Search

Lung cancer is a major public health problem worldwide, with high rates of morbidity and mortality. It often coexists with chronic obstructive pulmonary disease (COPD), the diagnosis and management of which often receives insufficient attention. In particular, the presence of COPD has significant implications for the clinical management of lung cancer patients. This review systematically assesses the influence of COPD on the efficacy of immunotherapy and the occurrence of immune-related adverse events in patients with lung cancer, identifies existing challenges and proposes avenues for future research in this field.

Dentin dysplasia type Ⅱ (DD-Ⅱ) is a subtype of hereditary dentin disorders. The dentin sialophosphoprotein (DSPP) gene has been revealed to be the causative gene, whose mutations could affect the normal tooth development process. The lesions involve both deciduous and permanent dentition, mainly manifested as tooth discoloration, attrition and even the subsequent malocclusion. If not treated in time, it will significantly affect the physical and psychological health of patients. The disease is difficult to be diagnosed in clinic accurately as its low incidence and hidden manifestations. The present article aims to discuss the clinical and radiographic characteristics, diagnosis, treatment of DD-Ⅱ, in order to improve the overall understanding on DD-Ⅱ for clinicians.

The biological samples of oral genetic diseases and rare diseases are extremely precious. Collecting and preserving these biological samples are helpful to elucidate the mechanisms and improve the level of diagnose and treatment of oral genetic diseases and rare diseases. The standardized construction of biobanks for oral genetic diseases and rare diseases is important for achieving these goals. At present, there is very little information on the construction of these biobanks, and the standards or suggestions for the classification and coding of biological samples from oral and maxillofacial sources, and this is not conducive to the standardization and information construction of biobanks for special oral diseases. This consensus summarizes the background, necessity, principles, and key points of constructing the biobank for oral genetic diseases and rare diseases. On the base of the group standard "Classification and Coding for Human Biomaterial" (GB/T 39768-2021) issued by the National Technical Committee for Standardization of Biological Samples, we suggest 76 new coding numbers for different of biological samples from oral and maxillofacial sources. We hope the consensus may promote the standardization, and smartization on the biobank construction as well as the overall research level of oral genetic diseases and rare diseases in China.

Objective: To investigate the etiology, prevention and treatment status, and their corresponding regional differences of the patients with liver cirrhosis in China, in order to provide scientific basis for the development of diagnosis and control strategies in China. Methods: Clinical data of patients diagnosed with liver cirrhosis for the first time through January 1, 2018 to December 31, 2020 from 50 hospitals in seven different regions of China were collected and analyzed retrospectively, and the difference of etiology, treatment, and their differences in various regions were analyzed. Results: A total of 11 861 cases with liver cirrhosis were included in the study. Thereinto, 5 093 cases (42.94%) were diagnosed as compensated cirrhosis, and 6 768 cases (57.06%) had decompensated cirrhosis. Notably, 8 439 cases (71.15%) were determined as chronic hepatitis B-caused cirrhosis, 1 337 cases (11.27%) were alcoholic liver disease, 963 cases (8.12%) were chronic hepatitis C, 698 cases (5.88%) were autoimmune liver disease, 367 cases (3.09%) were schistosomiasis, 177 cases (1.49%) were nonalcoholic fatty liver, and 743 cases (6.26%) of other types of liver disease. There were significant differences in the incidence of chronic hepatitis B, chronic hepatitis C, alcoholic liver disease, fatty liver, schistosomiasis liver disease, and autoimmune liver disease among the seven regions ( P <0.001). Only 1 139 cases (9.60%) underwent endoscopic therapy, thereinto, 718 cases (6.05%) underwent surgical therapy, and 456 cases (3.84%) underwent interventional therapy treatment. In patients with compensated liver cirrhosis, 60 cases (0.51%) underwent non-selective β receptor blockers(NSBB), including 59 cases (0.50%) underwent propranolol and 1 case (0.01%) underwent carvedilol treatment. In patients with decompensated liver cirrhosis, 310 cases (2.61%) underwent NSBB treatment, including 303 cases (2.55%) underwent propranolol treatment and 7 cases (0.06%) underwent carvedilol treatment. Interestingly, there were significant differences in receiving endoscopic therapy, interventional therapy, NSBB therapy, splenectomy and other surgical treatments among the seven regions ( P <0.001). Conclusion: Currently, chronic hepatitis B is the main cause (71.15%) of liver cirrhosis in several regions of China, and alcoholic liver disease has become the second cause (11.27%) of liver cirrhosis in China. The three-level prevention and control of cirrhosis in China should be further strengthened.

