Search

Introduction: Prior studies of patients treated for breast cancer during pregnancy (PrBC) report mixed outcomes and are limited by substandard treatment, small cohorts, and short follow-up. This study compared survival outcomes of PrBC patients treated with chemotherapy during pregnancy with nonpregnant patients matched by age, year of diagnosis, stage, and subtype., Methods: PrBC patients treated from 1989 to 2022 on prospective institutional protocols were eligible. Disease-free survival (DFS), overall survival (OS), and progression-free survival (PFS) were estimated using the Kaplan-Meier method and multivariable Cox proportional hazards regression., Results: Among 143 PrBC and 285 nonpregnant patients, median follow-up was 11.4 years. Survival differences were statistically significant, with median DFS and OS not attained for PrBC patients versus 5.6 years (95% confidence interval [CI], 3.6-15.4; p = .0001) and 19.3 years (95% CI, 14.1-not estimated; p = .0262) for nonpregnant patients, respectively. Median PFS was 24.1 years (95% CI, 15.8-not estimated) for PrBC patients versus 8.4 years (95% CI, 6.4-10.9) for the nonpregnant cohort (p = .0008). Study cohort was associated with DFS, PFS, and OS in multivariable analyses, with the nonpregnant cohort having increased risks of disease recurrence (hazard ratio [HR], 1.91; 95% CI, 1.33-2.76; p = .0005) and disease progression or death (HR, 1.68; 95% CI, 1.19-2.39; p = .0035), and shorter OS (HR, 1.52; 95% CI, 1.01-2.29; p = .0442)., Conclusion: These data suggest that PrBC patients treated with chemotherapy during pregnancy have at least comparable, if not superior, outcomes than nonpregnant patients with similar age, cancer stage, and subtype. Analyses excluding patients with postpartum breast cancer were unable to be performed and are a priority for future confirmatory studies., (© 2024 American Cancer Society.)

Objective: As the field of neuropsychology continues expanding efforts to better recruit providers and serve individuals from diverse populations, understanding the training and practice experiences of neuropsychologists from diverse backgrounds is crucial. Given the diversity of Asian populations, the experiences of Asian neuropsychologists offer a unique opportunity to reflect on the progress made in addressing issues related to diversity, equity, and inclusion (DEI). This information will help address challenges related to education, training, and clinical practice, particularly in meeting growing demands for neuropsychological evaluations among Asian populations and addressing unique challenges. Methods: Survey data from 69 Asian neuropsychologists encompassed demographic factors, educational background, clinical duties, research focuses, and advocacy/leadership work. Information regarding experiences of discrimination, barriers, and gaps was also gathered. Results: Asian neuropsychologists are a diverse group comprising South, Southeast, and East Asian communities with various levels of bilingualism. Clinical and training experiences span a spectrum of settings, programs, and responsibilities, though notably, there are still many gaps. Our sample endorsed experiences of discrimination associated with institutional, systemic, and social barriers (e.g. absence of training opportunities, unfair wages) as well as more general barriers in neuropsychology. Conclusions: This study overviews Asian neuropsychologists' demographic background, training, and practice experiences. Despite progress in the field's growing recognition and understanding of Asian neuropsychology, there remain unique experiences, challenges, and needs that are not well understood or addressed. Understanding these experiences and insights is essential for enhancing culturally sensitive neuropsychological services for individuals of Asian descent worldwide and advancing DEI efforts.

Objective: There is a concerning lack of systematic understanding regarding the availability and validity of neuropsychological assessment tools for children in Southeast Asia. This issue is further complicated by the unclear landscape for test development, adaptations, and translations in these countries. The purpose of this paper is twofold. First, we offer insights into the broader practice of pediatric neuropsychology within Southeast Asia communities based on their current medical infrastructural standings. Then, we provide a specific case study by examining the current status of pediatric neuropsychology for Vietnamese children., Method: A brief overview of the status of pediatric neuropsychology in Southeast Asia groups is provided, followed by a scoping review examining performance-based and objective rating inventories for the Vietnamese pediatric population., Results: 42 studies were included in the Vietnamese review spanning several cognitive and socioemotional domains. Adaptation and translation protocols were significantly variable. Figures and tables summarizing the identified questionnaires and test measures are included., Conclusions: Vietnam, with its moderately developed medical infrastructure and shared cultural, economic, and sociopolitical traits with other Southeast Asian countries, provides a compelling case study for the growth, challenges, and gaps in neuropsychology. While the field continues to develop in this country, ongoing opportunities and the need for guidelines on test development and adaptation are critically needed to advance the field further. Implications for more and less developed Southeast Asia countries are provided based on our scoping review., (© The Author(s) 2024. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.)

Introduction: The International Hidradenitis Suppurativa Severity Score System (IHS4) is a validated tool that measures inflammatory lesions, including draining tunnels, in hidradenitis suppurativa (HS)., Objective: To evaluate secukinumab efficacy using IHS4 in patients with moderate to severe HS., Methods: Data from the SUNSHINE and SUNRISE trials, which assessed subcutaneous secukinumab 300 mg every 2 (SECQ2W) and 4 (SECQ4W) weeks in adults with moderate to severe HS, were analyzed. Assessments included changes from baseline in IHS4 and severity classification up to Week 52; IHS4-55, IHS4-75, IHS4-90 responses (55%, 75% and 90% reduction in IHS4) and concordance between IHS4-55 and HS clinical response (HiSCR), at Weeks 16 and 52., Results: In total, 1084 patients (SECQ2W = 361; SECQ4W = 360; placebo = 363) were analyzed. At Week 16, SECQ2W and SECQ4W demonstrated a numerically higher reduction in IHS4 from baseline versus placebo (adjusted mean [95% CI]: -10.80 [-12.30 to -9.30] and -9.46 [-10.96 to -7.96] vs. -4.92 [-6.43 to -3.41]); the reduction was maintained until Week 52 in both dose regimens. A greater proportion of patients achieved IHS4-55 with SECQ2W (43.4%) and SECQ4W (39.5%) versus placebo (31.5%) at Week 16, with further improvement at Week 52. Similar trends were observed for IHS4-75 and IHS4-90 responses. While no patients had mild disease based on IHS4 (80.7% had severe and 19.3% had moderate HS) at baseline, a greater proportion of patients were categorized as having mild disease at Week 16 in the SECQ2W (25.9%) and SECQ4W (24.0%) groups versus placebo (16.4%); this trend continued up to Week 52 in both dose regimens. Strong concordance (>85%) was observed between IHS4-55 and HiSCR., Conclusions: Both SECQ2W and SECQ4W demonstrated efficacy in improving treatment response as measured by IHS4 and reducing disease severity versus placebo at Week 16 and these improvements were sustained through Week 52. These findings support that the dynamic and dichotomous IHS4 can efficiently detect treatment response changes in clinical trial settings., (© 2024 The Author(s). Journal of the European Academy of Dermatology and Venereology published by John Wiley & Sons Ltd on behalf of European Academy of Dermatology and Venereology.)

Severe and chronic infections, including pneumonia, sepsis, and tuberculosis (TB), induce long-lasting epigenetic changes that are associated with an increase in all-cause postinfectious morbidity and mortality. Oncology studies identified metabolic drivers of the epigenetic landscape, with the tricarboxylic acid (TCA) cycle acting as a central hub. It is unknown if the TCA cycle also regulates epigenetics, specifically DNA methylation, after infection-induced immune tolerance. The following studies demonstrate that lipopolysaccharide and Mycobacterium tuberculosis induce changes in DNA methylation that are mediated by the TCA cycle. Infection-induced DNA hypermethylation is mitigated by inhibitors of cellular metabolism (rapamycin, everolimus, metformin) and the TCA cycle (isocitrate dehydrogenase inhibitors). Conversely, exogenous supplementation with TCA metabolites (succinate and itaconate) induces DNA hypermethylation and immune tolerance. Finally, TB patients who received everolimus have less DNA hypermethylation demonstrating proof of concept that metabolic manipulation can mitigate epigenetic scars., Competing Interests: Competing interests statement:The authors declare no competing interest.

