Search

Background: Early response to treatment has been shown to be a predictor of later clinical outcomes in eating disorders (EDs). Specifically, early weight gain trajectories in anorexia nervosa (AN) have been shown to predict higher rates of later remission in inpatient treatment. However, no study has, as of yet, examined this phenomenon within outpatient treatment of first episode cases of AN or in emerging adults., Methods: One hundred seven patients with AN, all between the ages of 16 and 25 and with an illness duration of < 3 years, received treatment via the first episode rapid early intervention in eating disorders (FREED) service pathway. Weight was recorded routinely across early treatment sessions and recovery outcomes (BMI > 18.5 kg/m 2 and eating psychopathology) were assessed up to 1 year later. Early weight gain across the first 12 treatment sessions was investigated using latent growth mixture modelling to determine distinct classes of change. Follow-up clinical outcomes and remission rates were compared between classes, and individual and clinical characteristics at baseline (treatment start) were tested as potential predictors., Results: Four classes of early treatment trajectory were identified. Three of these classes (n = 95), though differing in their early change trajectories, showed substantial improvement in clinical outcomes at final follow-up. One smaller class (n = 12), characterised by a 'higher' start BMI (> 17) and no early weight gain, showed negligible improvement 1 year later. Of the three treatment responding groups, levels of purging, depression, and patient reported carer expressed emotion (in the form of high expectations and low tolerance of the patient) determined class membership, although these findings were not significant after correcting for multiple testing. A higher BMI at treatment start was not sufficient to predict optimal clinical outcomes., Conclusion: First episode cases of AN treated via FREED fit into four distinct early response trajectory classes. These may represent subtypes of first episode AN patients. Three of these four trajectories included patients with substantial improvements 1 year later. For those in the non-response trajectory class, treatment adjustments or augmentations could be considered earlier, i.e., at treatment session 12., (© 2021. The Author(s).)

Neuroinflammation is a key part of the etio-pathogenesis of Alzheimer's disease (AD). We tested the relationship between neuroinflammation and the disruption of functional connectivity in large-scale networks, and their joint influence on cognitive impairment. We combined [ 11 C]PK11195 positron emission tomography (PET) and resting-state functional magnetic resonance imaging (rs-fMRI) in 28 patients (12 females/16 males) with clinical diagnosis of probable AD or mild cognitive impairment with positive PET biomarker for amyloid, and 14 age-, sex-, and education-matched healthy controls (8 females/6 males). Source-based "inflammetry" was used to extract principal components of [ 11 C]PK11195 PET signal variance across all participants. rs-fMRI data were preprocessed via independent component analyses to classify neuronal and non-neuronal signals. Multiple linear regression models identified sources of signal covariance between neuroinflammation and brain connectivity profiles, in relation to the diagnostic group (patients, controls) and cognitive status.Patients showed significantly higher [ 11 C]PK11195 binding relative to controls, in a distributed spatial pattern including the hippocampus, frontal, and inferior temporal cortex. Patients with enhanced loading on this [ 11 C]PK11195 binding distribution displayed diffuse abnormal functional connectivity. The expression of a stronger association between such abnormal connectivity and higher levels of neuroinflammation correlated with worse cognitive deficits.Our study suggests that neuroinflammation relates to the pathophysiological changes in network function that underlie cognitive deficits in Alzheimer's disease. Neuroinflammation, and its association with functionally-relevant reorganization of brain networks, is proposed as a target for emerging immunotherapeutic strategies aimed at preventing or slowing the emergence of dementia. SIGNIFICANCE STATEMENT Neuroinflammation is an important aspect of Alzheimer's disease (AD), but it was not known whether the influence of neuroinflammation on brain network function in humans was important for cognitive deficit. Our study provides clear evidence that in vivo neuroinflammation in AD impairs large-scale network connectivity; and that the link between neuro inflammation and functional network connectivity is relevant to cognitive impairment. We suggest that future studies should address how neuroinflammation relates to network function as AD progresses, and whether the neuroinflammation in AD is reversible, as the basis of immunotherapeutic strategies to slow the progression of AD., (Copyright © 2019 Passamonti et al.)

Field monitoring of groundwater contamination plumes is an important component of managing risks for downgradient receptors and remedial strategies that rely on monitored natural attenuation. Collection of groundwater quality data can however take a considerable effort and be associated with high cost. Here, we investigated the relative merits of analyzing groundwater quality data using spatial compared to spatiotemporal statistical modelling and assessed the accuracy of both methods and implications for data collection requirements. The aim of this was to determine whether the quantity of data collected can be reduced, while retaining the same level of estimation accuracy, by analyzing groundwater contamination data using a spatiotemporal model which "borrows strength" across time, rather than a spatial model for individual sampling events. To capture the variability encountered under field conditions, we used three hypothetical groundwater contamination plumes with increasing complexity, and site data for a large groundwater gasoline additive plume. The results show that spatiotemporal methods can increase efficiency markedly so that, in comparison with repeated spatial analysis, spatiotemporal methods can achieve the same level of performance but with smaller sample sizes., (Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.)

Introduction: Semantic dementia, including the semantic variant of primary progressive aphasia (svPPA), is strongly associated with TAR-DNA binding protein 43 (TDP-43) type C pathology. It provides a useful model in which to test the specificity of in vivo binding of the putative tau ligand [ 18 F]AV-1451, which is elevated in frontotemporal lobar degeneration tauopathies., Methods and Results: Seven patients (five with svPPA and two with 'right' semantic dementia) and 12 healthy controls underwent positron emission tomography brain imaging with [ 18 F]AV-1451. Two independent preprocessing methods were used. For both methods, all patients had clearly elevated binding potential (BP ND (non-displaceable binding potential)) in temporal lobes, lateralising according to their clinical syndrome and evident in raw images. Region of interest analyses confirmed that BP ND was significantly increased in temporal regions, insula and fusiform gyrus, consistent with those areas known to be most affected in semantic dementia. Hierarchical cluster analysis, based on the distribution of [ 18 F]AV-1451 binding potential, separated semantic dementia from controls with 86% sensitivity and 100% specificity., Conclusions: [ 18 F]AV-1451 binds in vivo regions that are likely to contain TDP-43 and not significant tau pathology. While this suggests a non-tau target for [ 18 F]AV-1451, the pathological regions in semantic dementia do not normally contain significant levels of recently proposed 'off target' binding sites for [ 18 F]AV-1451, such as neuronal monoamine oxidase or neuromelanin. Postmortem and longitudinal data will be useful to assess the utility of [ 18 F]AV-1451 to differentiate and track different types of frontotemporal lobar degeneration., Competing Interests: Competing interests: None declared., (© Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.)

