Search

The plant microbiome plays a crucial role in facilitating plant growth through enhancing nutrient cycling, acquisition and transport, as well as alleviating stresses induced by nutrient limitations. Despite its significance, the relative importance of common agronomic practices, such as nitrogenous fertilizer, in shaping the plant microbiome across different cultivars remains unclear. This study investigated the dynamics of bacterial and fungal communities in leaf, root, rhizosphere, and bulk soil in response to nitrogenous fertilizer across ten sorghum varieties, using 16S rRNA and ITS gene amplicon sequencing, respectively. Our results revealed that nitrogen addition had a greater impact on sorghum-associated microbial communities compared to cultivar. Nitrogen addition significantly reduced bacterial diversity in all compartments except for the root endophytes. However, N addition significantly increased fungal diversity in both rhizosphere and bulk soils, while significantly reducing fungal diversity in the root endophytes. Furthermore, N addition significantly altered the community composition of bacteria and fungi in all four compartments, while cultivars only affected the community composition of root endosphere bacteria and fungi. Network analysis revealed that fertilization significantly reduced microbial network complexity and increased fungal-related network complexity. Collectively, this study provides empirical evidence that sorghum-associated microbiomes are predominantly shaped by nitrogenous fertilizer rather than by cultivars, suggesting that consistent application of nitrogenous fertilizer will ultimately alter plant-associated microbiomes regardless of cultivar selection., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier B.V. All rights reserved.)

Necroptosis is a caspase-independent programmed cell death process characterized by morphological similarities to necrosis and the potential to cause significant inflammatory reactions. The initiation, execution, and inhibition of necroptosis involve a complex interplay of various signaling proteins. When death receptors bind to ligands, necroptosis is triggered through the receptor-interacting serine/threonine-protein kinase 1 (RIPK1)/RIPK3/Mixed Lineage Kinase Domain-Like (MLKL) axis, leading to inflammatory reactions in the surrounding tissues. This process encompasses numerous physiological regulatory mechanisms and contributes to the development and progression of certain diseases. The mechanisms of necroptosis were not well conserved across terrestrial and aquatic organisms, with differences in some components and functions. Given the significant challenges that aquatic animal diseases pose to aquaculture, research interest in necroptosis has surged recently, particularly in studies focusing on fish. Understanding necroptosis in fish can lead to interventions that offer potential breakthroughs in disease inhibition and fish health improvement., Competing Interests: Declaration of competing interest We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Ionic conductive hydrogels (ICHs) have attracted great attention because of their excellent biocompatibility and structural similarity with biological tissues. However, it is still a huge challenge to prepare a high strength, conductivity and durability hydrogel-based flexible sensor with dual network structure through a simple and environmentally friendly method. In this work, a simple one-pot cycle freezing thawing method was proposed to prepare ICHs by dissolving polyvinyl alcohol (PVA) and ferric chloride (FeCl 3 ) in cellulose nanofiber (CNF) aqueous dispersion. A dual cross-linked network was established in hydrogel through the hydrogen bonds and coordination bonds among PVA, CNF, and FeCl 3 . This structure endows the as-prepared hydrogel with high sensitivity (pressure sensitivity coefficient (S) = 5.326 in the pressure range of 0-5 kPa), wide response range (4511 kPa), excellent durability (over 3000 cycles), short response time (83 ms) and recovery time (117 ms), which can accurately detect various human activities in real time. Furthermore, the triboelectric nano-generator (TENG) made from PVA@CNF-FeCl 3 hydrogel can not only supply power for commercial capacitors and LED lamps, but also be used as a self-powered sensor to detect human motion. This work provides a new approach for the development of the next generation of flexible wearable electronic devices., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Non-benzenoid polycyclic aromatic hydrocarbons (PAHs) have received considerable attention owing to their distinctive optical and electrical properties. Nevertheless, the synthesis and optoelectronic application of non-benzenoid PAHs remain challenging. Herein, we present a facile synthesis of linear non-benzenoid PAH with an armchair edge, diACh , by fusing chrysene with two azulene units. We systematically investigated the optical and electrical properties, which were also compared to its isomers, including benzenoid and non-benzenoid zigzag edge isomers. diACh exhibits global aromaticity, good planarity, and suitable highest occupied molecular orbital/lowest unoccupied molecular orbital energy levels. The protonation of diACh in solution successively forms a stable tropylium cation and dication. Moreover, the neutral, cationic, and dicationic states of diACh can be transformed with remarkable reversibility during the protonation-deprotonation process, as confirmed by ultraviolet-visible absorptions, fluorescence spectra, 1 H nuclear magnetic resonance, and theoretical calculations. Additionally, we fabricate p-type organic field-effect transistor (OFET) devices based on diACh with hole mobility up to 0.026 cm 2 V -1 s -1 , and we further develop OFET-based acid vapor sensors with good sensitivity, recyclability, and selectivity. These findings underscore the unique properties of linear non-benzenoid PAHs with an armchair edge engendered by the fusion of azulene with the acene backbone, showcasing prospective applications in organic optoelectronics.

The degenerative process of follicular atresia in hens naturally commences in granulosa cells, significantly impacting laying hens' reproductive performance. Past studies suggested that granulosa cell autophagy and apoptosis work together to cause follicular atresia. Recent research indicates that miRNA regulates granulosa autophagy and apoptosis, which contributes to the development of follicular atresia. However, the role of miR-302c-3p in follicular atresia and development remains unclear. In this study with the RNA-seq approach, we found that miR-302c-3p expression was significantly decreased in atrophic follicles, suggesting its involvement in the follicular atresia process. Following this, we performed in vitro studies to confirm that miR-302c-3p inhibits autophagy and apoptosis in chicken granulosa cells. Mechanistically, LATS2 is considered as the putative target gene of miR-302c-3p, and it has been demonstrated that LATS2 exerts a positive regulatory role in the modulation of autophagy and apoptosis in chicken granulosa cells. Furthermore, we verified the regulatory function of miR-302c-3p in chicken granulosa cells via the LATS2-YAP signaling pathway. Our results collectively demonstrates that miR-302c-3p targets LATS2 to modulate the YAP signaling pathway, impacting autophagy and apoptosis in granulosa cells leading to follicular atresia., Competing Interests: Declaration of competing interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartially of the research reported., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Against the traditional view, a recently published theory argued that isotope ratios are higher in convective precipitation but lower in stratiform precipitation and proposed that isotope ratios reflect rain type proportions. This theory has been widely cited despite some early reservations. Whether the theory represents a faithful reflection of signals of water isotope ratios remains unclear. Here, we reassess its validity from different timescales and broader observations from the pantropics. Unexpectedly, our findings contradict the theory on daily, monthly, and even annual timescales. Pantropical precipitation isotope ratios remain strongly correlated to convection intensity but are independent of rain type proportions because stratiform precipitation isotope ratios cover a large range of values. We find that the theory has many serious weaknesses related to preferential data selection and suggest that new theories need to be validated at more locations on different timescales before gaining widespread acceptance.

Background: Gastric cancer (GC) is one of the most common malignant tumors in the world, and its prognosis is closely related to many factors. In recent years, the incidence of vascular thrombosis in patients with GC has gradually attracted increasing attention, and studies have shown that it may have a significant impact on the survival rate and prognosis of patients. However, the specific mechanism underlying the association between vascular thrombosis and the prognosis of patients with GC remains unclear., Aim: To analyze the relationships between vascular cancer support and other clinicopathological factors and their influence on the prognosis of patients with GC., Methods: This study retrospectively analyzed the clinicopathological data of 621 patients with GC and divided them into a positive group and a negative group according to the presence or absence of a vascular thrombus. The difference in the 5-year cumulative survival rate between the two groups was compared, and the relationships between vascular cancer thrombus and other clinicopathological factors and their influence on the prognosis of patients with GC were analyzed., Results: Among 621 patients with GC, the incidence of vascular thrombi was 31.7% (197 patients). Binary logistic regression analysis revealed that the degree of tumor differentiation, depth of invasion, and extent of lymph node metastasis were independent influencing factors for the occurrence of vascular thrombi in GC patients ( P < 0.01). The trend of the χ 2 test showed that the degree of differentiation, depth of invasion, and extent of lymph node metastasis were linearly correlated with the percentage of vascular thrombi in GC patients ( P < 0.01), and the correlation between lymph node metastasis and vascular thrombi was more significant ( r = 0.387). Univariate analysis revealed that the 5-year cumulative survival rate of the positive group was significantly lower than that of the negative group (46.7% vs 73.3%, P < 0.01). Multivariate analysis revealed that age, tumor diameter, TNM stage, and vascular thrombus were independent risk factors for the prognosis of GC patients (all P < 0.05). Further stratified analysis revealed that the 5-year cumulative survival rate of stage III GC patients in the thrombolase-positive group was significantly lower than that in the thrombolase-negative group (36.1% vs 51.4%; P < 0.05)., Conclusion: Vascular cancer status is an independent risk factor affecting the prognosis of patients with GC. The combination of vascular cancer suppositories and TNM staging can better judge the prognosis of patients with GC and guide more reasonable treatment., Competing Interests: Conflict-of-interest statement: The authors declare no conflicts of interest., (©The Author(s) 2024. Published by Baishideng Publishing Group Inc. All rights reserved.)