Background: Hidradenitis suppurativa (HS) is a chronic inflammatory skin disease associated with a substantial disease burden. Secukinumab has previously been reported to have sustained efficacy with a favourable safety profile in patients with moderate-to-severe HS. It is unknown whether prior biologic exposure affects the efficacy and safety of secukinumab., Objectives: To investigate the efficacy and safety of secukinumab in patients with moderate-to-severe HS based on prior exposure to -biologics., Methods: This was an analysis of the SUNSHINE and SUNRISE phase III trials of secukinumab in patients with moderate-to-severe HS. Patients were randomized at baseline to receive secukinumab every 2 (SECQ2W) or 4 weeks (SECQ4W), or placebo for 16 weeks. After week 16, patients on the SECQ2W and SECQ4W schedules remained on the same treatment regimen, while patients randomized to placebo were switched to either SECQ2W or SECQ4W up to week 52. Assessments based on prior exposure to biologics included Hidradenitis Suppurativa Clinical Response (HiSCR), abscess and inflammatory nodule (AN) count, flare rates, HS-related pain [numerical rating scale 30 (NRS30)], 55% reduction in the International Hidradenitis Suppurativa Severity Score System (IHS4-55), Dermatology Life Quality Index, EuroQol-5D and safety., Results: Overall, 1084 patients were randomized in the SUNSHINE and SUNRISE trials and included in this analysis; 255 (23.5%) were biologic-experienced [SECQ2W (n = 80); SECQ4W (n = 81); placebo (n = 94)] and 829 (76.5%) were biologic-naïve [SECQ2W (n = 281); SECQ4W (n = 279); placebo (n = 269)]. At week 16, responses were more efficacious for secukinumab than for placebo with regard to HiSCR in patients who were biologic-experienced {SECQ2W 37.0% [odds ratio (OR) 1.60, 95% confidence interval (CI) 0.83-3.08]; SECQ4W 38.8% [OR 1.67, 95% CI 0.86-3.22]; placebo 27.3%} and biologic-naïve [SECQ2W 45.6% (OR 1.64, 95% CI 1.15-2.33); SECQ4W 45.4% (OR 1.61, 95% CI 1.13-2.29); placebo 34.2%]. Similar results were observed for AN count, NRS30 and IHS4-55. The higher response seen at week 16 with secukinumab was sustained, with a trend toward improvement over time, through to week 52 in both subgroups. Additional efficacy was observed for quality-of-life assessments, and no differences in safety between subgroups were observed., Conclusions: Regardless of prior biologic exposure, secukinumab was efficacious in improving the signs and symptoms of HS. This finding positions secukinumab as the first option in patients who are biologic-naïve, as well as in patients who have previously been treated with other biologic therapy, based on individual patient needs., Competing Interests: Conflicts of interest C.C.Z. reports consultancy/advisory boards disease-­relevant honoraria from Boehringer Ingelheim, Incyte, InflaRx, Janssen, Novartis, Regeneron, Sanofi, UCB and Viatris; has received speaker fees from Almirall, Novartis and UCB; is President of the European Hidradenitis Suppurativa Foundation (EHSF) e.V., coordinator of the ALLOCATE Skin Group of the ERN-Skin, chair of the Acne/Rosacea/Hidradenitis Suppurativa Task Force group of the European Academy of Dermatology and Venerology (EADV), and Editor of EADV News. He is co-copyright holder of the International Hidradenitis Suppurativa Severity Score System (IHS4) on behalf of the EHSF e.V. His institution has received disease-relevant grants from Boehringer Ingelheim, InflaRx, Novartis and UCB for his participation as a clinical investigator. T.P. has received consulting fees from AbbVie, Almirall, Boehringer Ingelheim, Bristol Myers Squibb, Celgene, Eli Lilly, Galderma, Incyte, Janssen, LEO Pharma, Novartis, Pfizer, Sanofi Genzyme, Sun Pharma, UCB and Vyne. D.P. reports consultancy, investigator, advisory board or data safety monitoring board honoraria from Bickel Biotechnology, Biofrontera, BMS, Dermira, LEO Pharma, US Novartis Pharmaceuticals, Pfizer, Regeneron and Sanofi. D.P.’s institution has received grants/research funding for the role of investigator from Almirall, Amgen, AOBiome, Asana Biosciences, Bickel Biotechnology, Celgene, Dermira, Eli Lilly, LEO Pharma, Menlo Therapeutics, Novartis Pharmaceuticals, Novo Nordisk, Ortho Dermatologics, Pfizer and Regeneron. M.B.W. is an employee of and stockholder in Novartis Ireland Ltd. A.O. has been principal investigator in clinical trials sponsored by AbbVie, Alfasigma, Almirall, Amgen, Difa Cooper, Celgene, Eli Lilly, Galderma, Janssen, Laboratori Farmacologici Milanesi, LEO Pharma, Novartis, Pfizer, Pierre Fabre, Regeneron, Sanofi, UCB Pharma and Boehringer Ingelheim. A.O.’s institution has received disease-relevant grants from AbbVie, Alfasigma, Almirall, Amgen, Difa Cooper, Celgene, Eli Lilly, Galderma, Janssen, Laboratori Farmacologici Milanesi, LEO Pharma, Novartis, Pfizer, Pierre Fabre, Regeneron, Sanofi, UCB Pharma and Boehringer Ingelheim. A.O. has received speaker fees from AbbVie, UCB, LEO Pharma, Novartis, Pfizer and Eli Lilly. M.S.A. has been the principal investigator for clinical trials funded by Novartis, Arcutis Biotherapeutics, Galderma Laboratories, Eli Lilly, AbbVie, Pfizer, Concert Pharmaceuticals, Dermira, UCB, Incyte, Boehringer Ingelheim, Amgen, Evelo Sciences, LEO Pharma, Bristol Myers Squibb, Dice Therapeutics, Kiniksa Pharmaceuticals, Zai Lab, Sanofi and Bausch Health; and has been on advisory boards for Amgen, AbbVie, Sanofi, Novartis, Incyte, Boehringer Ingelheim, UCB, Arcutis, Bristol Myers Squibb and Bausch Health. X.L. is an employee of Novartis Pharma Co., Ltd. China. L.U., A.L.M., I.A. and I.L. are employees and stockholders of Novartis Pharma AG, Switzerland. S.R. is an employee and stockholder of Novartis Pharmaceuticals Corp., USA. P.M.-B. has received honoraria for acting as a consultant and/or as a speaker for Regeneron, Pfizer, Eli Lilly, AbbVie, Janssen, Novartis, LEO Pharma, Almirall, Sanofi, Viatris, L’Oréal, Organon, Cantabria Labs, Evelo Biosciences and CSL; and has been principal investigator in clinical trials supported by Pfizer, Biogen, Janssen, Amgen, AbbVie, Sanofi, and Novartis., (© The Author(s) 2024. Published by Oxford University Press on behalf of British Association of Dermatologists.)

Natural killer (NK) cells patrol tissue to mediate lysis of virally infected and tumorigenic cells. Human NK cells are typically identified by their expression of neural cell adhesion molecule (NCAM, CD56), yet despite its ubiquitous expression on NK cells, CD56 remains a poorly understood protein on immune cells. CD56 has been previously demonstrated to play roles in NK cell cytotoxic function and cell migration. Specifically, CD56-deficient NK cells have impaired cell migration on stromal cells and CD56 is localized to the uropod of NK cells migrating on stroma. Here, we show that CD56 is required for NK cell migration on ICAM-1 and is required for the establishment of persistent cell polarity and unidirectional actin flow. The intracellular domain of CD56 (NCAM-140) is required for its function and the loss of CD56 leads to enlarged actin foci and sequestration of phosphorylated Pyk2 accompanied by increased size and frequency of activated LFA-1 clusters. Together, these data identify a role for CD56 in regulating human NK cell migration through modulation of actin dynamics and integrin turnover.

Purpose: The purpose of this integrative literature review was to determine factors that increase the risk of immune checkpoint inhibitor (ICI)-related myocarditis in the cancer patient population., Methods: A literature review was conducted using the following databases: PubMed, Scopus, and Cochrane Review. Dates searched were from inception through March 1, 2022. Inclusion criteria included English language, cancer patients receiving ICI treatment, and risk factors for myocarditis. Articles were excluded if they were a non-human study, duplicate, had an irrelevant title or content, or were a review or commentary., Results: Patients with cancer who receive ICIs have an associated increased risk of myocarditis if they are older than 64 years, have a body mass index (BMI) greater than 28, and have a history of cardiovascular medication use., Conclusions: Myocarditis remains a rare cardiovascular adverse effect of ICIs. However, the mortality risk among this subset of patients remains high. Additional prospective randomized-controlled trials would be beneficial to further determine a causal relationship between risk factors for ICI-related myocarditis. Risk stratification tools may allow oncology medical providers to identify patients at a higher risk of ICI-related myocarditis to increase earlier surveillance., Competing Interests: The authors have no conflicts of interest to disclose., (© 2024 BroadcastMed LLC.)

The urea cycle enzyme argininosuccinate lyase (ASL) enables the clearance of neurotoxic ammonia and the biosynthesis of arginine. Patients with ASL deficiency present with argininosuccinic aciduria, an inherited metabolic disease with hyperammonemia and a systemic phenotype coinciding with neurocognitive impairment and chronic liver disease. Here, we describe the dysregulation of glutathione biosynthesis and upstream cysteine utilization in ASL-deficient patients and mice using targeted metabolomics and in vivo positron emission tomography (PET) imaging using ( S )-4-(3- 18 F-fluoropropyl)-l-glutamate ([ 18 F]FSPG). Up-regulation of cysteine metabolism contrasted with glutathione depletion and down-regulated antioxidant pathways. To assess hepatic glutathione dysregulation and liver disease, we present [ 18 F]FSPG PET as a noninvasive diagnostic tool to monitor therapeutic response in argininosuccinic aciduria. Human hASL mRNA encapsulated in lipid nanoparticles improved glutathione metabolism and chronic liver disease. In addition, hASL mRNA therapy corrected and rescued the neonatal and adult Asl-deficient mouse phenotypes, respectively, enhancing ureagenesis. These findings provide mechanistic insights in liver glutathione metabolism and support clinical translation of mRNA therapy for argininosuccinic aciduria.