We studied the effect of fibroblast growth factor receptor 3 (FGFR3) inhibitor BGJ-398 on the differentiation of bone marrow mesenchymal stem cells (BM MSC) into osteoblasts in wild type (wt) mice and in animals with mutation in TBXT gene (mt) and possible differences in the pluripotency of these cells. Cytology tests showed that the cultured BM MSC could differentiate into osteoblasts and adipocytes. The effect of different BGJ-398 concentrations on the expression of FGFR3, RUNX2, SMAD1, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD8 were studied by quantitative reverse transcription PCR. The expression of RUNX2 protein was evaluated by Western blotting. BM MSC of mt and wt mice did not differ in pluripotency and expressed the same membrane marker antigens. BGJ-398 inhibitor reduced the expression of FGFR3 and RUNX2. In BM MSC from mt and wt mice have similar gene expression (and its changing) in FGFR3, RUNX2, SMAD1, SMAD4, SMAD5, SMAD6, SMAD7, and SMAD8 genes. Thus, our experiments confirmed the effect of decreased expression of FGFR3 on osteogenic differentiation of BM MSC from wt and mt mice. However, BM MSC from mt and wt mice did not differ in pluripotency and are an adequate model for laboratory research., (© 2023. Springer Science+Business Media, LLC, part of Springer Nature.)

Circadian rhythm is regulated by circadian clock, which is formed by the body response to external cyclic stimuli through the endogenous circadian clock. Circadian rhythm disturbance is closely related to the risks of a variety of diseases, and its impact on oral health cannot be ignored. Exploring the relationship and related molecular mechanism between circadian rhythm and dental hard tissues development are helpful to deeply understand the pathogenesis of developmental defects on these tissues, which could provide a theoretical basis for prevention and treatment on disorders of dental hard tissues. In order to provide guidance for the disease prevention and treatment, based on the summarization of current research progress, this paper focuses on the involvement of biorhythm in the development of tooth hard tissues as well as the disturbance of circadian rhythm on the formation of enamel and dentin, and analyzes the related regulating mechanism of circadian rhythm and genes during the development of tooth hard tissues.

Diabetes mellitus is a relative contraindication of dental implant therapy, that limits the application of implant therapy severely. Diabetic status often leads to secondary vascular and bone lesions, which affect treatment adversely and lead to an increased failure rate. Therefore, how to implement implant therapy for diabetic patients has become a difficult question for dentists. According to the research and experience over the years on diabetic patients, and referring to the current research progress on this topic, the authors will discuss the clinical characteristics of diabetic patients and the details of treatment process, for reference.

Objective: To investigate the effect of guided bone regeneration (GBR) on marginal bone loss (MBL) in the region of the mandibular posterior tooth by using a retrospective cohort study, in order to provide reference for clinical practice. Methods: The research subjects were patients who received dental implants from October 2008 to June 2011 in the region of the mandibular posterior tooth at the Department of Oral Implantology, School of Stomatology, The Fourth Military Medical University. According to whether GBR was performed or not and the time of implant insertion, the patients were divided into the controls group (patients without bone grafting), simultaneous GBR implantation group, and delayed GBR implantation group. On this basis, the MBL was measured according to radiographs by comparing the marginal bone level from that of immediate postoperation 10 years ago. General data was collected and compared among groups, including modified plaque index (mPI), modified sulcus bleeding index (mSBI), probing depth (PD), and gingival papilla height. Results: The controls group (patients without bone grafting), implantation group, and delayed GBR implantation group followed 58, 76, 26 implants in 26, 32, 13 patients aging at (46.5±9.9), (45.5±10.7), (58.3±6.4) respectively. The duration of the follow-up was (11.2±0.7), (11.1±0.8), (11.1±0.9) years respectively. The 10-year implant survival rate was 100% (58/58), 100% (76/76), 100% (26/26). The MBL was (0.91±0.28), (0.84±0.27), (1.01±0.27) mm respectively. The MBL difference of patients with simultaneous GBR implantation and delayed GBR implantation showed statistical significance ( P <0.05), but these two groups showed no statistical significance compared with the controls group ( P >0.05). The mPI, mSBI, PD, and gingival papilla height of the three groups all had no significance on statistics ( P >0.05). Conclusions: It can be concluded that there is no difference in long-term marginal bone resorption between simultaneous and delayed implantation with or without GBR (using autologous blood mixed with granular bone meal) in the posterior mandibular area.

We detected some serious inaccuracies and mistakes. Therefore, the article "MiR-605-3p inhibits malignant progression of prostate cancer by up-regulating EZH2, by M.-Z. Pan, Y.-L. Song, F. Gao, published in Eur Rev Med Pharmacol Sci 2019; 23 (20): 8795-8805-DOI: 10.26355/eurrev&#95;201910&#95;19274-PMID: 31696466" has been withdrawn. The Publisher apologizes for any inconvenience this may cause. https://www.europeanreview.org/article/19274.