Transition-metal phosphates/phosphides showcase significant promise for energy-related applications because of their high theoretical electrochemical characteristics. However, sluggish electro/ion transfer rates and kinetically unfavorable reaction sites hinder their application at high mass loading. Herein, a self-supporting electrode based on transition-metal phosphates was successfully fabricated via a one-step electrodeposition process. The nanosheet structure of transition-metal phosphates, formed by interconnecting nanoparticles, effectively mitigates the impact of stress and achieves a high mass-loading (21 mg cm -2 ) of the electrode. Additionally, the oxygen vacancy-rich and porous nanostructure of transition-metal phosphates endows the as-prepared electrodes with a significantly increased conductivity and fast ion migration rate for enhancing electrochemical kinetics. Consequently, the as-fabricated transition-metal phosphate electrode displays the highest areal specific capacity of 39.2F cm -2 . Furthermore, the asymmetric supercapacitor achieves a maximum energy density of 0.79 mWh cm -2 and a high capacity retention of 93.0 % for 10000 cycles under 60 mA cm -2 . This work provides an ideal strategy for fabricating flexible electrodes with high mass loading and synthesizing transition-metal phosphate electrodes rich in oxygen vacancies., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Scanning tunneling microscopy (STM) serves as a critical tool for high-resolution surface imaging, yet deciphering the atomic structures from STM images on multielement surfaces, such as oxides and carbides, remains a challenging task that heavily relies on the expertise and intuition of researchers. In this study, we introduce a data-driven method for rapid structural recognition from STM images. This method involves extracting structural features, filtering through a structural database, and matching with simulated STM images and surface energy analyses, thereby providing researchers with several of the most probable structures. We demonstrate the capabilities of this technique using our previously reported iron carbide grown on an Fe(110) crystal. By proposing a candidate structure set and establishing a comprehensive database linking STM images to corresponding structures and surface energies, we selected 6 out of more than 10 000 possible surfaces. On the basis of these 6 recommendations, researchers can conveniently determine the real surface structures. Our work provides an efficient tool for the structure recognition of STM images to construct surface structures, potentially serving as a universal auxiliary tool for STM structural analysis.

Objective: To investigate the effect of increased cardiac output induced by dobutamine on cerebral blood flow (CBF) in healthy volunteers using magnetic resonance 3D-pseudo-continuous arterial spin labeling technology. Methods: A prospective study was conducted on 48 healthy volunteers recruited by handy sampling from June 2021 to January 2022. Physiological parameters before (at rest state) and after (under stress state) dobutamine-induced increase in cardiac output were analyzed. Quantitative CBF maps were generated by using arterial spin labeling difference imaging and proton density weighted reference image processing, and CBF changes under the rest and stress states were compared. Multivariable logistic regression model was used to analyze factors associated with reduced CBF. Results: A total of 48 subjects were included, with an age [ M ( Q 1 , Q 3 )] of 25.0 (24.0, 28.0) years, including 43 men and 5 women. Compared with the rest state, the CBF in the anterior cerebral artery [(36.2±6.9) vs (34.5±6.5) ml·(100 g) -1 ·min -1 , P =0.006] and the middle cerebral artery perfusion area [(35.8±6.5) vs (34.1±6.4) ml·(100 g) -1 ·min -1 , P =0.006] decreased under the stress state, however there was no statistically significant change in CBF in the posterior cerebral artery and the vertebral-basilar artery perfusion area (all P >0.05). Logistic regression analysis showed that the decrease in CBF in the anterior cerebral artery and middle cerebral artery supply regions during the stress state were correlated with an increase in diastolic blood pressure [ OR (95% CI ): 0.887 (0.796-0.989) and 0.895 (0.805-0.994), both P <0.05]. Conclusions: Dobutamine-induced increase in cardiac output leads to a decrease in CBF in anterior cerebral circulation but has no effect on posterior circulation. The increase in diastolic blood pressure is associated with decreased CBF under the stress state. Changes in CBF should be considered in the context of increased cardiac output.

As major terrestrial carbon sinks, forests play an important role in mitigating climate change. The relationship between the seasonal uptake of carbon and its allocation to woody biomass remains poorly understood, leaving a significant gap in our capacity to predict carbon sequestration by forests. Here, we compare the intra-annual dynamics of carbon fluxes and wood formation across the Northern hemisphere, from carbon assimilation and the formation of non-structural carbon compounds to their incorporation in woody tissues. We show temporally coupled seasonal peaks of carbon assimilation (GPP) and wood cell differentiation, while the two processes are substantially decoupled during off-peak periods. Peaks of cambial activity occur substantially earlier compared to GPP, suggesting the buffer role of non-structural carbohydrates between the processes of carbon assimilation and allocation to wood. Our findings suggest that high-resolution seasonal data of ecosystem carbon fluxes, wood formation and the associated physiological processes may reduce uncertainties in carbon source-sink relationships at different spatial scales, from stand to ecosystem levels., (© 2024. The Author(s).)

Backgrounds: Currently, family with sequence similarity 65 member A (FAM65A) is reported as a pivotal regulator in various cancers. However, the effect of FAM65A in lung squamous cell carcinoma (LSCC) is still unclear, the prime objective of this research is to explore the role of FAM65A in LSCC., Methods: Gene expression data and correlated clinical information were downloaded from the public database and the expression of FAM65A was detected. The expression of FAM65A was also detected in our collected clinical samples and LSCC cell lines. Survival package of R language was used to determine the survival significance of FAM65A. Proteins expression level was determined via western blot assay. Cell function experiments and in vivo experiments were performed to explore the effect of FAM65A on LSCC cell biological behaviors., Results: FAM65A expression was significantly increased in LSCC clinical samples and cell lines. High FAM65A expression predicted poor prognosis in LSCC patients. After silencing FAM65A, the ability of LSCC cell proliferation, invasion and migration was decreased, and LSCC cell cycle was blocked. Moreover, in vivo experiments revealed that silencing FAM65A could inhibit LSCC cell proliferation., Conclusions: High FAM65A expression could enhance proliferative, invasive and migratory abilities of LSCC. FAM65A might be a novel biomarker of LSCC., (© 2024. The Author(s).)

Background and Purpose: GLP-1 receptor agonists are clinically utilized for type 2 diabetes and obesity. In vitro and in vivo preclinical studies were performed to assess the druggability of a novel small molecule GLP-1 receptor biased agonist SAL0112., Experimental Approach: The HTRF assay, FLIPR assay, TR-FRET assay, and PathHunter assay were utilized for in vitro studies. Liver transporter tests were conducted using the HEK293-OATP1B1 and HEK293-OATP1B3 cell lines. In vitro stability assessments of various species and in vivo PK studies in rodents were performed. A model of type 2 diabetes and obesity induced by a high-energy diet in transgenic C57BL/6 mice expressing the human GLP-1 receptor gene was conducted., Principal Results: SAL0112 demonstrated high potency and selectivity in activating the Gαs pathway of the GLP-1 receptor, with no observed desensitization. SAL0112 demonstrated greater stability in human and rat liver microsomes compared to Danuglipron. In vivo PK studies revealed higher absorption of SAL0112 in rats. SAL0112 displayed a significantly lower potential for DDI on liver transporters compared to Danuglipron. SAL0112 led to significant reductions in body weight (P<0.001), blood glucose levels in OGTT (P<0.001), HbA 1c (P<0.05) and improved insulin resistance (P<0.01). Notably, it increased peripheral adipocyte density and resolved hepatic steatosis. The efficacy of SAL0112 was found to be comparable to that of Danuglipron and Liraglutide., Conclusion: SAL0112 demonstrated potent and selective GLP-1 receptor biased agonism, effectively alleviating signs of type 2 diabetes in a mouse model. These promising findings pave the way for the advancement of SAL0112 into clinical trials., Competing Interests: Declaration of Competing Interest SAL0112 is a developing product of Salubris and Salubris is the patent owner. Part of authors are from Salubris., (Copyright © 2024 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Background: Combined hepatocellular-cholangiocarcinoma (cHCC-CCA), as a rare primary hepatic tumor, is challenging to accurately assess in terms of the clinical outcomes and prognostic risk factors in patients. This study aimed to clarify the function of tertiary lymphoid structure (TLS) status in predicting the outcome of cHCC-CCA and to preliminarily explore the possible mechanism of TLS formation., Methods: The TLSs, with different spatial distributions and densities, of 137 cHCC-CCA were quantified, and their association with prognosis was assessed by Cox regression and Kaplan-Meier analyses. We further validated TLS possible efficacy in predicting immunotherapy responsiveness in two cHCC-CCA case reports. TLS composition and its relationship to CXCL12 expression were analysed by fluorescent multiplex immunohistochemistry., Results: A high intratumoural TLS score was correlated with prolonged survival, whereas a high TLS density in adjacent tissue indicated a worse prognosis in cHCC-CCA. Mature TLSs were related to favorable outcomes and showed more CD8 + T cells infiltrating tumor tissues. We further divided the cHCC-CCA patients into four immune grades by combining the peri-TLS and intra-TLS, and these grades were an independent prognostic factor. In addition, our reported cases suggested a potential value of TLS in predicting immunotherapy response in cHCC-CCA patients. Our findings suggested that CXCL12 expression in cHCC-CCA tissue was significantly correlated with TLS presence., Conclusion: The spatial distribution and density of TLSs revealing the characteristics of the cHCC-CCA immune microenvironment, significantly correlated with prognosis and provided a potential immunotherapy response biomarker for cHCC-CCA., (© 2024. The Author(s).)