Xenografts of human skeletal muscle generated in mice can be used to study muscle pathology and to test drugs designed to treat myopathies and muscular dystrophies for their efficacy and specificity in human tissue. We previously developed methods to generate mature human skeletal muscles in immunocompromised mice starting with human myogenic precursor cells (hMPCs) from healthy individuals and individuals with facioscapulohumeral muscular dystrophy (FSHD). Here, we examine a series of alternative treatments at each stage in order to optimize engraftment. We show that (i) X-irradiation at 25Gy is optimal in preventing regeneration of murine muscle while supporting robust engraftment and the formation of human fibers without significant murine contamination; (ii) hMPC lines differ in their capacity to engraft; (iii) some hMPC lines yield grafts that respond better to intermittent neuromuscular electrical stimulation (iNMES) than others; (iv) some lines engraft better in male than in female mice; (v) coinjection of hMPCs with laminin, gelatin, Matrigel, or Growdex does not improve engraftment; (vi) BaCl 2 is an acceptable replacement for cardiotoxin, but other snake venom preparations and toxins, including the major component of cardiotoxin, cytotoxin 5, are not; and (vii) generating grafts in both hindlimbs followed by iNMES of each limb yields more robust grafts than housing mice in cages with running wheels. Our results suggest that replacing cardiotoxin with BaCl 2 and engrafting both tibialis anterior muscles generates robust grafts of adult human muscle tissue in mice., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

We synthesized seven ( Z )-benzylidene-2-( E )-styryloxazol-5(4 H )-ones derivatives of cinnamic acid and evaluated the ability of these compounds to inhibit human acetylcholinesterase (hAChE). The most potent compound was evaluated for cognitive improvement in short-term memory. The seven compounds reversibly inhibited the hAChE between 51 and 75% at 300 μM, showed an affinity ( K i ) from 2 to 198 μM, and an IC 50 from 9 to 246 μM. Molecular docking studies revealed that all binding moieties are involved in the non-covalent interactions with hAChE for all compounds. In addition, in silico pharmacokinetic analysis was carried out to predict the compounds' blood-brain barrier (BBB) permeability. The most potent inhibitor of hAChE significantly improved cognitive impairment in a modified Y-maze test (5 μmol/kg) and an Object Recognition Test (10 μmol/kg). Our results can help the rational design of hAChE inhibitors to work as potential candidates for treating cognitive disorders.

Improvements in functional genomic annotation have led to a critical mass of neurogenetic discoveries. This is exemplified in hereditary ataxia, a heterogeneous group of disorders characterised by incoordination from cerebellar dysfunction. Associated pathogenic variants in more than 300 genes have been described, leading to a detailed genetic classification partitioned by age-of-onset. Despite these advances, up to 75% of patients with ataxia remain molecularly undiagnosed even following whole genome sequencing, as exemplified in the 100 000 Genomes Project. This study aimed to understand whether we can improve our knowledge of the genetic architecture of hereditary ataxia by leveraging functional genomic annotations, and as a result, generate insights and strategies that raise the diagnostic yield. To achieve these aims, we used publicly-available multi-omics data to generate 294 genic features, capturing information relating to a gene's structure, genetic variation, tissue-specific, cell-type-specific and temporal expression, as well as protein products of a gene. We studied these features across genes typically causing childhood-onset, adult-onset or both types of disease first individually, then collectively. This led to the generation of testable hypotheses which we investigated using whole genome sequencing data from up to 2182 individuals presenting with ataxia and 6658 non-neurological probands recruited in the 100 000 Genomes Project. Using this approach, we demonstrated a high short tandem repeat (STR) density within childhood-onset genes suggesting that we may be missing pathogenic repeat expansions within this cohort. This was verified in both childhood- and adult-onset ataxia patients from the 100 000 Genomes Project who were unexpectedly found to have a trend for higher repeat sizes even at naturally-occurring STRs within known ataxia genes, implying a role for STRs in pathogenesis. Using unsupervised analysis, we found significant similarities in genomic annotation across the gene panels, which suggested adult- and childhood-onset patients should be screened using a common diagnostic gene set. We tested this within the 100 000 Genomes Project by assessing the burden of pathogenic variants among childhood-onset genes in adult-onset patients and vice versa. This demonstrated a significantly higher burden of rare, potentially pathogenic variants in conventional childhood-onset genes among individuals with adult-onset ataxia. Our analysis has implications for the current clinical practice in genetic testing for hereditary ataxia. We suggest that the diagnostic rate for hereditary ataxia could be increased by removing the age-of-onset partition, and through a modified screening for repeat expansions in naturally-occurring STRs within known ataxia-associated genes, in effect treating these regions as candidate pathogenic loci., (© The Author(s) 2023. Published by Oxford University Press on behalf of the Guarantors of Brain.)

Abstract: Repeated stress produces hyperalgesic priming in preclinical models, but underlying mechanisms remain uncertain. As stress engages kappa opioid receptors (KORs), we hypothesized that repeated administration of KOR agonists might mimic, in part, stress-induced hyperalgesic priming. The potential contribution of circulating prolactin (PRL) and dysregulation of the expression of PRL receptor (PRLR) isoforms in sensory neurons after KOR agonist administration was also investigated. Mice received 3 daily doses of U-69593 or nalfurafine as a "first-hit" stimulus followed by assessment of periorbital tactile allodynia. Sixteen days after the first KOR agonist administration, animals received a subthreshold dose of inhalational umbellulone, a TRPA1 agonist, as the second-hit stimulus and periorbital allodynia was assessed. Cabergoline, a dopamine D2 receptor agonist, was used to inhibit circulating PRL in additional cohorts. Prolactin receptor isoforms were quantified in the V1 region of the trigeminal ganglion after repeated doses of U-69593. In both sexes, KOR agonists increased circulating PRL and produced allodynia that resolved within 14 days. Hyperalgesic priming, revealed by umbellulone-induced allodynia in animals previously treated with the KOR agonists, also occurred in both sexes. However, repeated U-69593 downregulated the PRLR long isoform in trigeminal neurons only in female mice. Umbellulone-induced allodynia was prevented by cabergoline co-treatment during priming with KOR agonists in female, but not male, mice. Hyperalgesic priming therefore occurs in both sexes after either biased or nonbiased KOR agonists. However, a PRL/PRLR-dependence is observed only in female nociceptors possibly contributing to pain in stress-related pain disorders in females., (Copyright © 2022 International Association for the Study of Pain.)

