. Linear regression analysis was used to assess the association of CAVI with LV function (peak mitral annular systolic s' and early diastolic velocity e') and structure (LV mass index (LVMI) and relative wall thickness (RWT)). Older age, male sex, lower body mass index, history of hypertension, diabetes and chronic kidney disease were each associated with a higher CAVI (adjusted R2 = 0.56, all p < 0.01). A higher CAVI was associated with lower s' and e', and greater RWT, independent of age, sex, systolic BP and other conventional cardiovascular risk factors (all p < 0.05); a borderline association of higher CAVI with greater LVMI (p = 0.05) was present. Associations with e', s' and RWT were similar in women and men but the association with LVMI was stronger in women than in men (p for interaction = 0.02, multivariable-adjusted ß = 6.92, p < 0.001 in women; p > 0.1 in men). In conclusion, a higher CAVI, a measure of global arterial stiffness, is associated with worse LV systolic function, worse diastolic relaxation, and greater LV RWT in both men and women, and with LVMI in women. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Case presentation: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. Conclusions: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

Objective A large number of disease-modifying drugs are available for multiple sclerosis ( MS); however, there is no established biomarker to predict long-term disease severity and future relapses in MS. We aimed to clarify the alterations in peripheral blood T cell subsets that are associated with MS relapse and disease severity, according to cytokine production profiles in the remission phase. Methods Blood samples collected from 29 relapsing-remitting MS patients in the remission phase and 21 healthy controls (HC) were analyzed for various cytokine-producing T cell subsets by flow cytometry. Results MS patients in the remission phase had significantly higher percentages of interleukin ( IL)-17+ CD4+ T cells, IL-4+ CD4+ T cells, IL-9+ CD4+ T cells, interferon-γ+ CD8+ T cells and IL-4+ CD8+ T cells than HC ( P = 0.047, P = 0.007, P = 0.026, P = 0.015 and P = 0.007, respectively). In MS, the percentages of IL-9+ CD4+ T cells, IL-9+ CD8+ T cells and IFN-γ+ IL-17+ CD8+ T cells showed a significant positive correlation with annualized relapse rates (ARR) ( P = 0.011, r = 0.47, P = 0.007, r = 0.49 and P = 0.044, r = 0.38, respectively). Conclusions In the remission phase of MS, both anti-inflammatory cytokine-producing T cells and pro-inflammatory cytokine-producing T cells are increased; however, only the percentages of pro-inflammatory cytokine-producing T cells, such as IL-9-producing CD4+ T cells, IL-9-producing CD8+ T cells and IFN-γ- and IL-17-producing CD8+ T cells, correlate with ARR. These pro-inflammatory cytokine-producing T cells in the remission phase might be candidate biomarkers for future relapses in MS patients. [ABSTRACT FROM AUTHOR]

Mosquito control is essential to protect humans from mosquito-borne diseases. The host recognition between mosquitoes and humans is achieved by the mosquito olfactory system. Antennal sensilla, which house olfactory receptor neurons, are responsible for detecting chemical cues from hosts. To deepen our understanding of the mechanisms involved in the host seeking behavior of mosquitoes, we conducted an electrophysiological study to investigate the response profile of each type of antennal sensilla to human odorants using single sensillum recording. In this study, more than 100 human odorants have been applied as stimuli to 5 morphological types of sensilla, long sharp trichoid (LST), short sharp trichoid (SST), short blunt trichoid I (SBTI), short blunt trichoid II (SBTII), and grooved peg (GP). Different types of sensilla present distinctive response profiles to the human odorants tested. In particular, SST, SBTI, and SBTII sensilla responded to more than 1 category of human odorants, while GP and LST were narrowly tuned to amines and methyl nonanoate, respectively. The dose-dependent patterns and odorant-specific/ chemical structure-specific temporal dynamics of SBTI and SBTII antennal sensilla to human odorants had been further detected. Taken together, our study provides the new information on the olfactory physiology of Culex quinquefasciatus (Diptera: Culicidae) to human odorants, leading to a better understanding of mosquito-host recognition and being important for future development of new reagents in the mosquito control. [ABSTRACT FROM AUTHOR]