Objective: Methyl CpG-binding protein 2 (MECP2) duplication syndrome is a rare X-linked genomic disorder affecting predominantly males, which is usually manifested as epilepsy and autism spectrum disorder (ASD) comorbidity. The transgenic line MeCP2 Tg1 was used for mimicking MECP2 duplication syndrome and showed autism-epilepsy co-occurrence. Previous works suggested that the excitatory/inhibitory (E/I) imbalance is a potential common mechanism for both epilepsy and ASD. The projection neurons and parvalbumin (PV) interneurons account for the majority of E/I balance in the hippocampus. Therefore, we explored how structural changes of projection and PV + neurons occur in the hippocampus of MeCP2 Tg1 mice and whether these morphological changes contribute to epilepsy susceptibility., Methods: We used the interneuron Designer receptors exclusively activated by designer drugs mouse model to inhibit inhibitory neurons in the hippocampus to verify the epilepsy susceptibility of MeCP2 Tg1 (FVB, an inbred strain named as sensitivity to Friend leukemia virus) mice. Electroencephalograms were recorded for the definition of seizure. We performed retro-orbital injection of virus in MeCP2 Tg1 (FVB):CaMKIIα-Cre (C57BL/6) mice or MeCP2 Tg1 :PV-Cre (C57BL/6) mice and their littermate controls to specifically label projection and PV + neurons for structural analysis., Results: Epilepsy susceptibility was increased in MeCP2 Tg1 mice. There was a reduced number of PV neurons and reduced dendritic complexity in the hippocampus of MeCP2 Tg1 mice. The dendritic complexity in MeCP2 Tg1 mice was increased compared to wild-type mice, and total dendritic spine density in dentate gyrus of MeCP2 Tg1 mice was also increased. Total dendritic spine density was increased in CA1 of MeCP2 Tg1 mice., Significance: Overexpression of MeCP2 may disrupt crucial signaling pathways, resulting in decreased dendritic complexity of PV interneurons and increased dendritic spine density of projection neurons. This reciprocal modulation of excitatory and inhibitory neuronal structures associated with MeCP2 implies its significance as a potential target in the development of epilepsy and offers a novel perspective on the co-occurrence of autism and epilepsy., (© 2024 International League Against Epilepsy.)

Major depressive disorder (MDD) is a global health burden characterized by persistent low mood, deprivation of pleasure, recurrent thoughts of death, and physical and cognitive deficits. The current understanding of the pathophysiology of MDD is lacking, resulting in few rapid and effective antidepressant therapies. Recent studies have pointed to the sigma-1 (σ-1) receptor as a potential rapid antidepressant target; σ-1 agonists have shown promise in a variety of preclinical depression models. Hypidone hydrochloride (YL-0919), an independently developed antidepressant by our institute with faster onset of action and low rate of side effects, has recently emerged as a highly selective σ-1 receptor agonist; however, its underlying astrocyte-specific mechanism is unknown. In this study, we investigated the effect of YL-0919 treatment on gene expression in the prefrontal cortex of depressive-like mice by single-cell RNA sequencing. Furthermore, we knocked down σ-1 receptors on astrocytes in the medial prefrontal cortex of mice to explore the effects of YL-0919 on depressive-like behavior and neuroinflammation in mice. Our results demonstrated that astrocyte-specific knockdown of σ-1 receptor resulted in depressive-like behavior in mice, which was reversed by YL-0919 administration. In addition, astrocytic σ-1 receptor deficiency led to activation of the NF-κB inflammatory pathway, and crosstalk between reactive astrocytes and activated microglia amplified neuroinflammation, exacerbating stress-induced neuronal apoptosis. Furthermore, the depressive-like behavior induced by astrocyte-specific knockdown of the σ-1 receptor was improved by a selective NF-κB inhibitor, JSH-23, in mice. Our study not only reaffirms the σ-1 receptor as a key target of the faster antidepressant effect of YL-0919, but also contributes to the development of astrocytic σ-1 receptor-based novel drugs., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Cardiovascular disease (CVD) is a group of diseases, affecting the human heart and accounting for 30% of deaths worldwide. Major CVDs include heart failure, hypertension, stroke, etc. Various therapeutics are available against CVD, still there is a dire need to find out potential protein drug targets to reduce economic burden and mortality rate. Goal of the current study was to utilize sequential computational techniques to find the best cardiovascular drug targets and their inhibitors. Common human cardiovascular targets of both databases (GeneCards and Uniprot) were subjected to bioinformatics analyses. Purpose was to validate putative therapeutic targets employing the structure-based bioinformatics methods to determine their physiochemical properties and biological processes. Three stable proteins, that have 0 transmembrane helices, and possess biological processes were screened as potential protein-based therapeutic targets: Hemoglobin subunit beta (HBB), Gamma-enolase (ENO2), and Cholesteryl ester transfer protein (CETP). Tertiary structures of target proteins were retrieved from PDB, and molecular docking technique was utilized to evaluate a library of 5000 phytochemicals against the interacting residues of the target protein as well as their respective standard drugs through MOE and Pyrx software. Top five phytochemicals (d-Sesamin, 1,3-benzodioxole, Sativanone, Thiamine, and Cajanol) were identified based on their RMSD and docking scores as compared to their standard drugs. The docking studies were also validated by MM-GBSA binding free energy and molecular dynamics simulations. According to the study's findings, these phytochemicals may eventually be used as drugs to treat CVD. Further in vitro testing is required to confirm their efficacy and drug potency.Communicated by Ramaswamy H. Sarma.

Objectives: The gut-liver axis disruption is a unified pathogenetic principle of cholestatic liver disease (CSLD). Increased gut permeability is the leading cause of gut-liver axis disruption. HO-1 is capable of protecting against gut-liver axis injury. However, it has rarely been reported whether autophagy is involved in HO-1 protecting gut-liver barrier integrity and the underlying mechanism., Materials and Methods: Mice underwent bile duct ligation (BDL) was established as CSLD model in vivo. Caco-2 cells with LPS treatment was established as in vitro cell model. Immunofluorescence, western blot and transepithelial electrical resistance (TER) assay were used to observe epithelial tight junction (TJ) and autophagy. Liver injury and fibrosis were evaluated as well through H&E staining, masson staining, sirius red staining and ELISA., Results and Conclusions: Our study demonstrated that the epithelial TJ and TER were notably reduced both in BDL mice and in LPS treated intestinal epithelial cells. Increased HO-1 expression could significantly induce intestinal epithelial cell autophagy. Additionally, this increased autophagy level reversed the reduction effects of BDL or LPS on epithelial TJ and TER in vivo and in vitro , therefore decreased transaminase level in serum and relieved liver fibrosis in BDL mice. Besides, increased autophagy level in turn upregulated the expression of HO-1 by p62 degradation of Keap1 and subsequent activation of Nrf2 pathway. Collectively, these results indicate that HO-1 reduces gut permeability by enhancing autophagy level in CSLD, the increased autophagy establishes a HO-1-p62-Nrf2 positive feedback loop to further improve gut-liver axis disruption. Therefore, our study confirms the critical role of autophagy in HO-1 ameliorating gut-liver axis injury during CSLD, highlighting HO-1 as a promising therapeutic target.