Objective: The incidence of thyroid cancer is rising globally. Most patients progress slowly, but some patients develop lymph node and distant metastasis earlier, and their prognosis is poor. Therefore, early diagnosis and warning of malignancy are very meaningful for such patients. SAS1B gene is a newly discovered protein expressed on the surface of mature egg cells and has metalloendopeptidase activity. We aimed at exploring whether SAS1B is involved in the occurrence of thyroid cancer, and at providing evidence for early diagnosis and targeted therapy of thyroid cancer., Patients and Methods: In this study, a rabbit anti-human SAS1B polyclonal antibody was prepared by gene recombination technology. The indirect ELISA method was used to detect the SAS1B protein expression in the serum of 69 patients with thyroid cancer and 55 normal controls, and the relevant pathological factors were analyzed. Immunohistochemistry and PCR technology were used to investigate the expression levels of SAS1B protein and mRNA in 30 thyroid cancer tissues and 23 control thyroid tissues., Results: The titer of SAS1B recombinant antibody was 1:51200. The expression of SAS1B in the serum of patients with thyroid cancer was higher than that in the normal control group (p<0.01). The antibody had a good sensitivity in serum detection of cancer patients (p=0.008<0.01), the linear regression analysis result was that the expression of SAS1B gene was related to tumor envelope invasion and lymph node metastasis (p=0.003<0.01, p=0.003<0.01), and it was irrelevant to the patient's gender, age, tumor mass size, number of cancer foci, pathological stage, etc. (p>0.05). The results of immunohistochemistry showed that SAS1B protein was mainly located in the cytoplasm and membrane of thyroid cancer cells. The expression intensity in thyroid cancer tissues was higher than that in control tissues (p<0.05), but it was not expressed in normal thyroid tissues. Antibodies showed a good sensitivity that was used to detect thyroid cancer tissues (p=0.000<0.01). The results of ordinary PCR detection using thyroid cancer tissue and control thyroid tissue showed that the amplification products of the three domains (N-terminal, C-terminal and catalytic domain) of the SAS1B gene showed high expression in thyroid cancer tissue. q-PCR results showed that the expression of SAS1B gene in thyroid cancer and control thyroid tissue was higher than that in control group (p<0.05), and the genes of Aurora A and BARD1 related to centrosome replication and DNA replication forks protection during the proliferation were highly expressed in thyroid cancer tissue. The study results suggested that SAS1B was involved in the carcinogenesis of thyroid cancer. The Hum&#95;mPLoc.2.0 software, PSORT Ⅱ software and UniProt software were used to predict that SAS1B protein had secretory protein properties., Conclusions: The above data indicate that the SAS1B gene is closely related to the process of thyroid cancer and can serve as a good tumor marker that can be used for early diagnosis and early warning of thyroid malignancy.

With the development of dental implant prosthodontic technique, many new concepts and methods have emerged. In the light of present situation, implant prosthodontic technique is developing towards precision, comfortability, immediacy and digitization. Meanwhile, the research area is focusing on expanding immediate restoration indications, clinical selection strategies of different prosthodontic materials and the accuracy of digitalized prosthodontics. The paper aims to discuss the developing trend in prosthodontics of dental implantology for clinical reference.

Objective: To explore the protective effect of human adipose-derived mesenchymal stem cells (AD-MSCs) and liraglutide on lipopolysaccharide (LPS) -induced acute lung injury (ALI) . Methods: AD-MSCs were cultured in vitro and randomly divided into 3 groups: control group, LPS group (30 mg/L) , and LPS (30 mg/L) +liraglutide (10 nM) group. MTT assay was used to detect the proliferation of AD-MSCs at 6, 24, 48 and 72 h. Annexin V-FITC / PI double staining flow cytometry was used to detect the apoptosis of the cells. Western blot was used to detect the expression of apoptotic proteins cleaved caspase-3, Bax and Bcl-2 at 72 h in vitro . For the in vivo experiment, 60 male SPF BALB/c mice were randomly divided into 5 groups: control group, ALI group, ALI+AD-MSCs group, ALI+Liraglutide group, and ALI+AD-MSCs+Lraglutide group. The mice were sacrificed on day 2 and day 7 after LPS treatment. HE staining was used to examine the pathological changes of the lungs of mice, and the scores of lung injury were measured. The lung tissues of mice were examined by immunohistochemistry, and the expression of the marker protein Nanog of mesenchymal stem cells was observed. BALF was collected, and the number of BALF neutrophils was counted by Rayleigh Giemsa staining. The wet/dry specific gravity of mouse lung tissue was recorded. Results: The apoptosis of AD-MSCs stimulated by LPS was significantly higher than that of the control group ( P< 0.05) , and the proliferation of AD-MSCs at 6, 24, 48 and 72 h was significantly lower than that of the control group (all P< 0.05) . The addition of Liraglutide reduced the apoptosis of AD-MSCs ( P< 0.05) , and promoted the proliferation of AD-MSC at 6, 24, 48 and 72 h. Compared with the control group, in the 2 d and 7 d model groups, the lung injury pathology of ALI group had lung injury, increased number of neutrophils in BALF (65.63±1.34 vs 1.74±0.17, 51.67±1.35 vs 1.55±0.13) ×10(4)/ml (all P< 0.05) , and increased W/D of lung tissues. The expression level of Nanog protein was low in the 7 d model group. Compared with the ALI group, in 2 d and 7 d model groups, the ALI+AD-MSCs group, the ALI+liraglutide group, and the ALI+AD-MSCs+liraglutide group showed reduced lung injury pathology, and the number of neutrophils was decreased, (37.04±1.23, 29.17±0.68) ×10(4) / ml (all P< 0.05) in the ALI+AD -MSCs group, (39.58±1.67, 35.42±0.25) ×10(4) / ml in the ALI+Liraglutide group (all P< 0.05) and (28.54±0.37, 21.46±0.89) ×10(4)/ml (all P< 0.05) in the ALI+AD-MSCs+Liraglutide group. Lung tissue W/D in the ALI+AD-MSCs group, ALI+Liraglutide group and ALI+AD-MSCs+Liraglutide group showed the same trend. Nanog protein expression increased in the 7 d model group. Conclusions: AD-MSCs play a protective role in acute lung injury in mice under the synergistic effect of liraglutide.