Notch family proteins have been reported to be associated with the initiation and development of various types of tumors. The present study used a prospective design to investigate the role of Notch proteins as novel biomarkers that are capable of predicting the survival outcome for patients with non-small cell lung cancer (NSCLC). The protein expression of Notch 1, Notch 3 and their ligands, Jagged 1 and Delta-like 4, was examined using immunohistochemistry in NSCLC tissues and adjacent non-cancerous lung tissues from 101 patients who underwent surgical treatment. The expression was also correlated with clinicopathological parameters and overall survival (OS). High Notch 1 protein expression was observed in 55.4% (56/101) of NSCLC samples and high Notch 3 expression was observed in 53.5% (54/101). The nuclear expression of Notch 3 was significantly associated with the lymph node status (P=0.0026) and tumor-node-metastasis (TNM) stage (P<0.0001), while the coexpression of Notch 1 plus Notch 3 was associated with lymph node status (P=0.0056), TNM stage (P=0.0001) and the histological grading (P=0.0359). In the survival analyses, the high expression of Notch 1 and Notch 3 exhibited an additive effect toward a poorer OS compared with a subtype with low coexpression for the two proteins (P<0.001), with high nuclear Notch 3 expression in the NSCLC patients maintaining independent prognostic significance for the outcome on multivariate analysis. These data further demonstrate a central role for Notch signaling in NSCLC and the significance of Notch 3 as a prognostic indicator of a poorer survival for patients with resected NSCLC. [ABSTRACT FROM AUTHOR]

Mesenchymal chondrosarcoma (MC) is a rare malignant cartilaginous forming tumor. MC of the kidney is extremely rare, with only seven cases reported in the literature. The present study described the case of a 17-year-old male, who presented with sudden severe pain in the right flank and a high fever. Imaging studies demonstrated a large soft heterogeneous mass (7.8x9.5x15 cm) located between the liver and right kidney with no clear demarcation, and a well-demarcated mass (1.3x2.4 cm) with patchy dense calcification occupying the left renal pelvis. Following the diagnosis of a Wilms' tumor, the patient underwent a right radical nephrectomy and the pathological diagnosis was MC of the kidney. To the best of our knowledge, the current study presents the first case of MC with bilateral kidney invasion and calcification in the renal pelvis. In addition, the clinical, radiological and pathological features, and the management of this unusual neoplasm were discussed. [ABSTRACT FROM AUTHOR]

Background: Fingolimod efficiently reduces multiple sclerosis (MS) relapse by inhibiting lymphocyte egress from lymph nodes through down-modulation of sphingosine 1-phosphate (S1P) receptors. We aimed to clarify the alterations in peripheral blood T cell subsets associated with MS relapse on fingolimod. Methods/Principal Findings: Blood samples successively collected from 23 relapsing-remitting MS patients before and during fingolimod therapy (0.5 mg/day) for 12 months and 18 healthy controls (HCs) were analysed for T cell subsets by flow cytometry. In MS patients, the percentages of central memory T (CCR7+CD45RO+) cells (TCM) and naïve T (CCR7+CD45RO-) cells decreased significantly, while those of effector memory T (CCR7-CD45RA-) and suppressor precursor T (CD28-) cells increased in both CD4+T and CD8+T cells from 2 weeks to 12 months during fingolimod therapy. The percentages of regulatory T (CD4+CD25highCD127low) cells in CD4+T cells and CCR7-CD45RA+T cells in CD8+T cells also increased significantly. Eight relapsed patients demonstrated greater percentages of CD4+TCM than 15 non-relapsed patients at 3 and 6 months (p=0.0051 and p=0.0088, respectively). The IL17-, IL9-, and IL4-producing CD4+T cell percentages were significantly higher at pre-treatment in MS patients compared with HCs (p<0.01 for all), while the IL17-producing CD4+T cell percentages tended to show a transient increase at 2 weeks of fingolimod therapy (pcorr=0.0834). Conclusions: The CD4+TCM percentages at 2 weeks to 12 months during fingolimod therapy are related to relapse. [ABSTRACT FROM AUTHOR]

Then the patient lay on the left for another rectal observation, and a subtle surface pattern of the rectal mucosa 8 cm above the anal edge was noticed, which did not disappear after gas injection (Figure 1A). The patient had a discoid resection of the rectal wall showing the muscle layer infiltrated by EM. I Dear Sir i , Three patients were diagnosed with endometriosis (EM) and suspected of colorectal involvement on MRI scan, so they were sent for colonoscopy to define the degree of colorectal involvement (Video S1). [Extracted from the article]