Carbon dioxide radical anion (CO 2 •- ) recently becomes appreciated in halogenated contaminants elimination; nevertheless, its application has been restricted by insufficient mechanistic understanding. Herein, we provided a quantitative insight into the kinetics and mechanisms of CO 2 •- mediated dehalogenation of halogenated alkanes. A CO 2 •- dominated UV 254 /H 2 O 2 /HCOO - system has been successfully established and demonstrated for effective elimination of 7 kinds of halogenated alkanes (71.3 % to 100 % of removal). Using a laser flash photolysis technology, the second-order rate constants of CO 2 •- ( [Formula: see text] ) reacting with CCl 4 , CHCl 3 and CH 2 Cl 2 were firstly reported, to be 2.5 × 10 8 , 6.2 × 10 7 and 5.8 × 10 6 M -1 s -1 , respectively. [Formula: see text] presented a significant negative correlation with the lowest unoccupied molecular orbital energy (E LUMO ) of chlorinated alkanes, proving that the enhanced dehalogenation of CO 2 •- was attributed by direct electron transfer mechanism. A fitting model was developed accordingly for [Formula: see text] prediction. This study also demonstrated that the CO 2 •- mediated ARP effectively removed halogenated alkanes regardless of pH condition (6.0∼9.0) and bicarbonate concentrations. These findings are significant in advancing the scientific understanding of CO 2 •- mediated ARP. This reductive process a promising control strategy for halogenated contaminants, such as polyfluoroalkyl substances (PFAS) and halogenated pharmaceuticals., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Zhang xinran reports financial support was provided by Sun Yat-Sen University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

The development of a multifunctional wound dressing that can adapt to the shape of wounds and provide controlled drug release is crucial for diabetic patients. This study developed a carboxymethyl chitosan-based hydrogel dressing with enhanced mechanical properties and tissue adherence that were achieved by incorporating pectin (PE) and polydopamine (PDA) and loading the hydrogel with recombinant human epidermal growth factor (rhEGF). This EGF@PDA-CMCS-PE hydrogel demonstrated robust tissue adhesion, enhanced mechanical properties, and superior water retention and vapor permeability. It also exhibited significant antioxidant capacity. The results showed that EGF@PDA-CMCS-PE could effectively scavenge 2,2'-Azinobis-(3-ethylbenzthiazoline-6-sulphonate)， (1,1-diphenyl-2-picrylhydrazyl), and superoxide anions and increase superoxide dismutase and catalase levels in vivo. In vitro cytotoxicity and antibacterial assays showed good biocompatibility and antimicrobial properties. The sustained release of EGF by the hydrogel was confirmed, with a gradual release profile over 120 h. In vivo studies in diabetic mice showed that the hydrogel significantly accelerated wound healing, with a wound contraction rate of 97.84% by day 14. Histopathological analysis revealed that the hydrogel promoted fibroblast proliferation, neovascularization, and orderly connective tissue formation, leading to a more uniform and compact wound-healing process. Thus, EGF@PDA-CMCS-PE hydrogel presents a promising tool for managing chronic diabetic wounds, offering a valuable strategy for future clinical applications., Competing Interests: Declaration of competing interest The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Vitamin D is a critical fat-soluble vitamin for the nervous system. Research suggests a potential link between vitamin D deficiency and attention-deficit hyperactivity disorder (ADHD), particularly in children and adolescents. The core symptoms of ADHD are associated with deficits in striatal functions, and maintaining sufficient levels of vitamin D may help prevent or alleviate ADHD symptoms. However, the molecular changes in the striatum caused by vitamin D supplementation that may contribute to the brain processes linked to ADHD symptoms remain unclear. In this study, we established a mouse model fed diets with three different dose gradients of vitamin D3 (0, 500, and 2000 IU/kg·day) from postnatal day 21 (P21) to 14 weeks of age. Striatal tissues from mice with gradient vitamin D3 intake were subjected to reduced representation bisulfite sequencing (RRBS), RNA-sequencing, and neurotransmitter profiling by liquid chromatography-mass spectrometry (LC-MS). Our findings indicate that vitamin D supplementation since childhood influenced the overall landscape of DNA methylations and the expression of many genes involved in critical neurological functions in a dose-dependent manner. Additionally, our data demonstrate how vitamin D modulated neuropeptide signaling pathways, as well as cholinergic and dopaminergic synapses in the striatum, through an orchestrated mechanism involving epigenetic and transcriptional regulations. Furthermore, we observed a synergistic effect of vitamin D on dopamine release following acute methylphenidate injection into our mouse model. In summary, this study provides mechanistic insights into how dietary vitamin D supplementation since childhood can modulate specific signal transductions among striatal cells, underscoring the importance of vitamin D supplementation for ADHD management., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

The surging popularity of virtual reality (VR) technology raises concerns about VR-induced motion sickness, linked to discomfort and nausea in simulated environments. Our method involves in-depth analysis of EEG data and user feedback to train a sophisticated deep learning model, utilizing an enhanced GRU network for identifying motion sickness patterns. Following comprehensive data pre-processing and feature engineering to ensure input accuracy, a deep learning model is trained using supervised and unsupervised techniques for classifying and predicting motion sickness severity. Rigorous training and validation procedures confirm the model's robustness across diverse scenarios. Research results affirm our deep learning model's 84.9% accuracy in classifying and predicting VR-induced motion sickness, surpassing existing models. This information is vital for improving the VR experience and advancing VR technology., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Luo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Gastric cancer(GC)is one of the most common gastrointestinal malignant tumors in the world, requiring the development of novel therapeutic agents with reduced toxicity. Rehmannia polysaccharide (RPS) possesses immunomodulatory and anti-tumor properties, yet its efficacy is suboptimal. To enhance its biological activity, we subjected RPS to molecular modifications, resulting in phosphorylated Rehmannia polysaccharides (P-RPS). Using the mixed phosphate method, we synthesized P-RPS and optimized the synthesis conditions through a combination of single-factor and response surface methodologies. In vitro studies on P-RPS's anti-tumor activity showed no direct influence on the viability of GC cells. However, P-RPS induced the transformation of PMA-activated THP-1 cells into the M1 phenotype. We collected conditioned medium (CM) of THP-1 cells to stimulate gastric cancer cells and CM-P-RPS significantly promoted apoptosis of gastric cancer cells and inhibited cell proliferation, and reduced cell migration. Mechanistically, CM-P-RPS inhibits the Wnt/β-catenin signaling pathway through LGR6, leading to the suppression of tumor growth. Furthermore, P-RPS demonstrated a significant inhibitory effect on tumor growth in vivo, suggesting its potential as a promising therapeutic agent for GC treatment., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Interfaces between different materials crucially determine the performance of multi-material systems, impacting a wide range of industries. Currently, precisely programming interfaces with distinct properties at different localized interface positions remains a challenge, leading to limited interface adaptability and unpredictable interface failures, thus hindering the development of next-generation materials and engineering systems with highly customizable multiphysical interface performances. Our research introduces programmable "metainterfaces" for the first time, featuring engineerable biometric architectonics that allows for mechanically, thermally, and actively programmed distribution of interfacial effects by its orientation, driven by artificial intelligence. Enabled by metainterfaces, we showcased improved mechanical properties of future composite metamaterials by programming interface resistance customized to the decoupling modes of distinct lattice topologies. Additionally, we demonstrate enhanced and programmable impact mechanics in fish scale assemblies equipped with pre-programmed metainterface sheets. The proposed metainterface also allows for coolant flow programming in thermal management systems, opening new avenues for development of highly customizable thermos-mechanical systems. Additionally, we introduce digitally controlled "metadisks" enabled by metainterfaces as novel solutions for actively programmable interface systems in robotics, offering real-time adaptive and intelligent interfacial mechanics. This research sets the foundation for next-generation multi-material systems with precisely programmed interfacial effects, offering broad applicability in areas such as smart materials, advanced thermal management, and intelligent robotics.

The Panbio COVID-19/Flu A&B Panel (Abbott) is an in vitro diagnostic rapid test designed for the qualitative detection of nucleocapsid proteins SARS-CoV-2 and nucleoprotein influenza A and B antigens in nasal mid-turbinate (NMT) swab specimens from symptomatic individuals meeting COVID-19 and influenza clinical and/or epidemiological criteria. This study, the largest global one to date using fresh samples, aimed to assess the diagnostic sensitivity and specificity of the Panbio COVID-19/Flu A&B Panel in freshly collected NMT swab specimens from individuals suspected of respiratory viral infection consistent with COVID-19 and/or influenza within the first 5 days of symptom onset compared with results obtained with the cobas SARS-CoV-2 and influenza A/B qualitative assay (cobas 6800/8800 systems), which were tested using nasopharyngeal swab samples. A total of 512 evaluable subjects were enrolled in the COVID-19 cohort across 18 sites, and 1,148 evaluable subjects were enrolled in the influenza cohort across 22 sites in the Asia-Pacific, Europe, and the USA. The Panbio COVID-19/Flu A&B Panel demonstrated a sensitivity of 80.4% and a specificity of 99.7% for COVID-19. For influenza A, the sensitivity and specificity rates were 80.6% and 99.3%, respectively. Likewise, for influenza B, the sensitivity and specificity rates were 80.8% and 99.4%, respectively. In conclusion, the Panbio COVID-19/Flu A&B Panel emerges as a suitable rapid test for detecting COVID-19 and influenza in symptomatic subjects across diverse global populations, exhibiting high sensitivity. The assay achieved a sensitivity of 94.4% in samples with Ct ≤24 for COVID-19 and 92.6% in samples with Ct ≤30 for influenza A and B., Importance: The Panbio COVID-19/Flu A&B Panel is a suitable rapid test for detecting COVID-19 and influenza in symptomatic subjects across diverse global populations, exhibiting high sensitivity. The assay achieved a sensitivity of 94.0% in samples with Ct ≤24 for COVID-19 and 92.6% in samples with Ct ≤30 for influenza A and B., Competing Interests: The authors declare no conflict of interest.