Objective: To explore and analyze the clinical characteristics, diagnosis and treatment of infant hairy polyp. Methods: A retrospective analysis was made on 13 cases of hairy polyp confirmed by pathology, who were admitted to the Children's Hospital of Hebei Province from January 2010 to September 2019, including 4 males and 9 females, with a male-female ratio of 1∶2.25. The age ranged from 3 hours to 1 year, and the median age was 1 month. Twelve of the 13 children were found to have difficulty breathing or feeding. All the children received coblation resection under general anesthesia. The root pedicle of the mass was found in the lateral nasopharyngeal wall in 8 cases, in the junction of palatine and palatopharyngeal arch of tonsil and the tongue and esophageal entrance in 1 case, respectively. Nasal septum was found in 2 cases, including 1 case located between two incisors. The wound at the root pedicle was ablated and the bleeding was stopped completely. Results: Postoperative follow-up lasted from 3 months to 2 years, and there was no recurrence in 12 cases. Fibrolaryngoscope showed a mass of the right eustachian tube and pharyngeal mouth in 1 case 2 years after the surgery, which was considered recurrence of hairy polyps and lost after that. Conclusion: Hairy polyps in infants is a rare clinical disease, and its main symptom is upper respiratory tract obstruction. Early diagnosis and radical surgery are the key to the treatment of the disease.

Fusarium graminearum is the primary causal agent of Fusarium head blight (FHB) of wheat. The phenylpyrrole fungicide fludioxonil is not currently registered for the management of FHB in China. The current study assessed the fludioxonil sensitivity of a total of 53 F. graminearum isolates collected from the six most important wheat-growing provinces of China during 2018 and 2019. The baseline fludioxonil sensitivity distribution indicated that all of the isolates were sensitive, exhibiting a unimodal cure with a mean effective concentration for 50% inhibition value of 0.13 ± 0.12 μg/ml (standard deviation). Five fludioxonil-resistant mutants were subsequently induced by exposure to fludioxonil under laboratory conditions. Ten successive rounds of subculture in the absence of the selection pressure indicated that the mutation was stably inherited. However, the fludioxonil-resistant mutants were found to have reduced pathogenicity, higher glycerol accumulation, and higher osmotic sensitivity than the parental wild-type isolates, indicating that there was a fitness cost associated with fludioxonil resistance. In addition, the study also found a positive cross resistance between fludioxonil, procymidone, and iprodione, but not with other fungicides such as boscalid, carbendazim, tebuconazole, and fluazinam. Sequence analysis of four candidate target genes ( FgOs1 , FgOs2 , FgOs4 , and FgOs5 ) revealed that the HBXT2R mutant contained two point mutations that resulted in amino acid changes at K223T and K415R in its FgOs1 protein, and one point mutation at residue 520 of its FgOs5 protein that resulted in a premature stop codon. Similarly, the three other mutants contained point mutations that resulted in changes at the K192R, K293R, and K411R residues of the FgOs5 protein but none in the FgOs2 and FgOs4 genes. However, it is important to point out that the FgOs2 and FgOs4 expression of all the fludioxonil-resistant mutants was significantly ( P < 0.05) downregulated compared with the sensitive isolates (except for the SQ1-2 isolate). It was also found that one of the resistant mutants did not have changes in any of the sequenced target genes, indicating that an alternative mechanism could also lead to fludioxonil resistance.

Developmental disorders of dental hard tissues are important components of non-carious diseases, which mainly include amelogenesis imperfecta and hereditary dentin disorders with various subtypes. In the absence of effective intervention, these disorders would lead to tooth sensitivity, defects of tooth structure or even loss of tooth, affecting the masticatory function and facial aesthetic configuration. At present, many dental clinicians may not have sufficient understanding of the diseases, and it is urgent to pay attention to the diseases per se and the patients affected. Based on the summary of the current research progresses, this article focuses on the clinical classification, the disease phenotype and the pathogenesis of gene mutations, in order to provide reference and help for the dental clinicians as well as the patients.

Objective: To analyze the secondary pulmonary infection and the distribution of pathogenic bacteria in children with tracheobronchial foreign body, and to guide the clinical treatment. Method: The clinical data of 197 children with tracheobronchial foreign bodies confirmed by rigid bronchoscopy were reviewed. According to the clinical manifestations and signs, blood routine, chest CT and airway endocrine pathogen distribution, the secondary pulmonary infection was analyzed. Result: Seventy-five of 197 children with foreign bodies in tracheobronchial had secondary pulmonary infections. Among them, 32 cases of airway endocrine cultured pathogenic bacteria, mainly including Streptococcus pneumoniae and Haemophilus influenzae. Children with long preoperative history, fever, and with a history of using antibiotics are more likely to have secondary pulmonary infections. Conclusion: The duration of disease history, preoperative fever and the use of antibiotics are related to secondary pulmonary infection. The third generation of cephalosporins can effectively control the infection., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.)