Background: Few therapeutic options are available for patients with moderate-to-severe hidradenitis suppurativa. We aimed to assess the efficacy of secukinumab in patients with moderate-to-severe hidradenitis suppurativa in two randomised trials., Methods: SUNSHINE and SUNRISE were identical, multicentre, randomised, placebo-controlled, double-blind phase 3 trials done in 219 primary sites in 40 countries. Patients aged 18 years old or older with the capacity to provide written informed consent and with moderate-to-severe hidradenitis suppurativa (defined as a total of ≥5 inflammatory lesions affecting ≥2 distinct anatomical areas) for at least 1 year were eligible for inclusion. Included patients also agreed to daily use of topical over-the-counter antiseptics on the areas affected by hidradenitis suppurativa lesions while on study treatment. Patients were excluded if they had 20 or more fistulae at baseline, had ongoing active conditions requiring treatment with prohibited medication (eg, systemic biological immunomodulating treatment, live vaccines, or other investigational treatments), or met other exclusion criteria. In both trials, patients were randomly assigned (1:1:1) by means of interactive response technology to receive subcutaneous secukinumab 300 mg every 2 weeks, subcutaneous secukinumab 300 mg every 4 weeks, or subcutaneous placebo all via a 2 mL prefilled syringe in a double-dummy method as per treatment assignment. The primary endpoint was the proportion of patients with a hidradenitis suppurativa clinical response, defined as a decrease in abscess and inflammatory nodule count by 50% or more with no increase in the number of abscesses or in the number of draining fistulae compared with baseline, at week 16, assessed in the overall population. Hidradenitis suppurativa clinical response was calculated based on the number of abscesses, inflammatory nodules, draining fistulae, total fistulae, and other lesions in the hidradenitis suppurativa affected areas. Safety was assessed by evaluating the presence of adverse events and serious adverse events according to common terminology criteria for adverse events, which were coded using Medical Dictionary for Regulatory Activities terminology. Both the SUNSHINE, NCT03713619, and SUNRISE, NCT03713632, trials are registered with ClinicalTrials.gov., Findings: Between Jan 31, 2019, and June 7, 2021, 676 patients were screened for inclusion in the SUNSHINE trial, of whom 541 (80%; 304 [56%] women and 237 [44%] men; mean age 36·1 years [SD 11·7]) were included in the analysis (181 [33%] in the secukinumab every 2 weeks group, 180 [33%] in the secukinumab every 4 weeks group, and 180 [33%] in the placebo group). Between the same recruitment dates, 687 patients were screened for inclusion in the SUNRISE trial, of whom 543 (79%; 306 [56%] women and 237 [44%] men; mean age 36·3 [11·4] years) were included in the analysis (180 [33%] in the secukinumab every 2 weeks group, 180 [33%] in the secukinumab every 4 weeks group, and 183 [34%] in the placebo group). In the SUNSHINE trial, significantly more patients in the secukinumab every 2 weeks group had a hidradenitis suppurativa clinical response (rounded average number of patients with response in 100 imputations, 81·5 [45%] of 181 patients) compared with the placebo group (60·7 [34%] of 180 patients; odds ratio 1·8 [95% CI 1·1-2·7]; p=0·0070). However, there was no significant difference between the number of patients in the secukinumab every 4 weeks group (75·2 [42%] of 180 patients) and the placebo group (1·5 [1·0-2·3]; p=0·042). Compared with the placebo group (57·1 [31%] of 183 patients), significantly more patients in the secukinumab every 2 weeks group (76·2 [42%] of 180 patients; 1·6 [1·1-2·6]; p=0·015) and the secukinumab every 4 weeks group (83·1 [46%] of 180 patients; 1·9 [1·2-3·0]; p=0·0022) had a hidradenitis suppurativa clinical response in the SUNRISE trial. Patient responses were sustained up to the end of the trials at week 52. The most common adverse event by preferred term up to week 16 was headache in both the SUNSHINE (17 [9%] patients in the secukinumab every 2 weeks group, 20 [11%] in the secukinumab every 4 weeks group, and 14 [8%] in the placebo group) and SUNRISE (21 [12%] patients in the secukinumab every 2 weeks group, 17 [9%] in the secukinumab every 4 weeks group, and 15 [8%] in the placebo group) trials. No study-related deaths were reported up to week 16. The safety profile of secukinumab in both trials was consistent with that previously reported, with no new or unexpected safety findings detected., Interpretation: When given every 2 weeks, secukinumab was clinically effective at rapidly improving signs and symptoms of hidradenitis suppurativa with a favourable safety profile and with sustained response up to 52 weeks of treatment., Funding: Novartis Pharma., Competing Interests: Declaration of interests ABK reports grants from AbbVie, Anapyts Bio, Aristea, Bristol Myers Squibb, ChemoCentryx, Eli Lilly, Incyte, Janssen, Moonlake, Novartis, Pfizer, UCB, and Sonoma Bio and fellowship funding from AbbVie and Janssen paid to her institution; royalties from BIDMC; consulting fees from AbbVie, Alumis, Bayer, Bristol Myers Squibb, Boehringer-Ingelheim, Eli Lilly, FIDE, Novartis, Moonlake, Janssen, Pfizer, Priovant, Sonoma Bio, Sanofi, Target RWE, UCB, and Ventyx; stock in Ventyx; serving on advisory boards for Target RWE; serving as an advisory council member to the National Institute of Health Director; and serves on the board of directors of Almirall. GBEJ reports grants from AbbVie, Boehringer-Ingelheim, CSL Behring, Regeneron, InflaRx, Novartis, LEO Foundation, and UCB, paid to their institution, and honoraria for advisory board meetings from Coloplast, Union Therapeutics, Toosonix, Boehringer-Ingelheim, Kymera, Sanofi, Viela Bio, ChemoCentryx, LEO Pharma, Afyx, Incyte, InflaRx, Janssen Cilag, Novartis, and UCB. AA reports consulting fees from AbbVie, Boehringer-Ingelheim, InflaRx, and UCB, paid to their institution, and consulting fees from Novartis, AbbVie, and Boehringer-Ingelheim. ZR reports consulting fees and honoraria from AbbVie, Amgen, Janssen-Cilag, Novartis, UCB, Sanofi; consulting fees from Celltrion; personal fees for attending meetings or for travel from AbbVie, Janssen-Cilag, Novartis, UCB, and Sanofi; and payment for expert testimony from AbbVie, Amgen, Celltrion, Janssen-Cilag, Novartis, and UCB. ABG reports research and educational grants from AnaptysBio, Janssen, Novartis, Ortho Dermatologics, Sun Pharma, BMS, and UCB Pharma, paid to their institution; consulting fees from Amgen, AnaptysBio, Avotres Therapeutics, Boehringer-Ingelheim, Bristol Myers Squibb, Dermavant, Eli Lilly, Janssen, Novartis, Pfizer, Sanofi, Sun Pharma, UCB Pharma, and DiCE Therapeutics; honoraria as an advisory board member, or non-promotional speaker from Amgen, AnaptysBio, Avotres Therapeutics, Boehringer-Ingelheim, Bristol Myers Squibb, Dermavant, Eli Lilly, Janssen, Novartis, Pfizer, Sanofi, Sun Pharma, and UCB Pharma; is a president of International Dermatology Outcome Measures; and holds stock options in XBiotech, for work on a rheumatoid arthritis project. FGB reports consulting fees from AbbVie, Novartis, and UCB; honoraria and support for attending meetings or travel from AbbVie, Janssen Cilag, Novartis, and UCB; and served on a Data Safety Monitoring Board or Advisory Board for AbbVie, Boehringer-Ingelheim, Janssen Cilag, Novartis, UCB, Incyte, and Moonlake. CP reports consulting fees from Almirall, AbbVie, Amgen, BMS, Boehringer-Ingelheim, Celgene, GSK, Janssen, LEO Pharma, Eli Lilly, Merck, Novartis, Pfizer, Sanofi, and UCB and served on a Data Safety Monitoring Board or Advisory Board for IQVIA. EJGB reports grants from Horizon 2020 ImmunoSep and RISKinCOVID, Horizon Health EPIC-CROWN-2, Sobi, bioMérieux, MSD, Abbott, Novartis, UCB, and AbbVie, paid to their institution, and consulting fees from Sobi, Pfizer, Abbott, ThermoFisher, and Menarini. APV reports consulting fees from Janssen-Cilag; payment or honoraria from AbbVie, Almirall, BMS, Janssen-Cilag, Leo Pharma, Eli Lilly, MSD, Novartis, and UCB; and support for attending meetings or travel from Janssen-Cilag and UCB. AS reports consulting fees from Regeneron, Novartis, and AbbVie, paid to their institution; payment or honoraria from AbbVie, Novartis, Regeneron, Sanofi; support for attending meetings or travel from AbbVie, Janssen-Cilag, Novartis, and Sanofi; and fees for participation on a Data Safety Monitoring Board or Advisory Board from AbbVie, Novartis, and Sanofi. FR reports grants from ALK-Abelló, Allergopharma, Blueprint Medicines, Mylan, Novartis, and ThermoFisher; served on a Data Safety Monitoring Board or Advisory Board for ALK-Abelló, Boehringer-Ingelheim, Blueprint Medicines, Leo Pharma, and UCB; and is an active member of the German Association of Allergy and Clinical Immunology. AR and his institution received grants from AbbVie, Alvotech, Amgen, AnaptysBio, Argenx, Biothera, Bristol Myers Squibb, Celgene, Celltrion, Dermira, Galderma, Inflarx, Janssen, Kiniksa, Kymab, Leo Pharma, Novartis, Pfizer, Trevi Therapeutics, and UCB; payment or honoraria from Chema Rzeszow, Eli Lilly, Leo Pharma, Novartis, Sandoz, and Takeda; and served on a Data Safety Monitoring Board or Advisory Board for AbbVie, Galderma, Sandoz, and Sanofi Aventis. IL reports payment or honoraria from Novartis and support for attending meetings or travel from Sanofi. TP reporfts grants from Almirall, Incyte, and Pfizer, paid to their institution, and consulting fees from AbbVie, Almirall, Bristol Myers Squibb, Eli Lilly, Galderma, Incyte, Janssen, LEO Pharma, Novartis, and UCB. AM reports consulting fees from AbbVie, Boehringer-Ingelheim, Jansen, Eli Lilly, Novartis, Novo Nordisk, Sandoz, and UCB; payment for expert testimony or honoraria from AbbVie, Boehringer-Ingelheim, Jansen, Eli Lilly, Novartis, Novo Nordisk, Sandoz, and UCB; and support for attending meetings or travel from AbbVie, Novartis, Jansen, and UCB. PM-B reports consulting fees from AbbVie, Almirall, Eli Lilly, Janssen, LEO Pharma, Novartis, Pfizer, and Sanofi; payment or honoraria from AbbVie, Almirall, Janssen, LEO Pharma, Eli Lilly, Novartis, Organon, Pfizer, Sanofi, and Viatris; support for attending meetings or travel from AbbVie, Almirall, Janssen, LEO Pharma, Eli Lilly, Novartis, and Sanofi; and served on a Data Safety Monitoring Board or Advisory Board for AbbVie, Janssen, LEO Pharma, Eli Lilly, Novartis, Pfizer, and Sanofi. GK reports consulting fees from Bayer; payment or honoraria from AbbVie, Abbott, Actelion Pharmaceuticals, Amgen, Basilea Pharmaceutica, Biogen IDEC, Boehringer-Ingelheim, Bristol Myers Squibb, Celgene, Hexal, Janssen-Cilag, LEO Pharma, Eli Lilly, MSD, Mylan, Novartis, Parexel, Pfizer, and UCB; support for attending meetings or travel from AbbVie, Abbott, Amgen, Basilea Pharmaceutica, Celgene, Janssen-Cilag, LEO Pharma, MSD, Novartis, Pfizer, Sanofi, and UCB; and served on a Data Safety Monitoring Board or Advisory Board for AbbVie, Abbott, Amgen, Basilea, Bayer, Boehringer-Ingelheim, Bristol Myers Squibb, Celgene, Janssen-Cilag, LEO Pharma, Eli Lilly, Novartis, and UCB. P-AB reports consulting fees from Novartis, AbbVie, Pfizer, and UCB pharma; payment or honoraria from Novartis and AbbVie; support for attending meetings or travel from Novartis; and served on a Data Safety Monitoring Board or Advisory Board for Novartis. MBW, ALM, XW, LU, AP, DK, RM, CF, LC, MV, SR, and EM are employees of Novartis and hold company stock. RS is Director and Founder of Samson Medical, has participated in pharmaceutical advisory boards for Eli Lilly and Company, Pfizer, and Leo Pharmaceutical, has participated in speaker bureaus for AbbVie, Novartis, and Pfizer, and has acted as a principal investigator in clinical trials for AbbVie, Aerotech, Akesobio, Amgen, Arcutis, Arena, Ascend AstraZeneca, Bayer, Biotherapeutics Boehringer-Ingelheim, Bristol-Myer Squibb, Celgene, Coherus BioSciences, Connect, Demira, Eli Lilly, Galderma, GlaxoSmithKline, F Hoffman–La Roche, Janssen, MedImmune, Merck, Merck Sharpe & Dohme, Novartis, Oncobiologics, Pfizer, Principia, Regeneron, Roche, Reistone Biopharma, Samson Clinical, Sanofi-Genzyme, Sun Pharma UCB, Valeant, and Zai Labs. RS is President of the Australasian Hair and Wool Research Society, and Vice President of the International Society of Dermatology and The International Academy of Dermatology. LPR declares no competing interests., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Open science and collaboration are necessary to facilitate the advancement of Parkinson's disease (PD) research. Hackathons are collaborative events that bring together people with different skill sets and backgrounds to generate resources and creative solutions to problems. These events can be used as training and networking opportunities, thus we coordinated a virtual 3-day hackathon event, during which 49 early-career scientists from 12 countries built tools and pipelines with a focus on PD. Resources were created with the goal of helping scientists accelerate their own research by having access to the necessary code and tools. Each team was allocated one of nine different projects, each with a different goal. These included developing post-genome-wide association studies (GWAS) analysis pipelines, downstream analysis of genetic variation pipelines, and various visualization tools. Hackathons are a valuable approach to inspire creative thinking, supplement training in data science, and foster collaborative scientific relationships, which are foundational practices for early-career researchers. The resources generated can be used to accelerate research on the genetics of PD., (© 2023. The Author(s).)