Accurate calculation of non-covalent interaction energies in nucleotides is crucial for understanding the driving forces governing nucleic acid structure and function, as well as developing advanced molecular mechanics forcefields or machine learning potentials tailored to nucleic acids. Here, we dissect the nucleotides' structure into three main constituents: nucleobases (A, G, C, T, and U), sugar moieties (ribose and deoxyribose), and phosphate group. The interactions among these fragments and between fragments and water were analyzed. Different quantum mechanical methods were compared for their accuracy in capturing the interaction energy. The non-covalent interaction energy was decomposed into electrostatics, exchange-repulsion, dispersion, and induction using two ab initio methods: Symmetry-Adapted Perturbation Theory (SAPT) and Absolutely Localized Molecular Orbitals (ALMO). These calculations provide a benchmark for different QM methods, in addition to providing a valuable understanding of the roles of various intermolecular forces in hydrogen bonding and aromatic stacking. With SAPT, a higher theory level and/or larger basis set did not necessarily give more accuracy. It is hard to know which combination would be best for a given system. In contrast, ALMO EDA2 did not show dependence on theory level or basis set; additionally, it is faster.

F luorogenic ap tamers (FAPs) have become an increasingly important tool in cellular sensing and pathogen diagnostics. However, fine-tuning FAPs for enhanced performance remains challenging even with the structural details provided by X-ray crystallography. Here we present a novel approach to optimize a DNA-based FAP (D-FAP), Lettuce, on repurposed Illumina next-generation sequencing (NGS) chips. When substituting its cognate chromophore, DFHBI-1T, with TO1-biotin, Lettuce not only shows a red-shifted emission peak by 53 nm (from 505 to 558 nm), but also a 4-fold bulk fluorescence enhancement. After screening 8,821 Lettuce variants complexed with TO1-biotin, the C14T mutation is found to exhibit an improved apparent dissociated constant ( vs. 0.82 µM), an increased quantum yield (QY: 0.62 vs. 0.59) and an elongated fluorescence lifetime (τ: 6.00 vs. 5.77 ns), giving 45% more ensemble fluorescence than the canonical Lettuce/TO1-biotin complex. Molecular dynamic simulations further indicate that the π-π stacking interaction is key to determining the coordination structure of TO1-biotin in Lettuce. Our screening-and-simulation pipeline can effectively optimize FAPs without any prior structural knowledge of the canonical FAP/chromophore complexes, providing not only improved molecular probes for fluorescence sensing but also insights into aptamer-chromophore interactions.

Conjugated polymer dots (Pdots) have shown potential in the biomedical fields due to their optical properties and customizable design. However, the limited research on the biotoxicity of Pdots hinders their further application and translation. Lipophilic Pdots are prone to adsorbing specific proteins, leading to targeted tissue accumulation. Therefore, lipophilic fluorescent Pdots (Bare-Pdots) are synthesized using the conjugated polymer poly[2-methoxy-5-(2'-ethylhexyloxy)-1,4-phenylenevinylene] (MEH-PPV) to systematically evaluate their biodistribution and biotoxicity in stem cells, zebrafish embryos, and mice. It is observed that Bare-Pdots are readily internalized by cells and adhered to the embryonic chorion. Additionally, Bare-Pdots exhibit a distinct distribution in brown adipose tissue and heart, closely associated with phagocytosis of capillary endothelial cells involved in lipid metabolism. Notably, injection of Bare-Pdots at 5 mg kg -1  results in dysfunction of brown adipose tissue and an increased risk of obesity 90 days post-injection. Furthermore, hydrophilic COOH-Pdots and NH 2 -Pdots with reduced lipophilicity are synthesized using amphiphilic ligands. NH 2 -Pdots show similar distribution but lower biotoxicity compared to Bare-Pdots. Nevertheless, injection of COOH-Pdots at 5 mg kg -1 causes a decrease in white blood cells and renal tubular damage. These findings provide valuable insights for optimizing dosage to ensure the safe use of Pdots in preclinical applications., (© 2024 Wiley‐VCH GmbH.)

Force Field X (FFX) is an open-source software package for atomic resolution modeling of genetic variants and organic crystals that leverages advanced potential energy functions and experimental data. FFX currently consists of nine modular packages with novel algorithms that include global optimization via a many-body expansion, acid-base chemistry using polarizable constant-pH molecular dynamics, estimation of free energy differences, generalized Kirkwood implicit solvent models, and many more. Applications of FFX focus on the use and development of a crystal structure prediction pipeline, biomolecular structure refinement against experimental datasets, and estimation of the thermodynamic effects of genetic variants on both proteins and nucleic acids. The use of Parallel Java and OpenMM combines to offer shared memory, message passing, and graphics processing unit parallelization for high performance simulations. Overall, the FFX platform serves as a computational microscope to study systems ranging from organic crystals to solvated biomolecular systems., (© 2024 Author(s). All article content, except where otherwise noted, is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International (CC BY-NC-ND) license (https://creativecommons.org/licenses/by-nc-nd/4.0/).)

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Background: Poor sleep quality has become one of the most pressing public issues among Chinese college students, with an increasing incidence rate in recent years. Although some studies showed that anxiety is related to sleep quality, the relationship between time anxiety (which is a more concrete manifestation of anxiety in the temporal dimension) and sleep quality, as well as its potential mechanisms, still requires further investigation and analysis. This study aimed to explore the relationship between time anxiety and sleep quality among college students, and to examine the mediating role of irrational procrastination and the moderating effect of physical activity., Methodology: A cross-sectional study was conducted with 1,137 participants recruited from four universities in eastern, western, and central China. They completed a questionnaire survey on time anxiety, irrational procrastination, physical activity, and sleep quality. Data analysis was performed using SPSS 26.0 and PROCESS 3.3., Results: Time anxiety had a significant positive impact on sleep quality ( β  = 0.28, t  = 9.95, p  < 0.001). Irrational procrastination played a mediating role between time anxiety and college students' sleep quality, the effect value was 0.05, and the intermediary effect accounted for 19.26%. Physical activity moderated the direct effect of time anxiety on college students' sleep quality ( β  = -0.08, t  = -2.98, p < 0.01), and moderated the second half path of irrational procrastination mediation model ( β  = -0.06, t  = -2.12, p < 0.05)., Conclusion: Higher levels of time anxiety are associated with poorer sleep quality among college students. Time anxiety not only directly affects college students' sleep quality, but also indirectly affects it through irrational procrastination. Conducting physical activities can mitigate the impact of time anxiety and irrational procrastination on college students' sleep quality., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Sun, Gao and Ren.)

Emerging immunotherapies such as immune checkpoint blockade (ICB) and chimeric antigen receptor T-cell (CAR-T) therapy have revolutionized cancer treatment and have improved the survival of patients with multiple cancer types. Despite this success many patients are unresponsive to these treatments or relapse following treatment. CRISPR activation and knockout (KO) screens have been used to identify novel single gene targets that can enhance effector T cell function and promote immune cell targeting and eradication of tumors. However, cancer cells often employ multiple genes to promote an immunosuppressive pathway and thus modulating individual genes often has a limited effect. Paralogs are genes that originate from common ancestors and retain similar functions. They often have complex effects on a particular phenotype depending on factors like gene family similarity, each individual gene's expression and the physiological or pathological context. Some paralogs exhibit synthetic lethal interactions in cancer cell survival; however, a thorough investigation of paralog pairs that could enhance the efficacy of cancer immunotherapy is lacking. Here we introduce a sensitive computational approach that uses sgRNA sets enrichment analysis to identify cancer-intrinsic paralog pairs which have the potential to synergistically enhance T cell-mediated tumor destruction. We have further developed an ensemble learning model that uses an XGBoost classifier and incorporates features such as gene characteristics, sequence and structural similarities, protein-protein interaction (PPI) networks, and gene coevolution data to predict paralog pairs that are likely to enhance immunotherapy efficacy. We experimentally validated the functional significance of these predicted paralog pairs using double knockout (DKO) of identified paralog gene pairs as compared to single gene knockouts (SKOs). These data and analyses collectively provide a sensitive approach to identify previously undetected paralog pairs that can enhance cancer immunotherapy even when individual genes within the pair has a limited effect.