Objective: We conducted this study to analyze the EEG abnormalities of cognitive impairment and epileptic seizures in patients with epilepsy, as well as to investigate the application value of EEG in the diagnosis of epilepsy with cognitive impairment., Patients and Methods: 62 cases of patients that were admitted to our hospital for the first diagnosis as status epilepticus were selected. Of those, 20 cases were accompanied by cognitive impairment. The America Biology Graphene type 24 leads channel video EEG was applied to monitor staging, index, frequency, and distribution range of epileptic discharge. The revised Wechsler Adult Intelligence Scale-Revised in China (WAIS-RC) and Wechsler Memory Scale-Revised in China (WMS-RC) were adopted to test cognitive function., Results: The epileptic discharge index, discharge frequency and discharge distribution range of the conscious period, sleep I-II period and sleep III-IV period of epilepsy with the cognitive impairment group were evidently higher than those of epilepsy without cognitive impairment group. The differences were statistically significant (p<0.05). Intelligence Quotient (IQ) and Memory Quotient (MQ) level of the cognitive impairment group were the lowest in sleep III-IV period, with the next being the sleep I-II period; the highest was the conscious period, and the differences were statistically significant (p<0.05). With an increase of the epileptic discharge index, the discharge range, IQ and MQ level of cognitive impairment group decreased; differences were statistically significant (p<0.05). Therefore, the discharge index, frequency, and distribution range of epileptic discharge of epilepsy with cognitive impairment in different periods differed from epilepsy patients without cognitive impairment. According to the extent of cognitive impairment in different stages, discharge index, frequency, and distribution range were also different., Conclusions: The 24 h video EEG, which was used to monitor epileptic discharge characteristics, has a great application value for early identification of epilepsy with cognitive impairment.

Objective: To clarify whether microRNA-646 could regulate the proliferative potential and cell cycle progression of nasopharyngeal carcinoma cells through targeting mammalian target of rapamycin (mTOR). It, therefore, could influence the occurrence and progression of nasopharyngeal carcinoma., Patients and Methods: Quantitative Real-time polymerase chain reaction (qRT-PCR) was used to detect expression of the levels of microRNA-646 and mTOR in tumor tissues and paracancerous tissues of patients with nasopharyngeal carcinoma. Besides, their expressions in nasopharyngeal carcinoma cell lines were determined by qRT-PCR. Survival analysis was conducted to evaluate the sensitivity and specificity of microRNA-646 in diagnosing nasopharyngeal carcinoma. The overall survival of patients with nasopharyngeal carcinoma was calculated based on their expression levels of microRNA-646. The regulatory effects of microRNA-646 and mTOR on proliferative potential and cell cycle progression were explored by cell counting kit-8 (CCK-8) assay and flow cytometry, respectively. Dual-luciferase reporter gene assay was conducted to verify the relationship between microRNA-646 and mTOR, which was further confirmed by Pearson correlation analysis. Finally, gain-of-function experiments were carried out to determine whether microRNA-646 could regulate the proliferative potential and cell cycle progression of nasopharyngeal carcinoma cells by targeting mTOR., Results: MicroRNA-646 was lowly expressed in nasopharyngeal carcinoma tissues and cell lines. Survival analysis confirmed the diagnostic value of microRNA-646 in nasopharyngeal carcinoma. Besides, the nasopharyngeal carcinoma patients with high level of microRNA-646 were expected to have a longer 5-year survival time compared with those with low level. Overexpression of microRNA-646 inhibited the proliferative potential and cell cycle progression of HONE1 and SUNE1 nasopharyngeal carcinoma cells. Dual-luciferase reporter gene assay detected the binding of microRNA-646 to mTOR. Moreover, mTOR was highly expressed in nasopharyngeal carcinoma tissues and cell lines. A negative correlation was found between microRNA-646 and mTOR. That is, the overexpression of mTOR could reverse the inhibitory effects of microRNA-646 on the proliferative potential and cell cycle progression of HONE1 and SUNE1 cells., Conclusions: MicroRNA-646 remains a low level in nasopharyngeal carcinoma. It inhibits the proliferative potential and cell cycle progression of nasopharyngeal carcinoma cells by targeting mTOR. It can, therefore, inhibit the development of nasopharyngeal carcinoma.