Fitting statistical models to spatiotemporal data requires finding the right balance between imposing smoothness and following the data. In the context of P-splines, we propose a Bayesian framework for choosing the smoothing parameter, which allows the construction of fully automatic data-driven methods for fitting flexible models to spatiotemporal data. An implementation, which is highly computationally efficient and exploits the sparsity of the design and penalty matrices, is proposed. The findings are illustrated using a simulation study and two examples, all concerned with the modelling of contaminants in groundwater. This suggests that the proposed strategy is more stable that competing methods based on the use of criteria such as generalised cross-validation and Akaike's Information Criterion. © 2015 The Authors. Environmetrics Published by John Wiley Sons Ltd.

This experiment was conducted to determine the effect of high levels of supplemental Cu (as (CuSO4).5H2O) on the serum lipid profile and carcass traits of goat kids. Fifteen Boer x Spanish wether goat kids (BW = 21.3 +/- 0.7 kg) were housed in individual pens and were assigned randomly to 1 of 3 treatments. Treatments consisted of 1) control (no additional supplemental Cu), 2) 100 mg of Cu/d, and 3) 200 mg of Cu/d. Copper sulfate was placed in gelatin capsules and inserted into the esophagus via a balling gun before the morning feeding. Animals were fed a high-concentrate (70:30 grain:hay) diet for 112 d. Serum lipid profile was determined on d 14 and 112, and BW was recorded after 4-h withdrawals from feed and water. After 112 d, animals were slaughtered, and carcass traits were measured. The left half of 12 carcasses and 9th to 11th rib sections from the right side of 15 carcasses were dissected into separable soft tissue and bone portions. The soft tissue portion was analyzed for moisture, ether extract, CP, and ash. Average daily feed intake decreased (linear; P = 0.05), and G:F increased (quadratic; P = 0.02) in the 100 mg of Cu/d group. Serum cholesterol and triglycerides did not change (P > 0.10); however, NEFA decreased (linear; P = 0.01) as supplemental Cu increased. No differences were observed (P > 0.10) in HCW, chilled carcass weight, or kidney and pelvic fat; however, 12th rib fat (linear; P = 0.01) and adjusted fat thickness (linear; P = 0.03) decreased as Cu supplementation increased. No differences (P > 0.10) in LM area were observed; however, percentage of boneless closely trimmed retail cuts increased (linear; P = 0.04) as Cu supplementation increased. The moisture (%) of the 9th to 11th rib sections increased (linear; P = 0.03), ether extract (%) decreased (linear; P = 0.02), and CP and ash (%) tended to increase (linear; P = 0.09 and 0.06, respectively) as Cu supplementation increased. Carcass composition measured using the left half of the carcass confirmed the values obtained through the 9th to 11th rib sections. Results of this study indicate that supplemental Cu can alter the serum lipid profile, carcass characteristics, and carcass composition of goat kids.

Duroc-cross pigs (n = 25) were assigned to one of three experimental finishing diets containing 0 (control), 40,000 (40), or 80,000 (80) IU of supplemental vitamin D3/kg of feed (as-fed basis)to test the effects of vitamin D3 on pork quality traits. Experimental diets were fed for 44 or 51 d before slaughter, and days on feed were blocked in the experimental design. A trend existed for pigs receiving the highest concentration of vitamin D3 supplementation to have a lower (P = 0.08) ADG (0.77 kg/d) compared with pigs fed either the 40-diet (0.88 kg/d) or control (0.92 kg/d). Diet did not (P > 0.10) affect backfat thickness measured along the midline, 10th-rib fat depth, longissimus muscle area, muscle score, or hot carcass weights. Longissimus pH, measured at 0.5, 1, 2, 3, 4, and 24 h postmortem, was higher (P < 0.05) for pigs on the 80-diet than those fed the control diet. Longissimus muscle color, measured at 24 h postmortem, from pigs fed either the 40- or 80-diet were darker (lower L* values; P < 0.05) than those fed the control diet. Objective longissimus color scores were higher (P < 0.01), and firmness/wetness scores lower (P < 0.05), for pigs on the 80-diet as compared to those on the 40-diet or control diet. The diet had no (P > 0.10) effect on Warner-Bratzler shear force values; percentage of cook loss; or trained sensory panel evaluations for tenderness, juiciness, and flavor. Feeding the 80-diet increased (P < 0.05) plasma vitamin D3 and calcium after 2, 4, and 6 wk on feed compared with the control diet. Vitamin D3 and 25-hydroxy vitamin D3 concentrations in the longissimus muscle increased (P = 0.001) with increasing vitamin D3 levels in the diet; however, muscle calcium concentrations and fiber type were not (P > 0.30) affected by diet. These results indicate that feeding supranutritional levels of vitamin D3 for at least 44 d improves pork color and increases pH, but may retard growth if fed at 80,000 IU/kg of feed.

Objective: To gain insight into the function of cyclin-dependent kinase 5 (Cdk5) in spermatogenesis., Design: The expression of the Cdk5 protein was determined with the use of immunohistochemical and immunoblot analysis., Setting: Academic research laboratory., Animal(s): Adult mouse and archival human testicular tissue were used for the immunohistochemical analysis. Adult mice were used as the source of tissues for the immunoblot analysis., Intervention(s): The immunohistochemical analysis was performed with an anti-Cdk5 antibody. The double immunohistochemical analysis was performed with anti-Cdk5 and alpha-tubulin antibodies. Immunoblotting was used to examine multiple mouse tissues for Cdk5 expression., Main Outcome Measure(s): Analysis of Cdk5 protein distribution., Result(s): Cdk5 was localized specifically within the cytoplasm of Sertoli cells and meiotic metaphase germ cells. The double immunohistochemistry analysis demonstrated the co-localization of Cdk5 and alpha-tubulin within the Sertoli cells. Western blot analysis revealed a high level of expression of Cdk5 in the testicular lysate., Conclusion(s): The cyclin-dependent kinases are known regulators of the cell cycle; however, Cdk5 expression previously has been described in terminally differentiated cells of the brain. The present evidence of an association between Cdk5 and microfilaments of Sertoli cells and meiotic metaphase germ cells suggests a role of Cdk5 in both seminiferous tubule function and meiosis.