Benthic foraminifera fossil shells are particularly useful in reconstructing water depth, temperature, the exported flux of organic carbon to the sea floor, and the level of bottom-water oxygenation in paleoenvironments. In this study, we investigated the living (stained) and dead (thanatocoenoses) benthic foraminifera assemblages collected in surface sediment samples from the Bohai Sea (BS) and the northern Yellow Sea (NYS). The samples were collected from different seasons, i.e. 50 samples in May (spring) and 46 samples in November (autumn). Our benthic foraminifera fauna analysis of these samples shows four living assemblages in May and three in November, indicating a sensitive response to seasonal environmental changes where the fauna live in the modern setting of the BS and NYS. Our redundancy analysis (RDA) of the living assemblages and their corresponding environmental parameters indicates that in spring, the abundances of Astrononion tasmanensis , Nonionella stella and Bulimina sp. have positive correlations with increased water depth, density and salinity, but are negatively correlated with increased FLOUR (chlorophyll). The abundances of Buccella frigid and Verneuilinulla advena are positively correlated with higher levels of dissolved oxygen (DO) and negatively correlated with increases in temperature. The abundances of Cribrononion subincertum are positively correlated with increased turbidity (TURB) and temperature, but negatively correlated with increased DO. In autumn, there is a positive correlation between the abundances of V. advena and increased salinity. Protelphidium tuberculatum , Ammonia beccarii (vars.) abundances, however, have negative correlations with salinity. During the autumn, the benthic foraminifera species P. tuberculatum was noticeably expanded and the dominance areas occupied by Elphidium magellanicum and C. subincertum were significantly reduced in the BS; along the southern coast of the Liaodong Peninsula, the dominant Buccella frigida in the spring was replaced by V. advena in autumn. The seasonal shifting of benthic foraminifera species are local responses to the combined changes in bottom water temperature, salinity, TURB and DO in the BS and NYS, and also to the more intensified autumn/winter intrusion of the Yellow Sea Warm Current (YSWC). The dead assemblages of benthic foraminifera, which are used to reconstruct paleoenvironments, exhibited considerable destruction of agglutinated assemblages. We found that such species as V. advena , Trochammina sp., Ammoscalaria sp. and Polskiammina asiatica are missing from the dead assemblages, possibly due to postmortem taphonomic processes in the BS and NYS. Considerable destruction of agglutinated species in dead assemblages may slightly bias our estimates of paleoenvironmental parameters when they are based on benthic foraminifera fossil shells. [ABSTRACT FROM AUTHOR]

Objectives Multiple sclerosis ( MS) is an inflammatory demyelinating disease of the central nervous system, and is generally considered to be mediated by T helper (Th) 1/Th17 cells. Interferon-β ( IFNβ) is widely used as a disease-modifying MS drug, but its effects on Th17 cells are still disputed. Furthermore, the effects of IFNβ on Th9 cells have not been elucidated. The present study aimed to clarify the effects of IFNβ on cytokines/growth factors in cerebrospinal fluid ( CSF) and cytokine-producing Th cells in peripheral blood. Methods First, the frequency of IFNγ, interleukin ( IL)-17A, IL-9, and IL-4-producing Th cells in peripheral blood lymphocytes was analyzed by flow cytometry in 34 MS patients and 15 healthy volunteers enrolled in the cytokine-producing Th cell study. Second, levels of 27 cytokines/growth factors in the CSF were measured using a multiple fluorescence bead-based immunoassay in 34 MS patients enrolled in the cytokines/growth factors study. Results We found a significantly higher frequency of IL-4− IL-9+ CD4+ T cells and lower frequency of IFNγ+ IL-17A− CD4+ cells in peripheral blood lymphocytes in the 10 MS patients who had received IFNβ than in the 24 MS patients who had not received IFNβ or the 15 healthy controls ( P < 0.05). The seven MS patients who received IFNβ showed significantly lower IL-17A levels in CSF than did the 27 MS patients who had not received IFNβ ( P < 0.05). Conclusions The present results suggest the suppression of IL-17A production in the central nervous system and augmentation of Th9 cells in the peripheral blood by IFNβ in MS patients. [ABSTRACT FROM AUTHOR]

In this study, we present the complete genome of Fimbriimonas ginsengisoli Gsoil 348T belonging to the class Fimbriimonadia of the phylum Armatimonadetes, formerly called as candidate phylum OP10. The complete genome contains a single circular chromosome of 5.23 Mb including a 45.5 kb prophage. Of the 4820 open reading frames (ORFs), 3,000 (62.2%) genes could be classified into Clusters of Orthologous Groups (COG) families. With the split of rRNA genes, strain Gsoil 348T had no typical 16S-23S-5S ribosomal RNA operon. In this genome, the GC skew inversion which was usually observed in archaea was found. The predicted gene functions suggest that the organism lacks the ability to synthesize histidine, and the TCA cycle is incomplete. Phylogenetic analyses based on ribosomal proteins indicated that strain Gsoil 348T represents a deeply branching lineage of sufficient divergence with other phyla, but also strongly involved in superphylum Terrabacteria. [ABSTRACT FROM AUTHOR]