Objective: This study aimed to investigate the effect of microRNA-605-3p (miR-605-3p) on cell proliferation, invasion and migration in prostate cancer cells, as well as its effects on the Enhancer Zeste Homolog 2 (EZH2) expression and the potential regulatory mechanisms., Patients and Methods: Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was applied to detect the miR-605-3p expression in 52 pairs of Prostate Cancer (PCa) tissues and normal tissues, and to analyze the relationship between miR-605-3p expression and PCa pathological parameters. MiR-605-3p mimics were transfected into PCa cell line PC-3 and DU145 to achieve miR-605-3p overexpression. Then, Cell Counting Kit-8 (CCK-8), cell colony formation assay and transwell invasion and migration assay were performed to analyze miR-605-3p's effect on the biological function of prostate cancer cells. Finally, the potential mechanisms of downstream genes were explored through bioinformatics analysis and recovery experiments., Results: We found that miR-605-3p expression in PCa was markedly lower than that in normal tissues. Patients with low miR-605-3p expression had higher tumor stage, higher incidence of lymph node metastasis and distant metastasis. In vitro analysis showed that miR-605-3p overexpression leads to a significant decrease in cell proliferation, invasion and migration ability. Subsequently, it was verified in cell line and tissue that EZH2 expression was remarkably increased in PCa, which was negatively correlated with miR-605-3p expression. In addition, the recovery experiment found that EZH2 can counteract the role of miR-605-3p in PCa, together they affected the malignant progression of PCa., Conclusions: MiR-605-3p was significantly associated with PCa stage, lymph node metastasis and distant metastasis and the poor prognosis; besides, it can inhibit the malignant progression of PCa. In addition, the study showed that miR-605-3p may inhibit the proliferation, invasion and migration ability of PCa by regulating EZH2.

Objective: Hepatocellular carcinoma (HCC) is a hypervascularized tumor. Aberrant angiogenesis is the main cause, which results in cancer growth and progression. It has been showed that microRNA-302 cluster (miR-302) may be associated with angiogenesis. Here, we aimed to identify the role of miR-302a/b/c in the regulation of cell angiogenesis in HCC., Patients and Methods: MRNA expression of miR-302a/b/c and MACC1 was detected by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). The protein of MACC1 was measured using Western blot. Cells proliferation, migration, and invasion abilities were investigated via Cell Counting Kit-8 (CCK-8) assay or transwell assay, respectively. Tube formatting assays were used to explore the tube formation capacity. The interaction among miR-302a/b/c was analyzed by luciferase assay., Results: The expression of miR-302a/b/c was greatly reduced while MACC1 expression, whether mRNA or protein was conspicuously elevated in HCC tissues and cells. Then, functional experiment results showed miR-302a/b/c overexpression and MACC1 down-regulation inhibited the proliferation, migration, invasion ability, and tube formation capacity of HUVECs. In addition, we detected that miR-302a/b/c directly targeted MACC1 and suppressed MACC1 expression, and miR-302a/b/c could suppress tumor angiogenesis in HCC by targeting MACC1., Conclusions: MiR-302a/b/c may function as a potential suppressor of tumor angiogenesis in HCC by targeting MACC1, indicating a promising target for HCC therapy.

Background: Lung cancer patients with a previous extra-pulmonary malignancy have been widely discussed for their postoperative prognosis. Still, whether different types of previous extra-pulmonary malignancy confer different clinicopathological features and outcomes of lung cancer patients deserves further investigation., Methods: The medical records of patients undergoing operation for pulmonary malignancy were retrospectively reviewed. After identifying primary lung cancer out of pulmonary metastasis in patients with a history of previous extra-pulmonary malignancy, clinicopathological parameters and postoperative prognosis were compared between lung cancer patients without and with different types of previous extra-pulmonary malignancy., Results: Approximately, 5.0% lung cancer patients undergoing surgery had a previous extra-pulmonary malignancy. Prior breast cancer (20%) and colorectal cancer (16%) formed the majority of these previous extra-pulmonary malignancies. Many clinicopathological features such as reason for visit, tumor size and histological subtype were significantly different between lung cancer patients without and with different types of previous extra-pulmonary malignancy (P < 0.05). Lung cancer patients with a previous occurrence of breast cancer were the most different type from patients without a previous extra-pulmonary malignancy in clinicopathological features (P < 0.05). The postoperative overall survival was not significantly different between lung cancer patients without and with different types of previous extra-pulmonary malignancy (P > 0.05)., Conclusion: Previous extra-pulmonary malignancy was confirmed to be harmless to postoperative prognosis of lung cancer patients. Lung cancer patients with a previous extra-pulmonary malignancy, especially with a previous occurrence of breast cancer, were highly heterogeneous in clinicopathological features. These findings implied there might be a unique etiology existing in lung cancer following a previous occurrence of breast cancer.

Objective: To discuss the therapeutic scheme of petrous bone cholesteatoma(PBC) and the technique of facial nerve reconstruction. Method: The data of 28 patients who underwent surgery for PBC in our center were analyzed retrospectively. All patients were diagnosed radiologically with PBCs and reconfirmed pathologically after surgery. The surgical approach was discussed basing Sanna's classification of PBCs, and the facial nerve outcomes were analyzed moreover. Result: PBC cases 11 were supralabyrinthine, 4 infralabyrinthine, 3 infralabyrinthine-apical, 10 massive and none apical. The facial nerve was involved in 50% of the cases. The translabyrinthine approach were used in 3 cases. The transotic approach was used in 7 cases in this series.The transcochlear approach type was applied in 12 cases. The Infratemporal fossa type B approach and subtotal petrosectomy were employed in 2 cases and 4 cases respectively. Active management of the nerve(rerouting, anastomosis, or grafting) was required in 14 cases, postoperative facial nerve function were inproved in 10 cases(71.43%). Conclusion: The appropriate surgery approach was vitally important to radical disease clearance in PBCs. The facial nerve preservation was preceded hearing preservation. Active facial nerve management were beneficial to facial nerve recovery.., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.)

Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose.

Objective: Retrospctive analysed the Characteristics and outcomes of surgical treatment of 18 patients who were diagnosed as secondary acquired cholesteatoma (SAC). Method: Patients with SAC accepted operations were enrolled in this study. Then the factors such as sex, age, cource of history, otorrhea before operation, the size of perforation of tympanic membrane, entry site of epithelium, extension direction, ossicular destruction, tympanosclerosis, tympanum tympani tendon involvement, stage of cholesteatoma（JOS, 2015, Japan），degree of gasification of mastoid（JOS，2015，Japan），air conductive threshold, bone conductive threshold, air-bone gap, the healing of tympanic membrane and the auditory improvement were analyzed. Result: Eighteen patients were enrolled in this study, with course of history range from 2 months to 50 years (average: 20.20±16.31) years. There were 14 cases with wet ear before operation. All patients were conformed with perforation of membranal tensa by otoendoscopic photography before operation, with nearly total in 5 ears,large size in 10 ears,medium size in 2 ears and small size in 1 ear. Ossicular erosion were found in 13 patients (malleus involved in 6, incus involved in 12 and stapes involved in 4). Thirteen patients with tendon of tensor tympani involved and 9 patients with tympanosclerosis were conformed during operation. The epithelium entered through the malleus manubrium to the promontory in 13 cases, through the edge of the perforation in 3 cases and through the incus long process to around stapes in 1 case. Cholesteatoma invasion extend to anterosuperior area in 3 cases, posterosuperior area in 3 cases,both in anterosuperior and posterosuperior area in 12 cases. The cholesteatomas classified: stage Ⅰ in 11 cases, stage Ⅱ in 7 cases. Mastoid gasification classified MC0 in 6 cases, MC1 in 10 cases and MC2 in 2 cases. The average air conductive threshold was (56.32±10.15) dB, bone conductive threshold was (20.76±6.22) dB and air-bone gap (35.56±9.84) dB.Tympanic membrane healed in all patients during following up, without recurrent of cholesteatoma, and the post-operative air conductive threshold (43.02±14.96) dB and air-bone gap (21.04±12.90)dB were improved significantly( P <0.05). Conclusion: Most of SAC were secondary to nearly total or large perforation of membranal tensa (83.33%), with relative long history of chronic otitis media (average 20.20 ± 16.31) years and otorrhea before operation. The epithelium entered mainly through the malleus manubrium to the promontory，then through edge of the perforation，by extending anterosuperior and posterosuperior area and usually accompanied with tendon of tensor tympani involved, ossicular destruction, and poor mastoid gasification and tympanosclerosis. The characteristics of SAC were different from other type of cholesteatoma which need further researches.

Objective: To analyze the clinical features of pulmonary mucosa-associated lymphoid tissue (MALT) lymphoma. Methods: A total of 14 cases diagnosed with primary pulmonary MALT lymphoma were collected from May 2007 to May 2017 in Zhongshan Hospital, Fudan University. The clinical features, pathological characteristics, diagnosis, treatment and prognosis were retrospectively analyzed. Results: All 14 cases were pathologically diagnosed with primary pulmonary MALT lymphoma. The biopsy tissues were obtained through the Video-assisted Thoracoscopic Surgery (VATS) (4 cases), percutaneous puncture (2 cases), and bronchoscopy (8 cases). Cell types of these tumors were centrocyte-like cells (10 cases), lymphocytoid cells (2 cases), and monocytoid B cells (2 cases). The B cell clonality was detected by IgH cloning test in 4 cases and 3 of them were demonstrated with monoclonal strips. MALT1 breakup gene was positive in 3 out of 6 examined cases using fluorescence in situ hybridization (FISH). As for the treatment, 8 patients underwent chemotherapy, 5 patients underwent surgical resection and 1 patient abandoned treatment. Twelve patients were followed up to 9 years. The tumor recurrence occurred in 2 patients and resulted their death. Conclusions: The clinical manifestations of primary pulmonary MALT lymphoma are lack of specificity. The pathology, immunohistochemistry, IgH cloning test and MALT1 breakup gene tested by FISH are the criteria for diagnosis.