Background: The migraine premonitory phase is characterized in part by increased thirst, urination and yawning. Imaging studies show that the hypothalamus is activated in the premonitory phase. Stress is a well know migraine initiation factor which was demonstrated to engage dynorphin/kappa opioid receptors (KOR) signaling in several brain regions, including the hypothalamus. This study proposes the exploration of the possible link between hypothalamic KOR and migraine premonitory symptoms in rodent models., Methods: Rats were treated systemically with the KOR agonist U-69,593 followed by yawning and urination monitoring. Apomorphine, a dopamine D1/2 agonist, was used as a positive control for yawning behaviors. Urination and water consumption following systemic administration of U-69,593 was also assessed. To examine if KOR activation specifically in the hypothalamus can promote premonitory symptoms, AAV8-hSyn-DIO-hM4Di (Gi-DREADD)-mCherry viral vector was microinjected into the right arcuate nucleus (ARC) of female and male KOR CRE or KOR WT mice. Four weeks after the injection, clozapine N-oxide (CNO) was administered systemically followed by the assessment of urination, water consumption and tactile sensory response., Results: Systemic administration of U-69,593 increased urination but did not produce yawning in rats. Systemic KOR agonist also increased urination in mice as well as water consumption. Cell specific Gi-DREADD activation (i.e., inhibition through Gi-coupled signaling) of KOR CRE neurons in the ARC also increased water consumption and the total volume of urine in mice but did not affect tactile sensory responses., Conclusion: Our studies in rodents identified the KOR in a hypothalamic region as a mechanism that promotes behaviors consistent with clinically-observed premonitory symptoms of migraine, including increased thirst and urination but not yawning. Importantly, these behaviors occurred in the absence of pain responses, consistent with the emergence of the premonitory phase before the headache phase. Early intervention for preventive treatment even before the headache phase may be achievable by targeting the hypothalamic KOR., (© 2022. The Author(s).)

Gut microbiota alteration (gut dysbiosis) occurs during the onset and progression of Parkinson's disease. Gut dysbiosis biomarkers could be relevant to prodromal disease. Urolithins, anti-inflammatory metabolites produced from some dietary polyphenols by specific gut microbial ecologies (urolithin metabotypes), have been proposed as biomarkers of gut microbiota composition and functionality. However, this has not been explored in Parkinson's disease patients. The current study aimed to assess associations between urolithin metabotypes, gut dysbiosis and disease severity in Parkinson's disease patients. Participants (52 patients and 117 healthy controls) provided stool samples for microbiota sequencing and urine samples for urolithin profiling before and after consuming 30 g of walnuts for three days. Data on demographics, medication, disease duration and Hoehn and Yahr disease stage were collected. We observed a significant gradual increase of urolithin non-producers (metabotype-0) as the disease severity increased. The gut microbiome of metabotype-0 patients and patients with the greatest severity was characterized by a more altered bacterial composition, i.e. , increased pro-inflammatory Enterobacteriaceae and reduced protective bacteria against autoimmune and inflammatory processes, including butyrate and urolithin-producing bacteria (Lachnospiraceae members and Gordonibacter ). Besides, their microbiome was characterized by predictive functions of lipopolysaccharide biosynthesis and metabolism of glutathione, cysteine and methionine that could indirectly reflect the gut pro-inflammatory status. Urolithin detection in urine is a feasible, non-invasive and fast approach that can reflect gut microbiome dysbiosis and intestinal inflammation in Parkinson's disease patients. Our current study could provide novel strategies for improving diagnostics, and for preventing and treating disease progression in microbiota-based interventions.

Migration is an important function for natural killer cells. Cell motility has implications in development, tissue infiltration, and cytotoxicity, and measuring the properties of natural killer (NK) cell migration using in vitro assays can be highly informative. Many researchers have an interest in studying properties of NK cell migration in the context of genetic mutation, disease, or in specific tissues and microenvironments. Motility assays can also provide information on the localization of proteins during different phases of cell migration. These assays can be performed on different surfaces for migration or coupled with chemoattractants and/or target cells to test functional outcomes or characterize cell migration speeds and phenotypes. NK cells undergo migration during differentiation in tissue, and these conditions can be modeled by culturing NK cells on a confluent bed of stromal cells on glass and imaging cell migration. Alternatively, fibronectin- or ICAM-1-coated surfaces promote NK cell migration and can be used as substrates. Here, we will describe techniques for the experimental setup and analysis of NK cell motility assays by confocal microscopy or in-incubator imaging using commercially available systems. Finally, we describe open-source software for analyzing cell migration using manual tracking or automated approaches and discuss considerations for the implementation of each of these methods., (© 2022. The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature.)

Objectives: In this study, we evaluated the association between perceived stress and indicators of metabolic syndrome and how this association is mediated by sleep problems, unhealthy eating habits, and night eating syndrome, in addition to serum levels of ghrelin and cortisol in university students., Methods: We recruited 192 students from a public university in Mexico. Weight, height, waist circumference and blood pressure were taken in accordance with standard protocols. Validated questionnaires were used to assess perceived stress, sleep quality and eating habits. Fasting blood samples were taken to measure ghrelin, cortisol, triglycerides, glucose and HDL-C., Results: Path Analysis indicated direct positive effects of stress over PSQI (β = 0.341) and NES (β = 0.443); PSQI over NES (β = 0.233) and NES over glucose (β = 0.170), triglycerides over LDL-C (β = 0.215), waist circumference over SBP (β = 0.259). Likewise, standardized negative regression weights of PSQI over Diet Quality Index (β = -0.239) and ghrelin concentrations (β = -0.132), ghrelin over Diet Quality Index (β = -0.188) and waist circumference (β = -0.147). Diet Quality Index over triglycerides (β = -0.184); sleep duration over systolic blood pressure (β = -0.242); waist circumference over HDL-C (β = -0.256)., Conclusion: Psychological stress leads to increased indicators of MetS via decreased sleep quality, inadequate eating habits and eating behavior in university students.

Motivation: Co-expression networks are a powerful gene expression analysis method to study how genes co-express together in clusters with functional coherence that usually resemble specific cell type behavior for the genes involved. They can be applied to bulk-tissue gene expression profiling and assign function, and usually cell type specificity, to a high percentage of the gene pool used to construct the network. One of the limitations of this method is that each gene is predicted to play a role in a specific set of coherent functions in a single cell type (i.e. at most we get a single for each gene). We present here GMSCA (Gene Multifunctionality Secondary Co-expression Analysis), a software tool that exploits the co-expression paradigm to increase the number of functions and cell types ascribed to a gene in bulk-tissue co-expression networks., Results: We applied GMSCA to 27 co-expression networks derived from bulk-tissue gene expression profiling of a variety of brain tissues. Neurons and glial cells (microglia, astrocytes and oligodendrocytes) were considered the main cell types. Applying this approach, we increase the overall number of predicted triplets by 46.73%. Moreover, GMSCA predicts that the SNCA gene, traditionally associated to work mainly in neurons, also plays a relevant function in oligodendrocytes., Availabilityand Implementation: The tool is available at GitHub, https://github.com/drlaguna/GMSCA as open-source software., Supplementary Information: Supplementary data are available at Bioinformatics online., (© The Author(s) 2021. Published by Oxford University Press.)

The mechanisms responsible for the selective vulnerability of specific neuronal populations in Parkinson's disease are poorly understood. Oxidative stress secondary to brain iron accumulation is one postulated mechanism. We measured iron deposition in 180 cortical regions of 96 patients with Parkinson's disease and 35 control subjects using quantitative susceptibility mapping. We estimated the expression of 15 745 genes in the same regions using transcriptomic data from the Allen Human Brain Atlas. Using partial least squares regression, we then identified the profile of gene transcription in the healthy brain that underlies increased cortical iron in patients with Parkinson's disease relative to controls. Applying gene ontological tools, we investigated the biological processes and cell types associated with this transcriptomic profile and identified the sets of genes with spatial expression profiles in control brains that correlated significantly with the spatial pattern of cortical iron deposition in Parkinson's disease. Gene ontological analyses revealed that these genes were enriched for biological processes relating to heavy metal detoxification, synaptic function and nervous system development and were predominantly expressed in astrocytes and glutamatergic neurons. Furthermore, we demonstrated that the genes differentially expressed in Parkinson's disease are associated with the pattern of cortical expression identified in this study. Our findings provide mechanistic insights into regional selective vulnerabilities in Parkinson's disease, particularly the processes involving iron accumulation., (© The Author(s) (2021). Published by Oxford University Press on behalf of the Guarantors of Brain.)