The objectives of this study were to determine whether vitamin E supplementation influences color and tenderness of beef injected with calcium chloride. Market heifers (n = 12) were fed a standard finishing diet with minimal levels of vitamin E (NE group). Another 12 market heifers were fed the NE diet with the inclusion of 1,000 IU/d of DL-alpha-tocopherol per animal for the last 125 d on feed (E group). Animals were slaughtered after 125 d on the diets and upon reaching an ultrasound backfat thickness > 10 mm. Half of the longissimus muscles from each treatment group (NE and E) were pumped to 10% over the original weight with 250 mM CaCl2 (Ca) at 24 h postmortem. Remaining muscles (NE and E) were pumped to 10% over the original weight with water (NC) at 24 h postmortem. After equilibrating overnight, steaks (2.54 cm) were overwrapped with O2-permeable film and stored for 7 d after injection. Hunter "L," "a," and "b" values were obtained each day of storage. Trained panelists evaluated color on d 1, 4, and 7 after injection. 2-Thiobarbituric acid-reactive substances (TBARS) values were measured on d 1 and 7 after injection. Warner-Bratzler (W-B) shear force values and trained sensory panel evaluations at 1, 3, and 7 d after injection were obtained. Immunoblotting techniques were used to monitor the 30-kDa degradation product of troponin-T at 1, 3, and 7 d after injection. At 4 d after injection, E/Ca steaks were the least discolored (P < 0.05). The E/Ca steak TBARS values were not significantly different from values for NE/NC steaks at 7 d after injection, whereas NE/Ca steaks had greater (P < 0.05) TBARS values after 7 d following injection compared with all other groups. Treatment with Ca resulted in higher off-flavor scores (P < 0.05). The E/Ca samples had the most rapid tenderization and proteolysis of all treatment groups. Warner-Bratzler shear values were lower in the E/Ca samples than in the E/NC samples at 1, 3, and 7 d after injection (P < 0.05). No difference in shear force was noted between NE/Ca and NE/NC samples at any time point. No difference in sensory tenderness was noted between NE/Ca and NE/NC samples at 1 d after injection. However, Ca-injected samples (NE/Ca and E/Ca) were rated as being significantly more tender than their uninjected counterparts (NE/NC and E/NC) at 3 and 7 d after injection. Injection of CaCl2 may result in more rapid and immediate tenderization if beef from animals supplemented with vitamin E is used. Vitamin E incorporation into muscle tissue may potentiate the action of exogenously added calcium by protecting the calpains from oxidation.

Topoisomerase II is the target for several anticancer drugs that "poison" the enzyme and convert it to a cellular toxin by increasing topoisomerase II-mediated DNA cleavage. In addition to these "exogenous topoisomerase II poisons," DNA lesions such as abasic sites act as "endogenous poisons" of the enzyme. Drugs and lesions are believed to stimulate DNA scission by altering the structure of the double helix within the cleavage site of the enzyme. However, the structural alterations that enhance cleavage are unknown. Since abasic sites are an intrinsic part of the genetic material, they represent an attractive model to assess DNA distortions that lead to altered topoisomerase II function. Therefore, the structure of a double-stranded dodecamer containing a tetrahydrofuran apurinic lesion at the +2 position of a topoisomerase II DNA cleavage site was determined by NMR spectroscopy. Three major features distinguished the apurinic structure ( = 0.095) from that of wild-type ( = 0.077). First, loss of base stacking at the lesion collapsed the major groove and reduced the distance between the two scissile phosphodiester bonds. Second, the apurinic lesion induced a bend that was centered about the topoisomerase II cleavage site. Third, the base immediately opposite the lesion was extrahelical and relocated to the minor groove. All of these structural alterations have the potential to influence interactions between topoisomerase II and its DNA substrate.

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

The mechanical environment of the chondrocyte is an important factor that influences the maintenance of the articular cartilage extracellular matrix. Previous studies have utilized theoretical models of chondrocytes within articular cartilage to predict the stress-strain and fluid flow environments around the cell, but little is currently known regarding the cellular properties which are required for implementation of these models. The objectives of this study were to characterize the mechanical behavior of primary human chondrocytes and to determine the Young's modulus of chondrocytes from non-osteoarthritic ('normal') and osteoarthritic cartilage. A second goal was to quantify changes in the volume of isolated chondrocytes in response to mechanical deformation. The micropipette aspiration technique was used to measure the deformation of a single chondrocyte into a glass micropipette in response to a prescribed pressure. The results of this study indicate that the human chondrocyte behaves as a viscoelastic solid. No differences were found between the Young's moduli of normal (0.65+/-0.63 kPa, n = 44) and osteoarthritic chondrocytes (0.67+/-0.86 kPa, n = 69, p = 0.93). A significant difference in cell volume was observed immediately and 600 s after complete aspiration of the cell into the pipette (p < 0.001), and the magnitude of this volume change between normal (11+/-11%, n = 40) and osteoarthritic (20+/-11%, n = 41) chondroctyes was significantly different at both time points (p < 0.002). This finding suggests that chondrocytes from osteoarthritic cartilage may have altered volume regulation capabilities in response to mechanical deformation. The mechanical and volumetric properties determined in this study will be of use in analytical and finite element models of chondrocyte-matrix interactions in order to better predict the mechanical environment of the cell in vivo.

Introduction: Chondrocytes in articular cartilage utilize mechanical signals to regulate their metabolic activity. A fundamental step in determining the role of various biophysical factors in this process is to characterize the local mechanical environment of the chondrocyte under physiological loading., Methods: A combined experimental and theoretical approach was used to quantify the in-situ mechanical environment of the chondrocyte. The mechanical properties of enzymatically-isolated chondrocytes and their pericellular matrix (PCM) were determined using micropipette aspiration. The values were used in a finite element model of the chondron (the chondrocyte and its PCM) within articular cartilage to predict the stress-strain and fluid flow microenvironment of the cell. The theoretical predictions were validated using three-dimensional confocal microscopy of chondrocyte deformation in situ., Results: Chondrocytes were found to behave as a viscoelastic solid material with a Young's modulus of approximately 0.6 kPa. The elastic modulus of the PCM was significantly higher than that of the chondrocyte, but several orders of magnitude lower than that of the extracellular matrix. Theoretical modeling of cell-matrix interactions suggests the mechanical environment of the chondrocyte is highly non-uniform and is dependent on the viscoelastic properties of the PCM. Excellent agreement was observed between the theoretical predictions and the direct measurements of chondrocyte deformation, but only if the model incorporated the PCM., Conclusions: These findings imply that the PCM plays a functional biomechanical role in articular cartilage, and alterations in PCM properties with aging or disease will significantly affect the biophysical environment of the chondrocyte.