In the area of scientific computing, digital signal processing, communication and image processing, division is one of the widely used basic operations. Based on SRT-8 algorithm, a SIMD floating-point divider is designed? which is compatible to IEEE-754 standard. The divider supports one double precision floating point division and two parallel single precision floating point division on the same hardware platform. It reduces the iterative division calculation time delay and improves the frequency by optimizing the SRT-8 iterative division structure, choosing parallel processing of quotient and residuee addition, and adopting rapid storage technique. Besides, it reduces hardware resources and saves area by adopting reuse strategy. Experiments show that the synthesized cell area is 18 601. 968 1pm2 and the frequency reaches up to 2.5 GHz with 40 nm technology library, and the latency of operation is reduced by 23.81% in comparison to the traditional implementation based on SRT-8. [ABSTRACT FROM AUTHOR]

Recent studies show that the aryl hydrocarbon receptor (AhR) is involved in immune responses. AhR is activated following interaction with its ligands, such as 6-formylindolo[3,2-b]carbazole (FICZ) and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). In this study, we investigated the role of AhR activation by its endogenous ligands in the pathogenesis of ocular Behcet's disease (BD). The expression of AhR was significantly decreased in active BD patients as compared to inactive BD patients and normal controls. Both FICZ and ITE inhibited Th1 and Th17 polarization and induced the expression of IL-22 by PBMCs and by CD4+T cells in active BD patients and normal controls. Stimulation of purified CD4+T cells with FICZ or ITE caused a decreased expression of RORC, IL-17, IL-23R, and CCR6 and an increased phosphorylation of STAT3 and STAT5. The present study suggests that a decreased AhR expression is associated with disease activity in BD patients.The activation of AhR by either FICZ or ITE was able to inhibit Th1 andTh17 cell polarization. Further studies are needed to investigate whether modulation of AhR might be used in the treatment of BD. [ABSTRACT FROM AUTHOR]

Purpose: To further evaluate the effect of intravitreal bevacizumab (IVB) for the treatment of central retinal vein occlusion (CRVO) by meta-analysis. Methods: Pertinent publications were identified through PubMed, EMBASE, and the Cochrane Controlled Trials Register up to January 30, 2013. Changes in central macular thickness (CMT) and best-corrected visual acuity (BCVA) were extracted at 4, 12, and 24 weeks after treatment, and a meta-analysis was carried out to compare results between groups receiving IVB and intravitreal triamcinolone acetonide (IVTA). Results: One randomized controlled trial and 4 comparative studies were identified and included. All of the funnel plots, the Egger's method and Begg method did not show publication bias. Our meta-analysis revealed that BCVA and CMT at 4, 12, and 24 weeks after treatment did not vary significantly between the IVB groups and IVTA groups (BCVA: at 4 weeks, P=0.27; at 12 weeks, P=0.51; at 24 weeks, P=0.64; CMT at 4 weeks, P=0.88; at 12 weeks, P=0.57; at 24 weeks, P=0.64). However, the rate of intraocular pressure rise after intravitreal injection varied significantly between the IVB groups and IVTA groups ( P<0.001). Conclusions: Our results showed a similar improvement in BCVA and CMT among CRVO patients was obtained after intravitreal injections of both IVB, or IVTA, while the rate of IOP rise was significantly higher in the latter. [ABSTRACT FROM AUTHOR]

Background: Atherosclerotic vascular disease (AVD), a leading cause of morbidity and mortality, is increasing in prevalence in the developing world. We describe an approach to establish a biorepository linked to medical records with the eventual goal of facilitating discovery of biomarkers for AVD. Methods: The Vascular Disease Biorepository atMayo Clinic was established to archive DNA, plasma, and serum from patients with suspected AVD. AVD phenotypes, relevant risk factors and comorbid conditions were ascertained by electronic medical record (EMR)-based electronic algorithms that included diagnosis and procedure codes, laboratory data and text searches to ascertain medication use. Results: Up to December 2012, 8800 patients referred for vascular ultrasound examination and non-invasive lower extremity arterial evaluation were approached, of whom 5268 consented. The mean age of the initial 2182 patients recruited was 70.4 ± 11.2 years, 62.6% were men and 97.6% were whites. The prevalences of AVD phenotypes were: carotid artery stenosis 48%, abdominal aortic aneurysm 21% and peripheral arterial disease 38%. Positive predictive values for electronic phenotyping algorithms were > 0.90 for cases (and > 0.95 for controls) for each AVD phenotype, using manual review of the EMR as the gold standard. The prevalences of risk factors and comorbidities were as follows: hypertension 78%, diabetes 29%, dyslipidemia 73%, smoking 70%, coronary heart disease 37%, heart failure 12%, cerebrovascular disease 20% and chronic kidney disease 19%. Conclusions: Our study demonstrates the feasibility of establishing a biorepository of plasma, serum and DNA, with relatively rapid annotation of clinical variables using EMR-based algorithms. [ABSTRACT FROM AUTHOR]