Gliomas are primary brain tumors and are among the most malignant types. Adult-type diffuse gliomas can be classified based on their histological and molecular signatures as IDH-wildtype glioblastoma, IDH-mutant astrocytoma, and IDH-mutant and 1p/19q-codeleted oligodendroglioma. Recent studies have shown that each subtype of glioma has its own specific distribution pattern. However, the mechanisms underlying the specific distributions of glioma subtypes are not entirely clear despite partial explanations such as cell origin. To investigate the impact of multi-scale brain attributes on glioma distribution, we constructed cumulative frequency maps for diffuse glioma subtypes based on T1w structural images and evaluated the spatial correlation between tumor frequency and diverse brain attributes, including postmortem gene expression, functional connectivity metrics, cerebral perfusion, glucose metabolism, and neurotransmitter signaling. Regression models were constructed to evaluate the contribution of these factors to the anatomic distribution of different glioma subtypes. Our findings revealed that the three different subtypes of gliomas had distinct distribution patterns, showing spatial preferences toward different brain environmental attributes. Glioblastomas were especially likely to occur in regions enriched with synapse-related pathways and diverse neurotransmitter receptors. Astrocytomas and oligodendrogliomas preferentially occurred in areas enriched with genes associated with neutrophil-mediated immune responses. The functional network characteristics and neurotransmitter distribution also contributed to oligodendroglioma distribution. Our results suggest that different brain transcriptomic, neurotransmitter, and connectomic attributes are the factors that determine the specific distributions of glioma subtypes. These findings highlight the importance of bridging diverse scales of biological organization when studying neurological dysfunction., (© 2024 UICC.)

Negative pressure wound therapy (NPWT) is extensively used in clinical settings to enhance the healing of wounds. Despite its widespread use, the molecular mechanisms driving the efficacy of NPWT have not been fully elucidated. In this study, skin wound-healing models were established, with administration of NPWT. Vimentin, collagen I, and MMP9 of skin tissues were detected by immunofluorescence (IF). Gene expression analysis of skin wound tissues was performed by RNA-sequencing (RNA-seq). Protein expression was assayed by a Western blotting or IF assay, and mRNA levels were quantified by quantitative PCR. Chromatin accessibility profiles of fibroblasts following NPWT or IL-17 exposure were analyzed by ATAC-seq. In rat wound-healing models, NPWT promoted wound repair by promoting reepithelialization, extracellular matrix (ECM) synthesis, and proliferation, which mainly occurred in the early stage of wound healing. These differentially expressed genes (DEGs) in NPWT wounds versus control wounds were enriched in the IL-17 signaling pathway. IL-17 was identified as an upregulated factor following NPWT in skin wounds. Moreover, the IL-17 inhibitor secukinumab (SEC) could abolish the promoting effect of NPWT on wound healing. Importantly, chromatin accessibility profiles were altered following NPWT and IL-17 stimulation in skin fibroblasts. Our findings suggest that NPWT upregulates IL-17 to promote wound healing by altering chromatin accessibility, which is a novel mechanism for NPWT's efficacy in wound healing. NEW & NOTEWORTHY To our knowledge, this is the first report of the efficacy of negative pressure wound therapy (NPWT) in promoting wound healing via IL-17. Moreover, NPWT and IL-17 can alter chromatin accessibility. Our study identifies a novel mechanism for NPWT's efficacy in wound healing.

Escherichia coli (E. coli), a Gram-negative bacterium, is the primary pathogen responsible for endometritis in dairy cattle. The outer membrane components of E. coli, namely lipopolysaccharide (LPS) and bacterial lipoprotein, have the capacity to trigger the host's innate immune response through pattern recognition receptors (PRRs). Tolerance to bacterial cell wall components, including LPS, may play a crucial role as an essential regulatory mechanism during bacterial infection. However, the precise role of Braun lipoprotein (BLP) tolerance in E. coli-induced endometritis in dairy cattle remains unclear. In this study, we aimed to investigate the impact of BLP on the regulation of E. coli infection-induced endometritis in dairy cattle. The presence of BLP was found to diminish the expression and release of proinflammatory cytokines (IL-8 and IL-6), while concurrently promoting the expression and release of the anti-inflammatory cytokine IL-10 in endometrial epithelial cells (EECs). Furthermore, BLP demonstrated the ability to impede the activation of MAPK (ERK and p38) and NF-κB (p65) signaling pathways, while simultaneously enhancing signaling through the STAT3 pathway in EECs. Notably, BLP exhibited a dual role, acting both as an activator of TLR2 and as a regulator of TLR2 activation in LPS- and E. coli-treated EECs. In E. coli-infected endometrial explants, the presence of BLP was noted to decrease the release of proinflammatory cytokines and the expression of HMGB1, while simultaneously enhancing the release of anti-inflammatory cytokines. Collectively, our findings provide evidence that the bacterial component BLP plays a protective role in E. coli-induced endometritis in dairy cattle., Competing Interests: Declaration of Competing interest The authors declare that they have no conflict of interest., (Copyright © 2024 Elsevier B.V. All rights reserved.)

This study bridges the knowledge gap pertaining to the pathways of heavy metal accumulation and migration within the industrial chain of large-scale cattle farms. Two such farms in Shaanxi serve as a basis for our exploration into Zn, Cu, Cr, Pb, As, and Cd dynamics. Employing material flow analysis complemented by predictive models, we evaluate the potential ecological risks of arable soil from heavy metal influx via manure application. Our findings indicate that Zn and Cu predominate the heavy metal export from these operations, composing up to 60.00%-95.67% of their total content. Predictive models based on 2021 data reveal a potential increase in Cd soil concentration by 0.08 mg/kg by 2035, insinuating a reduced safe usage period for cattle manure at less than 50 years. Conversely, projections from 2022 data point towards a gradual Cu rise in soil, reaching risk threshold levels after 126 years. These outcomes inform limitations in cattle manure utilisation strategies, underscoring Cu and Cd content as key barriers. The study underscores the criticality of continuous heavy metal surveillance within farm by products to ensure environmental protection and sustainable agricultural practices., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Ltd.)

Single-atom catalysts (SACs) have made great progress in recent years as potential catalysts for energy conversion and storage due to their unique properties, including maximum metal atoms utilization, high-quality activity, unique defined active sites, and sustained stability. Such advantages of single-atom catalysts significantly broaden their applications in various energy-conversion reactions. Given the extensive utilization of single-atom catalysts, methods and specific examples for improving the performance of single-atom catalysts in different reaction systems based on the Sabatier principle are highlighted and reactant binding energy volcano relationship curves are derived in non-homogeneous catalytic systems. The challenges and opportunities for single-atom catalysts in different reaction systems to improve their performance are also focused upon, including metal selection, coordination environments, and interaction with carriers. Finally, it is expected that this work may provide guidance for the design of high-performance single-atom catalysts in different reaction systems and thereby accelerate the rapid development of the targeted reaction., (© 2024 Wiley‐VCH GmbH.)