Quantitative methods have been developed for the analysis of chemical warfare agent degradation products in reaction masses using capillary electrophoresis (CE). This is the first report of a systematic validation of a CE-based method for the analysis of chemical warfare agent degradation products in agent neutralization matrixes (reaction masses). After neutralization with monoethanolamine/water, the nerve agent GB (isopropyl methylphosphonofluoridate, Sarin) gives isopropyl methylphosphonic acid (IMPA) and O-isopropyl O'-(2-amino)ethyl methylphosphonate (GB-MEA adduct). The nerve agent GD (pinacolyl methylphosphonofluoridate, Soman), [pinacolyl = 2-(3,3-dimethyl)butyl] produces pinacolyl methylphosphonic acid (PMPA) and O-pinacolyl O'-(2-amino)ethyl methylphosphonate (GD-MEA adduct). The samples were prepared by dilution of the reaction masses with deionized water before analysis by CE/indirect UV detection or CE/conductivity detection. Migration time precision was less than 4.0% RSD for IMPA and 5.0 RSD for PMPA on a day-to-day basis. The detection limit for both IMPA and PMPA is 100 micrograms/L; the quantitation limit for both is 500 micrograms/L. For calibration standards, IMPA and PMPA gave a linear response (R2 = 0.9999) over the range 0.5-100 micrograms/mL. The interday precision RSDs were 1.9, 1.0, and 0.7% for IMPA at 7.5, 37.5 and 75.0 micrograms/mL, respectively. Corresponding values for PMPA (again, RSD) were 2.9, 1.1, and 1.0% at 7.5, 37.5 and 87.5 micrograms/mL, respectively, as before. Analysis accuracy was assessed by spiking actual neutralization samples with IMPA or PMPA. For IMPA, the seven spike levels used ranged from 20 to 220% of the IMPA background level, and the incremental change in the found IMPA level ranged from 86 to 99 % of the true spiking increment (R2 = 0.9987 for the linear regression). For PMPA, the five spike levels ranged from 10 to 150% of the matrix background level, and similarly, the accuracy obtained ranged from 95 to 97% of the true incremental value (R2 = 0.9999 for the linear regression).

The refined solution structure for the 8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 adduct was refined from the oligodeoxynucleotide duplex d(TATAFBGCATA)2 using a molecular dynamics protocol restrained by NOE data obtained from 1H NMR and compared with the refined structure of the unmodified oligomer, d(TATGCATA)2. The two aflatoxin B1 (AFB1) moieties were symmetry related by the pseudodyad axis of the self-complementary oligodeoxynucleotide. Each AFB1 intercalated into the helix above the 5'-face of the modified guanine, corroborating NMR spectroscopic data [Gopalakrishnan, S., Harris, T. M., and Stone, M. P. (1990) Intercalation of Aflatoxin B1 in Two Oligodeoxynucleotide Adducts: Comparative 1H NMR Analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2 Biochemistry 29, 10438-10448]. Molecular dynamics calculations restrained with 292 experimentally and empirically derived distances refined a family of structures characterized by pairwise root mean square differences of <1.3 A. Complete relaxation matrix calculations yielded a sixth root residual of 11 x 10(-2). Comparison of the refined structure with that of the corresponding unmodified oligodeoxynucleotide suggested that the two AFB1 adducts introduced a perturbation of the DNA localized at the two sites of adduction. The calculations predicted that each adduct introduced a "kink" into the DNA helical axis. However, the pseudodyad symmetry relating the two intercalation sites resulted in no net bending of the DNA. The results suggest the possibility that AFB1 lesions at adjacent guanines in the 5'-GC-3' sequence may be recognized or processed differently than are isolated AFB1 lesions.

Capillary electrophoresis with conductivity detection is evaluated for quantitative analysis of anions at low- to sub-ppb concentration levels in the presence and absence of a conductive sample matrix composed of 2 ppm ammonia and 50 ppb hydrazine. The low-level sensitivity is extended by a transient isotachophoretic stacking procedure. The linear range of the CE system and conductivity detector is graphically evaluated on the basis of absolute and corrected (normalized) chloride and sulfate peak profiles using an ASTM linearity criterion. The influence of random contamination bias from ubiquitous entities of nonsample chloride and sulfate levels introduced by liquid handling, laboratory atmosphere, and bulk chemical residues is quantitatively compared against an internal (contamination) reference ion.

The aim of this study was to determine whether cultured trophoblast tissues, derived from the trophectoderm of marmoset monkey blastocysts, contain homologues of human trophoblast antigens. This is an essential prerequisite to determine whether the marmoset may be a suitable model for preclinical testing of a human antitrophoblast antigen for fertility regulation. Previously evaluated monoclonal antibodies from the Flinders University laboratory, which reacted with human trophoblast with a high degree of specificity, were tested for immunohistochemical reactivity using an immunoperoxidase detection method on both frozen and paraformaldehyde-fixed sections of the cultured marmoset monkey trophoblast. All monoclonal antibodies raised against human placenta reacted positively, when compared to controls, suggesting that human and marmoset trophoblast cells share common epitopes. The specificity of the monoclonal antibodies was investigated by determining whether there was cross-reactivity with other marmoset monkey tissues, including adrenal, spleen, kidney, liver, muscle, ovary and testis. The specificities of the monoclonal antibodies on these marmoset tissues were similar to those previously found on the corresponding human tissues. We have concluded that marmoset monkey trophoblast exhibits homologues of human trophoblast antigens. The findings also suggest that marmoset monkeys should be evaluated further as a primate model to test suitable target antigens for antitrophoblast vaccines that may be useful contragestation agents in humans.