Background: To further evaluate the effect of intravitreal bevacizumab (IVB) for the treatment of branch retinal vein occlusion in a meta-analysis of previous studies. Methods: Pertinent publications were identified through systemic searches of PubMed, EMBASE, and the Cochrane Controlled Trials Register up to July 2012. Data on central macular thickness and best-corrected visual acuity obtained at 4 and 12 weeks after treatment were extracted. Groups of patients receiving IVB were compared with control groups. Results: Four randomized controlled and 3 comparative studies were included. A publication bias was not detected by funnel plots, the Egger method, or the Begg method. Best corrected visual acuity measured at 4 and 12 weeks after baseline increased significantly in the IVB groups as compared with the control groups [4 weeks: weighted mean deviation (WMD)=−0.09; 95% confidence interval (CI): −0.12, −0.05; P<0.001; at 12 weeks: WMD=−0.21; 95% CI: −0.30, −0.12; P<0.001]. Similarly, reduction in central macular thickness at 12 weeks after baseline was significantly higher in the IVB groups than in the control groups (WMD=−29.02; 95% CI: −50.56, −7.49; P=0.008). The change in central macular thickness at 4 weeks after baseline did not vary significantly between the IVB groups and control groups (WMD=−20.48; 95% CI: −67.30, 26.34; P=0.39). All included studies taken separately reported on a significant increase in visual acuity in the IVB groups. Conclusions: Patients with branch retinal vein occlusion experienced a significant benefit in terms of visual improvement and reduction in central macular thickness after the intravitreal injection of bevacizumab. [ABSTRACT FROM AUTHOR]

Abstract: A headspace-solid phase microextraction-gas chromatography–mass spectrometric (HS-SPME-GC–MS, hereafter abbreviated as “SPME”) method was developed for dedicated organophosphorus (OP) pesticides assessment in multiple vegetable and fruit commodities. Specific extraction variables were optimised to achieve harmonised extraction performance of eleven OPs in a great span of seven characteristic commodities cataloged in Codex Alimentarius Commission. Comprehensive validation study confirmed analytical robustness of the SPME treatment in turnip, green cabbage, French beans, eggplant, apple, nectarine and grapes. Based on range-specific evaluation, extraction of individual OPs was characterised by sub-ppb level sensitivity and a wide 0.01–2.5mgL−1 dynamic range. Effective sample clean-up afforded precise quantification (0.5–10.9% R.S.D.) within a 70–120% recovery range at the MRL levels specified for individual commodities. Compared to conventional methods currently used, the SPME treatment developed here is quick, accurate, and relatively environmental friendly; it represents an attractive, practical way to deliver international standards in OP screening routines. [Copyright &y& Elsevier]

Drugs and bioactive natural products exert their pharmacological effects by engaging numerous cellular targets in our body. Identification of these protein targets is essential for understanding the mechanism-of-action of these compounds, thus contributing to improved drug design in drug discovery programs. Termed "in situ drug profiling", a common strategy for studying these bioactive compounds centralized on the covalent capture of protein targets along with a reporter tag to facilitate downstream proteomic analyses. Though highly successful, such reliance on innate electrophilic traps to facilitate covalent capture restricted its applications to covalent acting compounds. Late-stage C--H functionalization (LSF) may resolve this by substituting biologically inert C--H bonds with desired electrophilic groups. Herein, we demonstrated this concept by arming a diverse range of electron-rich aromatic drugs and natural products with α,β-unsaturated esters, via late-stage C--H olefination with an arylthio-based carboxylic acid ligand developed by Ibanez and co-workers. We also showed that covalent probes generated from this LSF approach could be applied for "in situ drug profiling" of Δ8-THC, as exemplified by the successful target engagement of α-4db, a Δ8-THC-based probe, to its native target hCB2R. In combination with AfBP 7, a photoaffinity-based derivative of Δ8-THC, we identified several novel putative targets that could account for some of the effects in THC consumption. We anticipate our C--H LSF strategy to be widely adopted for future studies of noncovalent drugs. [ABSTRACT FROM AUTHOR]