Intraocular retinoblastoma treatment has changed radically over the last decade, leading to a notable improvement in ocular survival. However, eyes that relapse remain difficult to treat, as few alternative active drugs are available. More challenging is the scenario of central nervous system (CNS) metastasis, in which almost no advancements have been made. Both clinical scenarios represent an urgent need for new drugs. Using an integrated multidisciplinary approach, we developed a decision process for prioritizing drug selection for local (intravitreal [IVi], intrathecal/intraventricular [IT/IVt]), systemic, or intra-arterial chemotherapy (IAC) treatment by means of high-throughput pharmacological screening of primary cells from two patients with intraocular tumor and CNS metastasis and a thorough database search to identify clinical and biopharmaceutical data. This process identified 169 compounds to be cytotoxic; only 8 are FDA-approved, lack serious toxicities and available for IVi administration. Four of these agents could also be delivered by IT/IVt. Twelve FDA-approved drugs were identified for systemic delivery as they are able to cross the blood-brain barrier and lack serious adverse events; four drugs are of oral usage and six compounds that lack vesicant or neurotoxicity could be delivered by IAC. We also identified promising compounds in preliminary phases of drug development including inhibitors of survivin, antiapoptotic Bcl-2 family proteins, methyltransferase, and kinesin proteins. This systematic approach may be applied more broadly to prioritize drugs to be repurposed or to identify novel hits for use in retinoblastoma treatment.

Different cellular mechanisms have been described as being potentially involved in the progression of neurodegeneration in Parkinson's disease, although their role is still unclear. The present study aimed to identify in detail, through differentially expressed genes analysis by bioinformatics approaches, the molecular mechanisms triggered after a systemic insult in parkinsonian mice. To address this objective, we combined a dextran sodium sulfate (DSS)-induced ulcerative colitis experimental mice model with an acute 1-methyl-4-phenyl-1,2,3,6-tetradropyridine (MPTP) intoxication. The animals were divided into four experimental groups based on the different treatments: (i) control, (ii) DSS, (iii) MPTP and (iv) MPTP + DSS. The data obtained by microarray and functional enrichment analysis point out the implication of different molecular mechanisms depending on the experimental condition. We see, in the striatum of animals intoxicated only with DSS, dysfunction processes related to the blood. On the other hand, oxidative stress processes are more prominent at the MPTP intoxicated mice. Finally, differentially expressed genes within the MPTP + DSS show functional enrichment in inflammation and programmed cell death. Interestingly, we identify a significant synergistic negative effect of both toxins since the expression of differentially expressed genes (DEGs) related to balanced cellular homeostasis was not enough to prevent processes associated with cell death. This work provides detailed insights into the involvement of systemic inflammation, triggered after an insult in the colon, in the progression of the degeneration in Parkinsonism. In this way, we will be able to identify promising therapeutic targets that prevent the contribution of inflammatory processes in the progression of Parkinson's disease.

Background : Parkinson's disease (PD) is described as an age-related neurodegenerative disorder. However, the vast majority of research is carried out using experimental models of young animals lacking the implications of the decline processes associated with aging. It has been suggested that several molecular pathways are involved in the perpetuation of the degeneration and the neuroinflammation in PD. Among others, mitogen-activated protein kinases (MAPKs) have been highly implicated in the development of PD, and regulating components of their activity are indicated as promising therapeutic targets. Methods : To further define how MAPKs expression is related to the glial response and neuronal cell death, Parkinsonism was induced under an acute regimen in old mice. Moreover, the sacrifice was carried out at different time points (4, 8, 24, and 48 h) after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine hydrochloride (MPTP) injections to describe the early dynamic changes over time produced by the intoxication. Results : The results revealed that neuronal death increases as glial response increases in the nigrostriatal pathway. It was observed that both processes increase from 4 h in the ventral mesencephalon (VM), and neuronal death becomes significant at 48 h. In the striatum, they were significantly increased from 48 h after the MPTP administration compared with that in the control mice. Moreover, the p-ERK levels decrease, while phospho-p38 expression increases specifically in the striatum at 48 h after MPTP intoxication. Conclusions : The importance of these data lies in the possibility of elucidating the underlying mechanisms of neurodegenerative processes under aging conditions to provide knowledge for the search of solutions that slow down the progression of PD., (Copyright © 2020 Gil-Martinez, Cuenca-Bermejo, Gallo-Soljancic, Sanchez-Rodrigo, Izura, Steinbusch, Fernandez-Villalba and Herrero.)

Sleep deprivation (SD) has been reported to induce transient cognitive impairment in functional domains commonly affected in dementia, including memory. Indeed, sleep disturbance has been proposed as an early marker for Alzheimer's disease (AD). SD emulates many aging-related modifications, including important memory dysfunctions possibly caused by triggers of stress such as cortisol. Although exercise is widely assumed to be beneficial for overall health, only recently has the research community focused its attention on its possible effects on brain functions such as cognition. Octodon degus (O. degus) is a recent rodent model considered suitable for the study of neurodegenerative diseases, since it spontaneously develops several histopathological hallmarks observed in AD. We aimed to uncover the interaction between stress, exercise, age and transient memory impairments after SD insult. In this study, animals had free individual access to wheels to practice voluntary exercise. The Barnes Maze (BM) task was conducted with young and aged O. degus animals after combining voluntary exercise and either normal sleep or SD. Plasma cortisol levels were measured after each condition. SD impaired hippocampus-dependent memory in both young and old animals, while cortisol levels did not significantly differ between non-SD and SD animals. However, voluntary exercise for 45 days improved the cognitive impairment caused by SD compared with the control condition. Moreover, voluntary exercise decreased plasma cortisol levels in both conditions, independently of the age., (Copyright © 2019 Elsevier B.V. All rights reserved.)

After Alzheimer's disease, Parkinson's disease (PD) is the second most prevalent and incidental neurodegenerative disorder, affecting more than 2% of the population older than 65 years old. Since it was first described 200 years ago by Dr James Parkinson, great steps have been made in the understanding of the pathology. However, the cause(s) that initiates and perpetuates the neurodegenerative process is (are) still not clear. Thus, early diagnosis is not available, nor are there efficient therapies that can stop neurodegeneration. PD clinical features are defined by motor (like bradykinesia, resting tremor, gait impairment) and non-motor symptoms (like constipation, apathy, fathigue, olfactory dysfunction, depression and cognitive decline) that get more severe as the disease advances. Neuropathological hallmarks comprise selective loss of dopaminergic neurons in the Substantia Nigra pars compacta (SNpc) and Lewy bodies (LB) in different nuclei of the nervous system. Numerous studies have shown that these pathological features are aggravated by the confluence of other contributing factors, such as a genetic component, exposure to environmental toxins, mitochondrial dysfunction, increase of oxidative stress, calcium imbalance and chronic neuroinflammation, among others. Here, we provide a summary of the actual state of PD's pathology, the most studied molecular mechanisms, classic and novel therapeutic strategies and diagnosis methods, especially highlighting recent advances in these 200 years.

Breast cancer can be classified into molecular subtypes. Tumors overexpressing HER2 protein are more aggressive and metastatic; hence, patients have a poor prognosis. Anti-HER2 strategies, such as the monoclonal antibody Trastuzumab (Tz), have therefore been developed. Despite this progress, not all patients respond to the treatment. Retinoic acid (RA) has been proposed as an adjuvant treatment of breast carcinoma because of its ability to inhibit cell growth. We evaluated the effect of Tz in combination with RA on the viability, adhesion, migration, invasion and expression of migration-related proteins in SKBR3 and BT-474 human breast cancer cells. MTT, pharmacological interaction analysis, immunofluorescence, adhesion/migration/invasion and Western blot assays were performed. The coadministration of both drugs synergistically decreased cell survival. Tz+RA significantly decreased adhesion/migration/invasion in both cell types. Tz+RA strongly reduced FAK and HER2 expression and induced nuclear FAK translocation. In addition, a granular distribution of HER2 receptor was observed after the combined treatment. In conclusion, the coadministration of both drugs in patients with this type of cancer could contribute to the improvement of their prognosis and reduce the adverse effects of therapy because the applied Tz doses would be lower due to the adjuvant effect of RA., Competing Interests: CONFLICTS OF INTEREST The authors declare that they have no competing interests.

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a well-known neuropeptide with strong neurotrophic and neuroprotective effects. PACAP exerts its protective actions via three G protein-coupled receptors: the specific Pac1 receptor (Pac1R) and the Vpac1/Vpac2 receptors, the neuroprotective effects being mainly mediated by the Pac1R. The protective role of PACAP in models of Parkinson's disease and other neurodegenerative diseases is now well-established in both in vitro and in vivo studies. PACAP and its receptors occur in the mammalian brain, including regions associated with Parkinson's disease. PACAP receptor upregulation or downregulation has been reported in several injury models or human diseases, but no data are available on alterations of receptor expression in Parkinson's disease. The model closest to the human disease is the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced macaque model. Therefore, our present aim was to evaluate changes in Pac1R expression in basal ganglia related to Parkinson's disease in a macaque model. Monkeys were rendered parkinsonian with MPTP, and striatum, pallidum, and cortex were evaluated for Pac1R immunostaining. We found that Pac1R immunosignal was markedly reduced in the caudate nucleus, putamen, and internal and external parts of the globus pallidus, while the immunoreactivity remained unchanged in the cortex of MPTP-treated parkinsonian monkey brains. This decrease was attenuated in some brain areas in monkeys treated with L-DOPA. The strong, specific decrease of the PACAP receptor immunosignal in the basal ganglia of parkinsonian macaque monkey brains suggests that the PACAP/Pac1R system may play an important role in the development/progression of the disease.