We report the development of analyses for nerve agent degradation products or related species by the reversal of electroosmotic flow in capillary electrophoresis (CE). The developed methods were used in this laboratory for analysis of samples in the second and third official proficiency tests (International Round-Robins) for the Provisional Technical Secretariat/Preparatory Commission for the Organization for the Prohibition of Chemical Weapons, and those results are reported here. Analytes studied include methylphosphonic acid (a dibasic acid), the monoisopropyl ester of ethylphosphonic acid, and the monoalkyl esters of methylphosphonic acid (R = ethyl, isopropyl, isobutyl, pinacolyl (3,3-dimethyl-2-butyl), cyclohexyl, and 2-ethylhexyl). The cationic surfactants used here for the reversal of electroosmotic flow are didodecyldimethylammonium hydroxide and cetyltrimethylammonium hydroxide. CE methods using conductivity or indirect UV detection provide a good separation efficiency and very high sensitivity for the analysis of such compounds. The detection limits for these species were about 75 micrograms/L when using conductivity detection and about 100 micrograms/L when using indirect UV detection. Because pH plays an important role in the CE separation of the alkylphosphonic acids and their monoesters, the influence of pH on these separation systems was investigated. Electrolytes were stable for at least 3 months. Excellent separation efficiency and freedom from interference due to common anions were obtained in the developed methods which typically achieved complete separations in less than 3 min. The method was applied to aqueous leachates of soil, wipes of surfaces, and vegetation sampled from a field site known to have been exposed to nerve agents and subsequently cleaned up. The data from these environmental samples indicated that the method can be expected to be useful for environmental monitoring.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

The advent of immunocontraceptives represents the first truly novel approach to the development of family planning methods in over 30 years. Such products would have many advantages over existing contraceptives in that they would not elicit metabolic disturbances, would provide long-acting (i.e. 6 to 12 months) protection from pregnancy, be easy to administer, be economical to manufacture and distribute, and could, depending on their composition, be used by either men or women. Several lines of research and development currently in progress are aimed at the development of safe and effective immunocontraceptives based on reproductive hormones, components of the gametes (sperm and ova) and products of the early pre-implantation conceptus. The only prototype immunocontraceptives to have reached the stage of clinical trials in women are those based on the hormone human chorionic gonadotropin, and in men that based on follicle-stimulating hormone. However, extensive research is also underway on immunocontraceptives based on sperm and ovum components for use by women, and on immunocontraceptives based on sperm components and gonadotropin-releasing hormone for use by men. Before such preparations can be made available for wide-scale use, further research is needed on ways to overcome genetically determined variations in individual immune responses so that protective responses of a predetermined duration can be elicited in all recipients. It is anticipated that these technical problems can be solved and the clinical testing of lead products will be completed in the next decade. Almost all of the financial support for the research and development of immunocontraceptives has been provided by academic institutions and public sector agencies. In general, the pharmaceutical industry has not been willing to engage in new contraceptive development, largely because of concerns about product liability claims, anticipated low profitability and/or the risk of negative publicity. Therefore, the further development, manufacture and distribution of immunocontraceptives will probably require the collaboration of public sector agencies, governments and industry in order to overcome the current paucity of effort being put into the development and provision of new, safe, effective and acceptable methods of family planning. The purpose of this review is to provide information on the current status of research and development of potential immunocontraceptives and to attempt to stimulate pharmaceutical companies to reassess their positions with regard to the development, manufacture and distribution of these products.

This study was designed to identify the intrapersonal, interpersonal and extrapersonal stressors of primary caregivers caring for a traumatic-head-injured person. Betty Neuman's (1989) theoretical model provides a conceptual framework for studying the relationship between stressors and the changing stress level of primary caregivers caring for a traumatic-head-injured person. The Appraisal Caregiving Scale and the Burden Interview were administered to 23 caregivers. Intrapersonal, interpersonal and extrapersonal stressors are identified. Caregivers differed in the changing stress level they experienced. Positive correlations were found between the intrapersonal stressors and the changing stress level and the interpersonal stressors and the changing stress level.

A cocktail of trophoblast-reactive monoclonal antibodies (MAbs) is required for efficient isolation of trophoblasts from maternal blood. A modified antibody screening procedure was used to identify a clone, in a COS cell placental cDNA expression library, that expressed the gene product recognized by MAb FDO202N. The antigen recognised by MAb FDO202N was identified as human placental lactogen (hPL) hormone. hPL hormone is secreted into the maternal blood by trophoblasts at high levels during pregnancy. Immunohistochemical localization of hPL hormone was consistent with expression in the syncytiotrophoblast and extravillous cytotrophoblast. A model system was used where known numbers of syncytiotrophoblast sprouts were seeded into saline or maternal blood, bound by trophoblast-specific MAbs, recovered magnetically, and then counted. MAb FDO202N was shown to facilitate the efficient recovery of trophoblast sprouts from saline and maternal blood.

Twenty-one beef strip loins (Institutional Meat Purchasers Specification #180) were cut into equal halves. One-half of each loin was sprayed with a mixture of 2% lactic acid and 2% (vol/vol) acetic acid and the corresponding half was used as a control. The strip loins were stored at -1°C for 0, 7, 14, 28, 56, 84, or 112 days and evaluated for chemical, physical, and microbial properties. The internal pH increased significantly ( P < 0.05) beginning at day 56 for all products. Vacuum scores and visible purge scores showed that these qualities became less desirable over storage time. There were no significant differences ( P > 0.05) for meat color, fat color, or odor over storage time. Acid-treated strip loins had significantly lower ( P < 0.05) visible purge scores than control strip loins. Internal and external pH, vacuum, meat color, fat color, and odor were not affected by acid treatment. In a calculation of time-by-treatment interaction ( P < 0.05), acid-sprayed strip loins had less percentage of purge than corresponding controls at 56 and 112 days of storage. Water-holding capacity decreased over 84 days of storage. Anaerobes, lactic acid-producing bacteria, and psychrotroph populations increased significantly ( P < 0.05) over storage time but anaerobes and lactic acid-producing bacteria were reduced by acid treatment. Acid-sprayed strip loins had significantly lower aerobic ( P < 0.05) and psychrotrophic ( P < 0.1) populations than controls after 14 days. These data indicate that an acid spray immediately prior to packaging can reduce some species of bacteria without adversely affecting the physical properties of products stored for 112 days at -1°C.

The basic principle of a contraceptive (or anti-fertility) vaccine is to use the body's own immune defence mechanisms to provide protection against an unplanned pregnancy. Factors such as: economic production, convenience of use, relatively long-lasting but reversible action, low failure rate, and the avoidance of mechanical devices or exogenous hormones make this approach a potentially attractive option for family planning programmes in both developing and developed countries. The major efforts in research and development have involved the prospect of active immunization against specific antigens of sperm, ovum, zygote and early embryo, and the pregnancy hormone hCG. Several anti-hCG vaccines have entered clinical trials and show promising results. These vaccines operate by preventing or interrupting pregnancy at the peri-implantation stage probably by neutralizing the luteotrophic action of hCG. The most refined vaccine is one directed against the unique C-terminal peptide on the beta-subunit of hCG. This vaccine provokes antibodies that are specific for hCG and do not cross react with hLH. Future research efforts aim to optimize the anti hCG approach, utilize new vaccine delivery systems, and broaden the spectrum of target antigens of potential utility for contraceptive vaccines.