Background: Perioperative neurocognitive disorders (PND) are common complications after surgery in older patients. However, the specific mechanism of this condition remains unclear. Glial cell line-derived neurotrophic factor (GDNF) is an important neurotrophin that abundantly expressed throughout the brain. It can enhance synaptic plasticity and alleviate learning and memory impairments. Thus, the purpose of this study was to investigate the role of GDNF in PND and the mechanisms involved., Methods: The PND animal model was established by performing left tibial fracture surgery on 18-month-old C57BL/6 mice under sevoflurane anesthesia. Recombinant adeno-associated virus (rAAV)-GDNF or empty vectors were injected bilaterally into the hippocampal CA1 region of aged mice 3 weeks before anesthesia/surgery. The open field and fear conditioning test were used to assess the behavior changes. Golgi staining and electrophysiology were utilized to evaluate the morphological and functional alterations of neuronal synaptic plasticity. Western blot analysis was carried out to measure the proteins expression levels and immunofluorescence staining was performed to probe the cellular localization of GDNF., Results: Mice with surgery and anesthesia showed a significant decrease in hippocampus-dependent learning and memory, accompanied by a decline in hippocampal synaptic plasticity. Anesthesia/surgery induced a reduction of GDNF, which was colocalized with astrocytes. Overexpression of GDNF in astrocytes could ameliorate the decline in cognitive function by improving hippocampal synaptic plasticity, meanwhile astrocytic GDNF rescued the anesthesia/surgery-induced decrease in GFRα1 and NCAM., Conclusion: The study concludes that astrocytic GDNF may improve anesthesia/surgery-induced cognitive impairment by promoting hippocampal synaptic plasticity in aged mice via the GFRα1/NCAM pathway., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Sepsis represents a syndromic response to infection and frequently acts as a common pathway leading to fatality in the context of various infectious diseases globally. The pathology of severe sepsis is marked by an excess of inflammation and activated coagulation. A substantial contributor to mortality in sepsis patients is widespread microvascular thrombosis-induced organ dysfunction. Multiple lines of evidence support the notion that sepsis induces endothelial damage, leading to the release of glycosaminoglycans, potentially causing microvascular dysfunction. This review aims to initially elucidate the relationship among endothelial damage, excessive inflammation, and thrombosis in sepsis. Following this, we present a summary of the involvement of glycosaminoglycans in coagulation, elucidating interactions among glycosaminoglycans, platelets, and inflammatory cells. In this section, we also introduce a reasoned generalization of potential signal pathways wherein glycosaminoglycans play a role in clotting. Finally, we discuss current methods for detecting microvascular conditions in sepsis patients from the perspective of glycosaminoglycans. In conclusion, it is imperative to pay closer attention to the role of glycosaminoglycans in the mechanism of microvascular thrombosis in sepsis. Dynamically assessing glycosaminoglycan levels in patients may aid in predicting microvascular conditions, enabling the monitoring of disease progression, adjustment of clinical treatment schemes, and mitigation of both acute and long-term adverse outcomes associated with sepsis., Competing Interests: None declared., (The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution-NonDerivative-NonCommercial License, permitting copying and reproduction so long as the original work is given appropriate credit. Contents may not be used for commercial purposes, or adapted, remixed, transformed or built upon. (https://creativecommons.org/licenses/by-nc-nd/4.0/).)

Heavy metal ions and antibiotics were simultaneously detected in authentic water systems. This research, for the first time, employed synthesized sophorolipid-modified fly ash(SFA) to eliminate tetracycline(TC) and lead(Pb 2+ ) from wastewater. Various characterization techniques, including SEM-EDS, FTIR, XPS, BET, and Zeta, were employed to investigate the properties of the SFA. The results showed that the sophorolipid modification significantly improved the fly ash's adsorption capacities for the target pollutants. The static adsorption experiments elucidated the adsorption behaviors of SFA towards TC and Pb 2+ in single and binary systems, highlighting the effects of different Environmental factors on the adsorption behavior in both types of systems. In single systems, SFA exhibited a maximum adsorption capacity of 128.96 mg/g for Pb 2+ and 55.57 mg/g for TC. The adsorption of Pb 2+ and TC followed pseudo-second-order kinetics and Freundlich isotherm models. The adsorption reactions are endothermic and occur spontaneously. SFA demonstrates varying adsorption mechanisms for two different types of pollutants. In the case of Pb 2+ , the primary mechanisms include ion exchange, electrostatic interaction, cation-π interaction, and complexation, while TC primarily engages in hydrogen bonding, π-π interaction, and complexation. The interaction between Pb 2+ and TC has been shown to improve adsorption efficiency at low concentrations. Additionally, adsorption-desorption experiments confirm the reliable cycling performance of modified fly ash, highlighting its potential as a cost-effective and efficient adsorbent for antibiotics and heavy metals., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Biofilms are common living states for microorganisms, allowing them to adapt to environmental changes. Numerous Bacillus strains can form complex biofilms that play crucial roles in biocontrol processes. However, our current understanding of the molecular mechanisms of biofilm formation in Bacillus is mainly based on studies of Bacillus subtilis. Knowledge regarding the biofilm formation of other Bacillus species remains limited. In this study, we identified a novel transcriptional regulator, BmfR, belonging to the GntR family, that regulates biofilm formation in marine-derived Bacillus methylotrophicus B-9987. We demonstrated that BmfR induces biofilm formation by activating the extracellular polysaccharide structural genes epsA-O and negatively regulating the matrix gene repressor, SinR; of note it positively affects the expression of the master regulator of sporulation, Spo0A. Furthermore, database mining for BmfR homologs has revealed their widespread distribution among many bacterial species, mainly Firmicutes and Proteobacteria. This study advances our understanding of the biofilm regulatory network of Bacillus strains, and provides a new target for exploiting and manipulating biofilm formation., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier GmbH.)

Time always leaves its mark, and our genome is no exception. Mutations in the genome of somatic cells were first hypothesized to be the cause of aging in the 1950s, shortly after the molecular structure of DNA had been described. Somatic mutation theories of aging are based on the fact that mutations in DNA as the ultimate template for all cellular functions are irreversible. However, it took until the 1990s to develop the methods to test if DNA mutations accumulate with age in different organs and tissues and estimate the severity of the problem. By now, numerous studies have documented the accumulation of somatic mutations with age in normal cells and tissues of mice, humans, and other animals, showing clock-like mutational signatures that provide information on the underlying causes of the mutations. In this review, we will first briefly discuss the recent advances in next-generation sequencing that now allow quantitative analysis of somatic mutations. Second, we will provide evidence that the mutation rate differs between cell types, with a focus on differences between germline and somatic mutation rate. Third, we will discuss somatic mutational signatures as measures of aging, environmental exposure, and activities of DNA repair processes. Fourth, we will explain the concept of clonally amplified somatic mutations, with a focus on clonal hematopoiesis. Fifth, we will briefly discuss somatic mutations in the transcriptome and in our other genome, i.e., the genome of mitochondria. We will end with a brief discussion of a possible causal contribution of somatic mutations to the aging process., (© 2024. The Author(s), under exclusive licence to American Aging Association.)

Hand, foot and mouth disease (HFMD), mainly caused by enterovirus 71 (EV71), has frequently occurred in the Asia-Pacific region, posing a significant threat to the health of infants and young children. Therefore, research on the infection mechanism and pathogenicity of enteroviruses is increasingly becoming important. The 3D polymerase, as the most critical RNA-dependent RNA polymerase (RdRp) for EV71 replication, is widely targeted to inhibit EV71 infection. In this study, we identified a novel host protein, AIMP2, capable of binding to 3D polymerase and inhibiting EV71 infection. Subsequent investigations revealed that AIMP2 recruits the E3 ligase SMURF2, which mediates the polyubiquitination and degradation of 3D polymerase. Furthermore, the antiviral effect of AIMP2 extended to the CVA16 and CVB1 serotypes. Our research has uncovered the dynamic regulatory function of AIMP2 during EV71 infection, revealing a novel antiviral mechanism and providing new insights for the development of antienteroviral therapeutic strategies., Competing Interests: Conflict of interest Prof. Ke Lan is an editorial board member for Virologica Sinica and was not involved in the editorial review or the decision to publish this article. The authors declare that they have no conflicts of interest., (Copyright © 2024 The Authors. Publishing services by Elsevier B.V. All rights reserved.)

Objective: Patients with laryngotracheal stenosis (LTS) often have dysphagia after laryngotracheal reconstruction with T-tube insertion, which affects the quality of life. The purpose of this study is to observe the effect of swallowing rehabilitation therapy on the improvement of quality of life in patients of otolaryngology-head and neck surgery with dysphagia undergoing T-tube implantation treatment through longitudinal study., Methods: Thirty-eight patients with LTS who experienced dysphagia after laryngotracheal reconstruction and T-tube implantation were recruited. All patients received swallowing rehabilitation therapy. The assessment of swallowing function was performed using the 10-item Eating Assessment Tool (EAT-10), the 30 mL water swallow test (WST), and flexible endoscopic evaluation of swallow (FEES)., Results: After swallowing rehabilitation therapy, timing of swallowing, grade of dysphagia, performance on FEES and 30 mL WST, and EAT-10 score all improved. Thirty-eight patients successfully transitioned to oral feeding and were able to remove their nasogastric tubes without experiencing any complications, including aspiration pneumonia., Conclusion: For patients with LTS who experienced dysphagia after laryngotracheal reconstruction and T-tube implantation, swallowing rehabilitation therapy could improve swallowing function of the patients, so as to reduce the potential harm caused by the pain and complications of surgery experienced by patients., (© 2024 Wiley Periodicals LLC.)