Background: Depressive disorders are common during pregnancy. There is compelling evidence that the inflammatory response system is important in the pathophysiology of depression. Higher concentrations of proinflammatory cytokines including tumor necrosis factor-alpha (TNF-α) in depressed subjects have been described. Because several polymorphisms in the TNF-α promoter region are known to affect its gene expression, the aim of this study was determine whether TNF-α - 857C/T, -308G/A, and -238G/A polymorphisms confer susceptibility to depression during pregnancy in a Mexican mestizo population., Methods: This case-control study involved 153 depressed pregnant women and 177 controls. Polymorphisms were genotyped using real-time PCR. Odds ratios (OR) and 95% confidence intervals adjusted by age, body mass index, number of pregnancies, months of pregnancy and number of abortions were used to estimate risk., Results: The -857CT genotype was found to increase the risk for depression (OR= 1.73, 95% CI= 1.06-2.82). In contrast, the -238GA genotype reduced the risk (OR= 0.33, 95% CI= 0.14-0.72). The - 308G/A polymorphism was not associated with risk for depression. Finally, the C857-G308-A238 haplotype was associated with a decreased risk of depression (OR= 0.35, 95% CI= 0.15-0.82)., Conclusion: Our results show for the first time an association between TNF-α -857C/T and -238G/A polymorphisms and prenatal depression in Mexican mestizo population., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.)

The extrusion technology of blends formed by compounds with different physicochemical properties often results in new materials that present properties distinctive from its original individual constituents. Here, we report the use of melt extrusion of blends made from low-cost materials to produce a biodegradable foam suitable for use as an inoculant carrier of plant growth-promoting bacteria (PGPB). Six formulations were prepared with variable proportions of the raw materials; the resulting physicochemical and structural properties are described, as well as formulation performance in the maintenance of bacterial viability during 120 days of storage. Differences in blend composition influenced foam density, porosity, expansion index, and water absorption. Additionally, differences in the capability of sustaining bacterial viability for long periods of time were more related to the foam composition than to the resulting physicochemical characteristics. Microscopic analyses showed that the inoculant bacteria had firmly attached to the extruded material by forming biofilms. Inoculation assays using maize plants demonstrated that the bacteria attached to the extruded foams could survive in the soil for up to 10 days before maize sowing, without diminishing its ability to promote plant growth. The results presented demonstrate the viability of the new matrix as a biotechnological material for bacterial delivery not only in agriculture but also in other biotechnological applications, according to the selected bacterial strains.

Background: Therapeutic vaccination is being studied in eradication and "functional cure" strategies for HIV-1. The Profectus Biosciences multiantigen (MAG) HIV-1 DNA vaccine encodes HIV-1 Gag/Pol, Nef/Tat/Vif, and Envelope, and interleukin-12 (IL-12) and is delivered by electroporation combined with intramuscular injection (IM-EP)., Methods: Sixty-two HIV-1-infected patients on antiretroviral therapy (plasma HIV-1 RNA levels ≤ 200 copies/mL; CD4(+) T-cell counts ≥ 500 cells/mm(3)) were randomly allocated 5:1 to receive vaccine or placebo. At weeks 0, 4, and 12, 4 consecutive cohorts received 3000 μg HIV MAG pDNA with 0, 50, 250, or 1000 μg of IL-12 pDNA by IM-EP. A fifth cohort received HIV MAG pDNA and 1000 μg of IL-12 pDNA by standard IM injection., Results: CD4(+) T cells expressing IL-2 in response to Gag and Pol and interferon-γ responses to Gag, Pol, and Env increased from baseline to week 14 in the low-dose (50-μg) IL-12 arm vs. placebo (P < 0.05; intracellular cytokine staining). The total increase in the IL-2-expressing CD4 T-cell responses to any antigen was also higher in the low-dose IL-12 arm vs. placebo (P = 0.04). Cytokine responses by CD8 T cells to HIV antigens were not increased in any vaccine arm relative to placebo., Conclusions: HIV-1 MAG/low-dose IL-12 DNA vaccine delivered by IM-EP augmented CD4(+) but not CD8(+) T-cell responses to multiple HIV-1 antigens.

Climate, behavior, ecology, and oceanography shape patterns of biodiversity in marine faunas in the absence of obvious geographic barriers. Marine turtles are an example of highly migratory creatures with deep evolutionary lineages and complex life histories that span both terrestrial and marine environments. Previous studies have focused on the deep isolation of evolutionary lineages (>3 mya) through vicariance; however, little attention has been given to the pathways of colonization of the eastern Pacific and the processes that have shaped diversity within the most recent evolutionary time. We sequenced 770 bp of the mtDNA control region to examine the stock structure and phylogeography of 545 green turtles from eight different rookeries in the central and eastern Pacific. We found significant differentiation between the geographically separated nesting populations and identified five distinct stocks (F ST = 0.08-0.44, P < 0.005). Central and eastern Pacific Chelonia mydas form a monophyletic group containing 3 subclades, with Hawaii more closely related to the eastern Pacific than western Pacific populations. The split between sampled central/eastern and western Pacific haplotypes was estimated at around 0.34 mya, suggesting that the Pacific region west of Hawaii has been a more formidable barrier to gene flow in C. mydas than the East Pacific Barrier. Our results suggest that the eastern Pacific was colonized from the western Pacific via the Central North Pacific and that the Revillagigedos Islands provided a stepping-stone for radiation of green turtles from the Hawaiian Archipelago to the eastern Pacific. Our results fit with a broader paradigm that has been described for marine biodiversity, where oceanic islands, such as Hawaii and Revillagigedo, rather than being peripheral evolutionary "graveyards", serve as sources and recipients of diversity and provide a mechanism for further radiation.

Rhizobial surface polysaccharides (SPS) are, together with nodulation (Nod) factors, recognized as key molecules for establishment of rhizobia-legume symbiosis. In Rhizobium tropici, an important nitrogen-fixing symbiont of common bean (Phaseolus vulgaris L.), molecular structures and symbiotic roles of the SPS are poorly understood. In this study, Rhizobium sp. strain PRF 81 genes, belonging to the R. tropici group, were investigated: lpxA and lpxE, involved in biosynthesis and modification of the lipid-A anchor of lipopolysaccharide (LPS), and rkpI, involved in synthesis of a lipid carrier required for production of capsular polysaccharides (KPS). Reverse transcription quantitative PCR (RT-qPCR) analysis revealed, for the first time, that inducers released from common bean seeds strongly stimulated expression of all three SPS genes. When PRF 81 cells were grown for 48 h in the presence of seed exudates, twofold increases (p < 0.05) in the transcription levels of lpxE, lpxA, and rkpI genes were observed. However, higher increases (p < 0.05) in transcription rates, about 50-fold for lpxE and about 30-fold for lpxA and rkpI, were observed after only 5 min of incubation with common bean seed exudates. Evolutionary analyses revealed that lpxA and lpxE of PRF81 and of the type strain of R. tropici CIAT899(T)clustered with orthologous Rhizobium radiobacter and were more related to R. etli and Rhizobium leguminosarum, while rkpI was closer to the Sinorhizobium sp. group. Upregulation of lpxE, lpxA, and rkpI genes suggests that seed exudates can modulate production of SPS of Rhizobium sp. PRF81, leading to cell wall changes necessary for symbiosis establishment.

Objective: The objective of the present study is to investigate the association between attention deficit/hyperactivity disorder (ADHD), predominantly inattentive type (ADHD-I) and prenatal, delivery and early postnatal complications (PDPC)., Method: In a case-control design, we assessed a sample of 124 children and adolescents with ADHD-I and 124 non-ADHD controls (6-17 years old) from both a non-referred (n = 200) and a clinical sample (n = 48). Cases and controls, matched by gender and age, were systematically evaluated through structured diagnostic interviews. Prenatal, delivery and early postnatal complications (PDPC), as well as potential confounders were evaluated by direct interview with biological mothers., Results: Conditional logistic regression analysis showed that children and adolescents whose mothers presented more PDPC had a significantly higher risk for ADHD-I (p = 0.005; OR = 1.25; CI 95%: 1.1-1.5)., Conclusions: In a case-control study, we expanded to ADHD-I previous findings suggesting the association between perinatal factors and broadly defined ADHD. Due to the preventable nature of some of these PDPC, our results have clear impact in public mental health policies.

The aim of this investigation was to examine the influence of extrusion on the bioactive compounds and the antioxidant capacity of bean/corn mixtures. Whole bean flour and nixtamalized corn were mixed in a 60:40 proportion and extrusion was performed in different moisture (14.5%, 15.4%, 17.1% and 18.0%) and temperature (150°C, 160°C, 170°C, 180°C and 190°C) conditions in order to find the optimal extrusion conditions. According to their functional properties and antioxidant status, the mixtures 142°C/16.3% H, 170°C/16.3% H and 198°C/16.3% H were defined as optimal, moderate and bad, respectively. Total polyphenols and flavonoids in the mixture of 142°C/16.3% H (15.09±1.7 mg gallic acid equivalent [GAE]/g dry weight [DW] and 1.57±0.2 mg catechin equivalent [CE]/g DW) were significantly higher (P<0.05) than in the sample 170°C/16.3% H (9.42±1.1 mg GAE/g DW and 1.4±0.1 mg CE/g DW) and the mixture 198°C/16.3% H (6.46±0.8 mg GAE/g DW and 0.78±0.1 mg CE/g DW). The antioxidant activity (37.02±3.8 and 25.01±2.5 µM Trolox equivalent [TE]/g DW) of mixture 142°C/16.3% H, determined by the cupric reducing antioxidant capacity with Trolox equivalent antioxidant capacity and β-carotene-linoleic acid (β-carotene,% of inhibition) assays, was significantly higher (P<0.05) than in 170°C/16.3% H (25.69±2.8 and 17.02±1.8 µM TE/g DW) and in mixture 198°C/16.3% H (13.93±1.5 and 8.94±0.9 µM TE/g DW), respectively. The free polyphenols, flavonoids and the antioxidant activities showed lower results than the hydrolyzed ones. The correlation coefficients between polyphenols, flavonoids, and cupric reducing antioxidant capacity capacities were between 0.93 and 0.99. In cereal proteins extracted and separated by electrophoresis, some differences were found in the sodium dodecyl sulfate-protein bands in the region from 36 to 45 kDa for 142°C/16.3% H, in comparison with other samples. Therefore, there is a need to find such conditions for the extrusion procedures that would take into consideration the contents of the bioactive compounds and the antioxidant capacity in the end product.