Conductivity detection in CE has recently become available in a commercial CE instrument. The new conductivity cell is based on an end-capillary concept. The conductivity sensor and the detection end of the fused-silica capillary are permanently encapsulated in two individually modified coupling connectors (ConTip, ConCap [both from Orion Research, Boston, MA, U.S.A.]). This open-architecture cell permits interchangeability of sensors and capillaries, while maintaining a precisely defined detection volume between those two components when inserted into the detector cell block. The detector's performance is evaluated for sensitivity, linearity, and reproducibility using low-mobility electrolytes. Electropherograms comprising a variety of ionic class separations including inorganic and organic anions, organic surfactants, alkali metals, alkaline earths, transition metals, and organic amines are shown along with separations of actual samples.

Autoimmune diseases are relatively common in women, and tend to occur in the childbearing years. These disorders fall broadly into two groups: (i) Multisystem diseases such as systemic lupus erythematosus (SLE) and related connective tissue disorders (CTD). This group includes the 'pre-clinical' antiphospholipid or lupus obstetric syndrome which may first manifest itself as a pregnancy disorder causing recurrent abortion, fetal death, fetal growth retardation and early onset severe pre-eclampsia. (ii) Tissue- or organ-specific disorders such as autoimmune thrombocytopaenic purpura (ATP), autoimmune thyroid disease (Graves' disease, Hashimoto's autoimmune thyroiditis, and post-postum thyroiditis), autoimmune haemolytic anaemia, and the very rare myasthenia gravis. The study of autoimmune diseases against the background of pregnancy as an experimental system of nature has provided important insights into the nature of the disease processes and the relevance or otherwise of circulating autoantibodies to pathological effects. Thus, for example, if neonatal manifestations of adult disease are causally related to the transfer of autoantibodies across the placenta, they will disappear over a time course consistent with the catabolism of IgG, providing no permanent damage is produced. Conversely, if autoantibodies are demonstrable in the neonate, in the absence of clinical effects, they may only be an epiphenomenon of the maternal disease. In addition, on occasions, disease manifestations may be seen in the baby when the mother shows none. This may occur when the mother is in remission, but still has circulating antibodies, or when she has an occult form of the disease.(ABSTRACT TRUNCATED AT 250 WORDS)

Vaccination for birth control has several advantages over currently available methods of family planning and should prove an attractive addition to the contraceptive armamentarium both in developing countries and in a developed country such as Australia. Concerns have been voiced by consumer health advocates that vaccines, like other long acting contraceptive methods, may be abused by health authorities in developing countries and by their use in vulnerable groups such as aborigines in our own country. These concerns need to be recognised and addressed. More difficult to accommodate are the anxieties expressed by feminist groups about the 'loss of control' and 'lack of body awareness' inherent in a method, such as a vaccine, that is relatively easily administered and has no overt side effects. There is no evidence that these concerns are shared by women in general. The antifertility vaccine that will most likely be applied first in family planning programmes is one directed against the pregnancy hormone hCG. A WHO vaccine directed against the C-terminal peptide of beta-hCG provokes a specific and safe immune response and will enter Phase 2 trials in Sweden this year. Subsequent developments with this vaccine will include the replacement of the current emulsion vehicle by a delivery system based on biodegradeable microspheres which will give a more sustained antigen release and duration of effectiveness.

The impact of a government-run program on our current health care system is not well understood by most Americans. Californians could be in for many unpleasant surprises should the single payer ballot initiative pass this November. The author examines how a single payer program attempts to meet the goals of health care reform and why it fails in many important aspects.

A patient with previously undiagnosed antiphospholipid syndrome (APS) developed atypical severe preeclampsia at 31 weeks' gestation. Other complications of pregnancy included intrauterine growth retardation, thrombocytopenia and fetal distress necessitating urgent delivery of a live infant. There was a prior history of unexplained jugular venous thrombosis. Prophylaxis against thrombosis was commenced immediately postoperatively and no postpartum complications occurred. Recent evidence supports the use of antepartum prophylaxis with low dose heparin in patients with APS. The role of low dose aspirin, either alone or in combination with heparin, is yet to be determined. Human immunoglobulin may be useful in selected cases. Early diagnosis is a key factor in their management.

The individual health insurance market is in crisis. Among the possible options for reform, a managed competition approach offers the broadest, most comprehensive solution.

Insurance coverage denial and excessive premium rates have made the small employer health insurance market a popular target for sweeping reforms. Many proponents of small market insurance reform have advocated pure community rating by requiring carriers to charge the same rate to all of their customers as a solution. But legislating the use of pure community rating could do more harm than good in solving the problems of cost and access. A more sensible approach would limit rate differences through either rating bands or community rating by class.

The principle of vaccination for the purposes of fertility regulation is scientifically elegant and socially compelling. Factors such as economic production, convenience of use, relatively long-lasting but reversible protection, low failure rate and the avoidance of mechanical devices or exogenous hormones make this approach a potentially attractive option for family planning programmes in both developing and developed countries. The major efforts in research and development have involved the prospect of active immunization against specific antigens of sperm, oocyte, zygote and early embryo, and the pregnancy hormone human chorionic gonadotrophin (hCG). Several anti-hCG vaccines have entered clinical trials. They operate by preventing or interrupting pregnancy at the peri-implantation stage probably by neutralizing the luteotrophic effect of hCG. The most refined vaccine is one directed against the unique C-terminal peptide on the beta-subunit of hCG. This vaccine provokes antibodies that are specific for hCG and do not cross-react with human luteinizing hormone (hLH). Preclinical studies in baboons and data from a phase I human trial indicate that this method is free of side-effects and provides the promise of a duration of effectiveness of up to 12 months. Future research will optimize the anti-hCG approach, utilize new vaccine delivery systems and broaden the spectrum of target antigens of potential utility for contraceptive vaccines.