The transformation of CO 2 into value-added products from an impure CO 2 stream, such as flue gas or exhaust gas, directly contributes to the principle of carbon capture and utilization (CCU). Thus, we have developed a robust iron-based heterogeneous photocatalyst that can convert the exhaust gas from the car into CO with an exceptional production rate of 145 μmol g -1 h -1 . We characterized this photocatalyst by PXRD, XPS, ssNMR, EXAFS, XANES, HR-TEM, and further provided mechanistic experiments, and multi-scale/level computational studies. We have reached a clear understanding of its properties and performance that indicates that this highly robust photocatalyst could be used to design an efficient visible-light-mediated reduction strategy for the transformation of impure CO 2 streams into value-added products., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

Internalized pools of membrane attack complexes (MACs) promote NF-kB and dysregulated tissue inflammation. Here, we show that C9, a MAC-associated protein, promotes loss of proteostasis to become intrinsically immunogenic. Surface-bound C9 is internalized into Rab5 + endosomes whose intraluminal acidification promotes C9 aggregates. A region within the MACPF/CDC domain of C9 stimulates aggrephagy to induce NF-kB, inflammatory genes, and EC activation. This process requires ZFYVE21, a Rab5 effector, which links LC3A/B on aggresome membranes to RNF34-P62 complexes to mediate C9 aggrephagy. C9 aggregates form in human tissues, C9-associated signaling responses occur in three mouse models, and ZFYVE21 stabilizes RNF34 to promote C9 aggrephagy in vivo . Gene-deficient mice lacking ZFYVE21 in ECs showed reduced MAC-induced tissue injury in a skin model of chronic rejection. While classically defined as cytotoxic effectors, MACs may impair proteostasis, forming aggregates that behave as intracellular alarmins., Competing Interests: COMPETING INTERESTS The authors declare no competing interests.

Rationale & Objective: Membranous nephropathy (MN), recognized as an autoimmune kidney disease, responds well to anti-CD20 monoclonal antibodies. Obinutuzumab, a type Ⅱ humanized anti-CD20 and immunoglobulin G1 Fc-optimized monoclonal antibody, when compared with rituximab, has demonstrated superior efficacy in B-cell leukemia and lymphoma, especially in rituximab-resistant cases. However, the efficacy and safety of obinutuzumab in MN remain unclear., Study Design: A case series study., Setting & Participants: A total of 18 patients were diagnosed with MN and had received obinutuzumab at our center without secondary MN, undergoing dialysis, having a history of kidney transplantation, or infections requiring treatment., Exposure: Obinutuzumab treatment., Outcomes: Primary outcomes included remission rate, time to first remission, and first relapse-free survival time during the follow-up period., Analytical Approach: Survival analysis was performed with Cox proportional hazards models, log-rank test, and Kaplan-Meier survival analysis., Results: Patients with MN (median age of 52.5 years, 83.3% males) received an average dose of 2.1 ± 0.8 g of obinutuzumab during a median follow-up period of 13.6 months. During the follow-up, 17 patients (94.4%) achieved remission, with 12 patients (66.7%) achieving partial remission, and 5 patients (27.8%) achieving complete remission. The median time to first remission and first relapse-free survival time was 2.7 (1.0-6.1) months and 9.8 (2.6-11.2) months, respectively. Of 12 patients with previous rituximab treatment, all achieved remission successfully, with 8 (66.7%) achieving partial remission and 4 (33.3%) achieving complete remission. Adverse events were mostly mild, and no severe treatment-related adverse events were observed., Limitations: Limited or missing data; risks of selection bias; or recall bias; underestimated first relapse-free survival time because of a limited follow-up period; unmonitored counts of CD19 +  B-cells and other lymphocyte subsets., Conclusions: Obinutuzumab demonstrated promising efficacy and safety in inducing remission in MN, particularly in patients with an unsatisfactory response to rituximab., (© 2024 The Authors.)

Although more attention has been paid to microplastics (MPs) pollution in environment, research on the synthetic influence of microplastic and heavy metals remains limited. To help fill this information gap, we investigated the adsorption behavior of virgin polyvinyl chloride microplastics (PVCMPs) (≤450 µm white spherical powder) on cadmium (II). The effects on seed germination, seedling growth, photosynthetic system, oxidative stress indicators of lettuce, and changes in Cd bioavailability were evaluated under Cd 2+ (25 μmol/L), PVCMPs (200 mg/L), and PVCMP-Cd combined (200 mg/L + 25 μmol/L) exposures in hydroponic system. The results demonstrated that the PVCMPs effectively adsorbed Cd ions, which validated by the pseudo-second-order kinetic and the Langmuir isotherm models, indicating the sorption of Cd 2+ on the PVCMPs was primary chemisorption and approximates monomolecular layer sorption. Compared to MPs, Cd significantly inhibits plant seed germination and seedling growth and development. However, Surprising improvement in seed germination under PVCMPs-Cd exposure was observed. Moreover, Cd 2+ and MPs alone or combined stress caused oxidative stress with reactive oxygen species (ROS) including H 2 O 2 , O 2- and Malondialdehyde (MDA) accumulation in plants, and substantially damaged to photosynthesis. With the addition of PVCMPs, the content of Cd in the leaves significantly (P<0.01) decreased by 1.76-fold, and the translocation factor and Cd 2+ removal rate in the water substantially (P<0.01) decreased by 6.73-fold and 1.67-fold, respectively in contrast to Cd 2+ stress alone. Therefore, it is concluded the PVCMP was capable of reducing Cd contents in leaves, alleviating Cd toxicity in lettuce. Notably, this study provides a scientific foundation and reference for comprehending the toxicological interactions between microplastics and heavy metals in the environment., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper, (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Background: Patients with diffuse large B-cell lymphoma (DLBCL) often experience a poor prognosis due to cardiac damage induced by anthracycline chemotherapy, with left ventricular diastolic dysfunction manifesting early. Vector Flow Mapping (VFM) is a novel technology, and its effectiveness in detecting left ventricular diastolic dysfunction following anthracycline chemotherapy remains unverified., Objects: This study evaluates left ventricular diastolic function in DLBCL patients after anthracycline chemotherapy using vector flow mapping (VFM)., Materials and Methods: We prospectively enrolled 54 DLBCL patients who had undergone anthracycline chemotherapy (receiving a minimum of 4 cycles) as the case group and 54 age- and sex-matched individuals as controls. VFM assessments were conducted in the case group pre-chemotherapy (T0), post-4 chemotherapy cycles (T4), and in the control group. Measurements included basal, middle, and apical segment energy loss (ELb, ELm, ELa) and intraventricular pressure differences (IVPDb, IVPDm, IVPDa) across four diastolic phases: isovolumic relaxation (D1), rapid filling (D2), slow filling (D3), and atrial contraction (D4)., Results: When comparing parameters between the control and case groups at T0, no significant differences were observed in general data, conventional ultrasound parameters, and VFM parameters (all P > 0.05). From T0 to T4, ELa significantly increased throughout the diastole cycle (all P < 0.05); ELm increased only during D4 (all P < 0.05); and ELb increased during D1, D2, and D4 (all P < 0.05). All IVPD measurements (IVPDa, IVPDm, IVPDb) increased during D1 and D4 (all P < 0.05) but decreased during D2 and D3 (all P < 0.05). Significant positive correlations were identified between ELa-D4, IVPDa-D4, and parameters A, e', E/e,' and LAVI (all r > 0.5, all P < 0.001). Negative correlations were noted with E/A for ELa- D4 IVPDa-D4 (all r < -0.5, all P < 0.001). Positive correlations were observed for IVPDa-D1, IVPDa-D2 with E, E/e', and LAVI (0.3

Introduction: Variability in microbial residues within soil aggregates are becoming progressively essential to the nutritive and sustainability of soils, and are therefore broadly regarded as an indispensable part of soil organic matter. It is unexplored how the widespread implementation of microbial fertilisers in agricultural production impacts soil organic nutrients, in particular the microbial residue fraction., Methods: We performed a three-year field experiment to verify the distinct impacts of microbial and organic fertilizers on carbon accumulation in soil microbial leftovers among aggregate fractions., Results: Microbial residual carbon was shown to decrease insignificantly during the application of microbial fertilizer and to rise marginally afterwards with the utilization of organic fertilizer. However, the combined effects of the two fertilizers had substantial impacts on the accumulation of microbial residual carbon. Changes in the structure of the fungi and bacteria shown in this study have implications for the short-term potential of microbial fertilizer shortages to permanent soil carbon sequestration. Additionally, our findings revealed variations in microbial residue accumulation across the microbial fertilizers, with Azotobacter chroococcum fertilizer being preferable to Bacillus mucilaginosus fertilizer due to its higher efficiency. In this scenario of nutrient addition, fungal residues may serve as the primary binding component or focal point for the production of new microaggregates, since the quantity of SOC provided by fungal residues increased while that supplied by bacterial residues decreased., Discussion: Our findings collectively suggested that the mechanisms behind the observed bacterial and fungal MRC (microbial residue carbon) responses to microbial fertilizer or organic fertilizer in bamboo forest soils are likely to be distinct. The application of microbial fertilizers for a limited duration led to a decline soil stable carbon pool, potentially influencing the regulation of soil nutrients in such hilly bamboo forests., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Cai, Long, Li, Cao, Wang, Zhao, Ren, Zhao, Huang, Lu, Hu and Xu.)