There are controversial evidence in the literature on the role of comorbid anxiety disorders (ANX) in the improvement of attention-deficit/hyperactivity disorder (ADHD) symptoms with methylphenidate (MPH) treatment. Our main objective was to assess differences in the response to MPH treatment in children and adolescents with ADHD with and without comorbid ANX. We extensively evaluated response to MPH in a naturalistic study of 280 children and adolescent with ADHD according to DSM-IV criteria. Psychiatric diagnoses (ADHD, ANX, and other comorbidities) were assessed by semi-structured interviews (K-SADS-E). Response to MPH was assessed by means of total score in the Swanson, Nolan, and Pelham Scale-version IV (SNAP-IV) after 1 month of treatment. There was no significant between-group difference in the response to treatment with MPH after 1 month either when SNAP-IV scores were assessed dimensionally or categorically (moderate response) (P > 0.05). Our findings suggest that comorbid ANX do not interfere in the response to MPH on core ADHD symptoms.

The properties of Mon Thong, Chani and Kan Yao durian (Durio zibethinus Murr.) cultivars were compared in vitro and in vivo studies in order to find the best one as a supplement to antiatherosclerotic diet. Total polyphenols (361.4+/-35.3 mgGAE/100g FW), flavonoids (93.9+/-8.9 mgCE/100g FW) and total antioxidant capacity determined by DPPH and beta-carotene-linoleic acid assays (261.3+/-25.3 microMTE/100g FW and 77.8+/-7.8% of inhibition) were maximal in Mon Thong in comparison with Chani and Kan Yao and showed a good correlation between these three variables (R(2)=0.9859). Five groups of rats were fed diets supplemented with cholesterol and different durian cultivars. Diets supplemented with Mon Thong and to a lesser degree with Chani and Kan Yao significantly hindered the rise in the plasma lipids (TC - 8.7%, 16.1% and 10.3% and (b) LDL-C - 20.1%, 31.3% and 23.5% for the Chol/Kan Yao, Chol/Mon Thong and Chol/Chani, respectively) and the decrease in plasma antioxidant activity (P<0.05). Nitrogen retention remained significantly higher in Chol/Mon Thong than in other diet groups. Diet supplemented with Mon Thong affected the composition of plasma fibrinogen in rats and showed more intensity in protein bands around 47 kDa. No lesions were found in the examined tissue of heart and brains. Mon Thong cultivar is preferable for the supplementation of the diet as positively influenced the lipid, antioxidant, protein and metabolic status. The durian fruit till now was not investigated extensively, therefore based on the results of this study durian cultivars can be used as a relatively new source of antioxidants.

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Xiphophorus fishes and interspecies hybrids are used in many areas of contemporary research. Due to their high degree of heterozygosity Xiphophorus interspecies hybrids are extremely valuable models for molecular genetic study of gene regulation in physiology and behavior. Historically, Xiphophorus fish have made a contribution to understanding the genetics underlying tumorigenesis but the role this experimental model system may play in contemporary comparative biology has only just begun to be realized. In spite of many advantages a genome-level Xiphophorus sequencing project has not yet been initiated. In order to set a stage for a genome-level initiative, many Xiphophorus resources have recently been, or are currently being developed. Recent completion of the Xiphophorus gene linkage map, construction of microsatellite marker and EST databases, and the accessibility of BAC library resources hallmark the progress in development of genomic capabilities for Xiphophorus investigations. Herein we review current Xiphophorus genomic resources and to provide the reader with information that will enable them to access these resources available to enhance their investigations.

Teleost fish genome projects involving model species are resulting in a rapid accumulation of genomic and expressed DNA sequences in public databases. The expressed sequence tags (ESTs) collected in the databases can be mined for the analysis of both structural and functional genomics. In this study, we in silico analyzed 49,430 unigenes representing a total of 692,654 ESTs from four model fish for their potential use in developing simple sequence repeats (SSRs), or microsatellites. After bioinformatical mining, a total of 3,018 EST derived SSRs (EST-SSRs) were identified for 2,335 SSR containing ESTs (SSR-ESTs). The frequency of identified SSR-ESTs ranged from 1.5% for Xiphophorus to 7.3% for zebrafish. The dinucleotide repeat motif is the most abundant SSR, accounting for 47%, 52%, 64%, and 78% for medaka, Fundulus, zebrafish, and Xiphophorus, respectively. Simulation analysis suggests that a majority of these EST-SSRs have sufficient flanking sequences for polymerase chain reaction (PCR) primer design. Comparative DNA sequence analyses of SSR-ESTs identified several cross-species SSRs and sequences that may be used as cross-reference genes in comparative studies. For example, the flanking sequences of one SSR (CTG)n within the pituitary tumor-transforming gene (PTTG) 1 interacting protein (PTTGIP), showed conservation spanning the medaka, Fundulus, human, and mouse genomes. This study provides a large body of information on EST-SSRs that can be useful for the development of polymorphic markers, gene mapping, and comparative genome analysis. Functional analysis of these SSR-ESTs may reveal their role in metabolism and gene evolution of these model species.

In this study, biofiltration using a natural wood chip medium and a commercial biofiltration medium was evaluated for the removal of moderate concentrations of hydrogen sulfide (H2S) (up to 100 parts per million by volume [ppmv]) in the presence of significant concentrations of ammonia (NH3). These levels were chosen as representative of wastewater lift station emissions in the Brownsville, TX, area. NH3-removing portions of the biofilms may compete with H2S-removing portions and inhibit H2S removal. H2S process removal efficiencies for the commercial and natural media ranged from 90 to 96% depending on inlet loading and media type and bed height. Kinetic analysis of the H2S removal process followed apparent first-order reaction behavior. The average first-order reaction rates were 0.03 sec(-1) for the commercial medium and 0.09 sec(-1) for the natural medium. Pressure drops across the columns ranged from 0.41 in. H2O/ft for the commercial medium to 1.41 in. H2O/ft for the natural medium. NH3 gas levels of up to 80 ppmv did not affect the H2S removal process efficiency, and calculated kinetic rate constants for H2S removal remained almost the same. The NH3 gas also was removed simultaneously with the H2S up to 98% removal efficiency by the commercial medium.

Amaranth, soybean and maize were screened for proteins and their nutritional value. Isopropanol-soluble protein and buffer-soluble protein fractions were extracted from seeds and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The comparison of the identity and differences between investigated plants was carried out by the obtained SDS-PAGE electrophoretic patterns, and their microstructure was determined by scanning electron microscopy. Electrophoretic patterns of extracted proteins have shown that the main protein subunits were concentrated between 10 and 50 kDa. Variations were found in major fractions and minor bands as well as in the fine structure. The microstructure of pseudocereal and cereal protein fractions was inter-related with the results obtained by their electrophoretic separation. Pseudocereal amaranth can be used as a nutritive substitute of cereal maize in functional foods.

Oxidative modification of low-density lipoprotein (LDL) particles is a key event in the development of atherosclerosis. Oxidized LDL induces oxidative stress and modifies gene expression in endothelial cells. Berries constitute a rich dietary source of phenolic antioxidants. We found that the endemic Chilean berry Aristotelia chilensis (ach) has higher phenol content and scores better for total radical-trapping potential and total antioxidant reactivity in in vitro antioxidant capacity tests, when compared to different commercial berries. The juice of ach is also effective in inhibiting copper-induced LDL oxidation. In human endothelial cell cultures, the addition of ach juice significantly protects from hydrogen peroxide-induced intracellular oxidative stress and is dose-dependent. The aqueous, anthocyanin-rich fraction of ach juice accounts for most of ach's antioxidant properties. These results show that ach is a rich source of phenolics with high antioxidant capacity and suggest that it may have antiatherogenic properties.

The effects of two cueing treatments, Phonological Cueing Treatment (PCT) and Semantic Cueing Treatment (SCT), were examined with three chronic speakers with aphasia. The effects of treatment on action naming were measured with the use of single-subject experimental designs. The participants had received PCT and SCT to improve object naming in a previous investigation and had responded positively to both treatments. In the current study, Speaker 1 received SCT, Speaker 2 received PCT, and Speaker 3 received both SCT and PCT. Action naming improved for Speakers 1 and 3, but not for Speaker 2. These findings indicate that PCT and SCT may have utility in facilitating action naming for some speakers with aphasia but that the effects of these treatments may vary across grammatical form classes (e.g., nouns versus verbs).

For decades it has been assumed that in order to insert macromolecules into the embryo blastocoel for numerous experimental purposes, microinjection was required. Microinjection, however, can be only performed on a few embryos at a time, thus precluding many studies that could involve large populations of embryos. Laser scanning confocal microscopy, with its optical sectioning advantage, showed that fluorochrome-labeled macromolecular lectins and bovine albumin enter the blastocoel of living, swimming sea urchin embryos following a period of incubation without microinjection. A procedure is also described that shows macromolecular entry is substantially accelerated in low calcium seawater. The information gained from this study should greatly facilitate experiments on entire populations of millions of embryos at a time that require access of macromolecules to the embryo interior.