The carcass characteristics of 27 market barrows and 27 market gilts were evaluated at various times (n = 8) with real-time ultrasound (Aloka 210 DX) from approximately 20 kg until slaughter at three end points. The pigs were randomly assigned to slaughter weight groups of 91, 104.5, and 118 kg at weaning time. Correlations were determined over slaughter weight group and sex, and the accuracies of ultrasound measurements were also evaluated. The regressions of ultrasound 10th-rib fat and ultrasound longissimus muscle area on live weight were also developed. Correlations between actual and ultrasound-measured last-rib fat, 10th-rib fat, and longissimus muscle area were high (r = .91, .63, and .53, respectively; P less than .01). The accuracy of ultrasound longissimus muscle area prediction was lower for 118-kg pigs than for the two lighter groups, whereas the accuracy for prediction of last-rib fat was lower for 91-kg pigs than for the two heavier groups, as indicated by higher absolute differences (P less than .05). Last-rib fat and longissimus muscle area tended to be overestimated and 10th-rib fat tended to be underestimated by real-time ultrasound. Prediction of last-rib fat by ultrasound was more accurate for gilts than for barrows, as indicated by a lower absolute difference (P less than .05).

Optimized electromigrative sample introduction improves detection limits for anions in capillary electrophoresis. Reproducible results are achieved for micromolar and nanomolar levels of concentration. The new method offers shorter runtimes, improved resolution and greater simplicity in comparison with ion chromatography. The technique was applied to water samples from the power industry. Trace levels of anions are monitored routinely in water for steam generation in conventional and nuclear power plants. Reproducible and accurate results are presented for pure water samples containing typical concentrations of anions as well as for more specific types of samples, such as water compositions in the primary and secondary circuits of a nuclear power plant.

Objective: To describe the causes of infertility among couples presenting to a fertility clinic over a period of 14 years. Changes in treatment methods over the same period are described., Design: A retrospective analysis of records of patient age, date of first visit, duration and cause of infertility, treatment and outcome., Setting: A fertility clinic set in a large public hospital. Patients are referred by both general gynaecologists and general practitioners., Patients: From 1976 to 1989 (inclusive) 2895 couples who had engaged in unprotected intercourse for at least 12 months without conceiving attended the clinic., Results: Three major diagnostic categories were considered; these embraced aetiological factors relating to semen, ovulation, and pelvic anatomy. Investigation of the causes of infertility after a couple's first visit showed these to be a semen defect in 22%, irregular cycles or anovulation in 29%, and a pelvic disorder in 57%. The incidence of semen defects as the cause remained constant between 1976 and 1989 while that of ovulation "problems" declined from 42% in 1976 to 13% in 1989. In contrast, the incidence of pelvic dysfunction increased from 40% in 1976 to 68% in 1989, predominantly due to an increased diagnosis of endometriosis. The principal treatments were ovulation induction/cycle regulation (51%), in-vitro fertilisation/gamete intrafallopian transfer (42%), and donor insemination (18%)., Conclusions: Provided patient information is accurately and consistently recorded a Fertility Audit is a useful window on the activates of a Fertility Clinic and serves to highlight areas which warrant further investigation.

A random sample of 292 women attending a hospital antenatal clinic for routine care was surveyed concerning smoking behaviour and beliefs about smoking in pregnancy. Among women who continued to smoke during their pregnancy, most had cut down. Many expressed a desire to quit, felt guilty about not being able to do so, but reported that smoking offered important benefits relating to relaxation and mood control. Forty (27.8%) of the 144 women who were smokers at the time they became pregnant had quit during pregnancy. In a multivariate analysis, a nonsmoking household, and being more convinced about the health effects of maternal smoking, were most strongly associated with successful cessation. These 2 variables alone were able to correctly classify 83.8% of women as quitters or continuing smokers. Implications for health promotion programmes and messages are discussed.

Inorganic capillary electrophoresis (ICE) is a new separations technology which melds the technique of classical electrophoresis with the separations approach of ion chromatography. Matrices which have been difficult to deal with using ion chromatography have proven amenable to analysis by ICE. The simultaneous analysis of weak acid anions, oxalate and citrate and inorganic anions, chloride, sulfate, nitrate, phosphate and carbonate in diluted urine was achieved using ICE. The determination of the oxyanions of arsenic (i.e. arsenite and arsenate) in urine was also performed.

Acute systemic hypersensitivity reactions to semen are rare but may be life-threatening. Chronic or recurrent local reactions are more common and may be misdiagnosed as infective or nonspecific vaginitis. The antigen(s) involved in these reactions reside in a glycoprotein fraction of seminal plasma. Allergic vulvovaginitis may also occur in sensitized women when they are exposed to exogenous allergens such as drugs, food and infective agents during sexual activity. Skin testing and other relevant investigations are indicated when these disorders are suspected. Condom usage will prevent symptoms of coital allergy. Desensitization has had variable success in acute systemic hypersensitivity. Precoital antihistamines may modify local reactions.

High quality motile sperm are essential for the success of the in vitro fertilization-embryo transfer program and related procedures, for the performance of sperm antibody assays, and other in vitro tests of sperm function. Two methods for the extraction of high motility sperm, swim-down and swim-up, were compared on 30 ejaculates, and sperm motility was assessed at intervals up to 18 hours. The swim-down method was simpler, shorter, and provided a significantly better recovery of sperm with sustained high motility than did the swim-up method.

Since the mid 1970s, the World Health Organization's Special Programme of Research, Development and Research Training in Human Reproduction, through its Task Force on Vaccines for Fertility Regulation, has been supporting and coordinating the development of a birth control vaccine based on a synthetic peptide representing part of the beta subunit of human chorionic gonadotrophin (beta-hCG). The majority of this work has been carried out in the laboratories of Dr V.C. Stevens at Ohio State University. This hCG vaccine has recently been tested for tolerability and immunogenicity in a phase I clinical trial, and a preliminary evaluation of the vaccine's efficacy in fertile women volunteers is currently being planned. This paper describes the preclinical and clinical testing of this vaccine and the problems and challenges presented by this novel preparation. These have included the need to carry out safety and efficacy studies in the baboon, and the difficulties of designing appropriate preclinical toxicity and immunosafety studies and clinical trial protocols in the absence of previous experience with vaccines of this type.

Fetal trophoblast cells were isolated from maternal peripheral blood by means of murine monoclonal antibodies of high specificity and affinity for human syncytiotrophoblast and nonvillous cytotrophoblast cells. The cells were isolated in sufficient numbers to allow polymerase chain reaction (PCR) amplification of the Y-chromosome-specific DNA sequence from the peripheral blood of thirteen pregnant women. The fetal sex predicted by PCR analysis of the isolated trophoblast cells accorded with that ascertained by karyotyping of chorionic villus samples in eleven of twelve women studied in early pregnancy and with the sex of the baby on delivery in one woman studied at 34 weeks' gestation. Isolation of these fetal cells could allow noninvasive diagnosis of a wide range of inherited disorders.

In Escherichia coli, the level of 6-phosphogluconate dehydrogenase is directly proportional to the cellular growth rate during growth in minimal media. This contrasts with the report by Winkler et al. (M. E. Winkler, J. R. Roth, and P. E. Hartman, J. Bacteriol. 133:830-843, 1978) that the level of the enzyme in Salmonella typhimurium LT-2 strain SB3436 is invariant. The basis for the difference in the growth-rate-dependent regulation between the two genera was investigated. Expression of gnd, which encodes 6-phosphogluconate dehydrogenase, was growth rate uninducible in strain SB3436, as reported previously, but it was 1.4-fold growth rate inducible in other S. typhimurium LT-2 strains, e.g., SA535. Both the SB3436 and SA535 gnd genes were growth rate inducible in E. coli K-12. Moreover, the nucleotide sequences of the regulatory regions of the two S. typhimurium genes were identical. We concluded that a mutation unlinked to gnd is responsible for the altered growth rate inducibility of 6-phosphogluconate dehydrogenase in strain SB3436. Transductional analysis showed that the altered regulation is due to the presence of a mutation in hisT, the gene for the tRNA modification enzyme pseudouridine synthetase I. A complementation test showed that the regulatory defect conferred by the hisT mutation was recessive. In E. coli, hisT mutations reduced the extent of growth rate induction by the same factor as in S. typhimurium. The altered regulation conferred by hisT mutations was not simply due to their general effect of reducing the polypeptide chain elongation rate, because miaA mutants, which lack another tRNA modification and have a similarity reduced chain growth rate, had higher rather than lower 6-phosphogluconate dehydrogenase levels. Studies with genetic fusions suggested that hisT mutations lower the gnd mRNA level. The data also indicated that hisT is involved in translational control of gnd expression, but not the aspect mediated by the internal complementary sequence.

This study was designed to investigate the relationship between umbilical cord blood viscosity and clinical parameters such as maternal parity, maternal smoking, mode of delivery, sex of infant and the incidence of fetal distress at birth using mathematical modelling. The results demonstrated vaginal delivery, male infants, infants of primigravidas and low cord whole blood viscosity at a high shear rate were covariables and were associated with an increased incidence of fetal distress and low Apgar scores.

The detection of the lymphokine monocyte chemotactic factor by determination of the leading front of monocyte migration is described. Stimulated and control supernatants were placed on the attractant side of cellulose ester filters with normal human monocytes as responder cells. Lymphokine activity was assessed by comparing the leading front of monocyte migration in response to control and stimulated culture supernatants. More monocytes migrated to all levels within the filters towards PHA stimulated culture supernatant than to control supernatant, indicating that the lymphokine acted on the entire migrating cell population and not only the cells at the leading front. Analysis of cell migration in a range of concentration gradients demonstrated that the lymphokine induced by PHA was chemotactic for monocytes. There was a significant association (p less than 0.01) between the production of monocyte chemotactic factor in vitro and skin test reactivity in vivo to three soluble antigens, SKSD, Candida albicans extract and tetanus toxoid. It is concluded that the detection of monocyte chemotactic factor production in vitro provides good evidence of sensitisation, however due to a number of false negative reactions, failure to detect the lymphokine does not necessarily indicate lack of reactivity in vivo.

The purpose of the work was to develop an in vitro model for the study of lymphatic endothelium and to determine, using this model, whether or not a cytoplasmic process may be involved in transendothelial transport. Segments of canine renal hilar lymphatics were dissected clean, cannulated at both ends, and transferred to a perfusion chamber for measurement of transendothelial protein transport and for ultrastructural tracer studies. The segments were subsequently processed for light and electron microscopy. By both structural and functional criteria the lymphatics were judged to have retained their integrity. At 37 degrees C, 36 lymphatics showed a mean rate of protein transport of 3.51 +/- 0.45 (SEM) micrograms/min per cm2 of lymphatic endothelium. The rate was influenced by the temperature of the system, being significantly reduced by 49% +/- 4.8, 31% +/- 5.3, and 29% +/- 3.9 when the temperature was lowered to 4 degrees, 24 degrees, and 30 degrees C, respectively. When the temperature was raised to 40 degrees C, the rate was significantly increased by 48% +/- 12.2. The vesicular system and the intercellular regions in vessels with increased or reduced rates of transport were analyzed quantitatively to ascertain whether the rate changes could be correlated with ultrastructurally demonstrable changes in either of these postulated pathways. No significant changes in junctional or vesicular parameters were found between the control lymphatics and those perfused at 24 degrees, 30 degrees, and 40 degrees C. At 4 degrees C, the temperature at which the rate of protein transport was maximally reduced, vesicular size decreased, and the number of free cytoplasmic vesicles increased, whereas the number associated with the abluminal and luminal surfaces decreased. We concluded that isolated perfused lymphatic segments transport protein at a relatively constant rate under control conditions, and that this transendothelial transport comprises both temperature-dependent and temperature-independent mechanisms. The findings were considered in terms of the different theories of lymph formation and were interpreted as providing support for the vesicular theory.

Peritoneal fluid was collected from women undergoing investigations for infertility at laparoscopy performed during the luteal phase. The volume of fluid was recorded and concentrations of 6-keto prostaglandin F1 alpha were determined by radioimmunoassay. No difference was found in either the total amount or the concentration of 6-keto prostaglandin F1 alpha in the women with or without endometriosis. Furthermore, there was no difference in the volume of peritoneal fluid between these two groups of women. We conclude that 6-keto prostaglandin F1 alpha in peritoneal fluid is not associated with macroscopically visible endometriosis.

The in vitro random migration and chemotactic activity of peripheral blood monocytes and neutrophils was compared with the delayed hypersensitivity skin test to streptokinase-streptodornase in fourteen normal subjects. A significant positive correlation (P less than 0.001) was observed between the random migration of monocytes and the size of the skin test reaction. No significant correlation was found with random neutrophil migration or monocyte and neutrophil chemotactic responses. These results indicate that the in vitro random mobility of monocytes is related to the in vivo expression of a delayed-type hypersensitivity skin reaction.