Objective: To evaluate the effect of semaphorin 3A (Sema3A) pre-treated bone marrow mesenchymal stem cells (BMSC) sheets on new bone formation in type 2 diabetes mellitus rats. Methods: Type 2 diabetes mellitus (T2DM) were induced by injection of streptozotocin, and the BMSC were isolated, controlled, identified and induced into cell sheets. Fifteen T2DM rats were randomly divided into control, sheets and Sema3A-sheets group and the calvarial critical size defect (CSD) model of rats were established. The defect zone of rats from control group were implanted with bone powder. The defect zone of rats from sheets group were implanted with bone powder and BMSC sheets. The defect zone of rats from Sema3A-sheets group were implanted with bone powder and BMSC sheets pretreated with 1.0 mg/L Sema3A. After 8 weeks, the bone samples were harvested and analyzed by micro-CT scanning, HE staining for the evaluation of new bone formation, and the immunohistochemical analysis for the expression of osteogenesis-related proteins including type Ⅰ collagen (COL- Ⅰ ), bone morphogenetic protein-2 (BMP-2), and osteocalcin (OCN). Results: The BMSC were isolated and cultured, and oil red O and Alizarin red S staining proved the multi-potential differentiation. Eight weeks after the establishment of calvarial CSD model, Sema3A-sheet group showed the most abundant new bone formation (0.516±0.070), with increased bone volume fraction, namely bone volume/tissue volume (BV/TV) compared with sheets group (0.319±0.050) and control group (0.224±0.037) ( P <0.05), and the sheets group showed increased BV/TV compared with control group ( P <0.05). While trabecular thickness (Tb.Th) control group showed no difference in three groups ( P >0.05). HE staining also confirmed that Sema3A-sheets group showed the most new bone formation. Sheet group (0.174±0.051) compared showed difference with control group (0.099±0.033) ( P < 0.05), and Sema3A-sheet group (0.421±0.069) showed increased bone formation compared with sheet group and control group ( P <0.05). Immunohistochemistry showed that BMSC sheet increased the expression of osteogenesis-related proteins including COL-Ⅰ, BMP-2 and OCN, while Sema3A pretreatment showed more obvious increase of the expression of COL-Ⅰ and OCN. Conclusions: The combined implantation of bone powder and Sema3A stimulated BMSC sheets significantly increased bone regeneration in vivo . Therefore, Sema3A pre-treated BMSC sheets transplantation provides a new strategy for restoring bone defect in T2DM.

Objective: The aim of this study is to explore the value of EBV DNA monitor in high risk population of nasopharyngeal carcinoma (NPC). Method: A total of 366 cases of NPC at high risk were screened for 15 864 cases by ELISA, and 262 cases were randomly selected from low-risk groups. Fifty-eight nasopharyngeal carcinoma patients were also involved. EBV DNA was detected by PCR in 366 NPC high risk patients and followed up for 1 year. The clinical significance of EBV-DNA in screening NPC was compared. Result: The positive rate of EBV-DNA test was 12.0% in primary screening, EBV-DNA test in primary screening was 3.4% in low-risk population, and EBV-DNA in nasopharyngeal carcinoma was 91.4%, The positive rate of the three groups was statistically significant ( P <0.01); After one year follow-up, a total of 267 cases returned visit. Positive rate of group A with continuous high risk was significantly higher than group B who was high risk at the first time of visit and non high risk at returned visit ( P ＜0.05). Conclusion: Quantitative analysis of plasma EBV DNA in high risk population can supply serological risk assessment. It can elevate the efficiency of screening and has significant application value for NPC high risk population.

Objective: To compare the prevalence of HIV/STD and related health care seeking behaviors among male STD clinic attendees between Xi'an and Xianyang cities. Methods: During June and July 2016, 206 male STD clinic attendees were studied in Xi'an city, with another 221 male STD clinic attendees in Xianyang city. Cross-sectional questionnaire survey was used to collect attendees'behavioral information. Blood samples were collected via HIV/HCV/Syphilis testing. Results: The prevalence rate of HIV infection was 2.4% (5/206) in Xi'an and 0.9% (2/221) in Xianyang, with no statistical significant difference between the two cities. The prevalence rate of syphilis was 4.9% (10/206) in Xi'an, which was significantly lower than 13.6% (30/221) in Xianyang. The proportion of respondents, diagnosed with other sexually transmitted diseases, in Xi'an was higher than that of Xianyang. The proportions of commercial heterosexual sex and sex with temporary sexual partners in the past 3 months were 18.0% (37/206) and 15.5% (32/206) in Xi'an, lower than 46.6% (103/221) and 15.8% (35/221) in Xianyang ( χ (2)=39.70, Р <0.01; χ (2)=0.01, P =0.93) . The proportions of condom use with commercial sex workers or temporary sexual partners in the past 3 months among Xi'an were 37.8% (14/37) and 6.3% (2/32) , lower than 93.1% (95/102) and 57.1% (20/35) in Xianyang ( χ (2)=49.06, Р <0.01; χ (2)=19.63, Р <0.01) . Conclusion: Differences were noticed between Xi'an and Xianyang city in terms of STD and HIV prevalences, behaviors related to commercial sex and use of condoms among the male STD clinic attendees that calling for targeted actions in control of high risk behavlors in both HIV/AIDS and STDs transmission.

Objective: To investigate the value of preoperative dynamic contrast-enhanced MRI in reducing the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma. Methods: Seventy-two patients with early non-mass breast carcinoma received ultrasonographic and mammographic examination and subsequently underwent dynamic contrast-enhanced MRI examination before breast conserving surgery. The control group consisted of 74 patients who had early non-mass breast carcinoma. They only received ultrasonographic and mammographic examination and didn't undergo contrast-enhanced MRI examination. The comparison of the rate of tumor-positive resection margins between two groups was performed. The MRI findings that had the significant influence on the rate of tumor-positive resection margins were analyzed using Logistic regression model. Results: In 28 patients (28/72, 38.9%), dynamic contrast-enhanced MRI could correct or supplement the ultrasonographic and mammographic findings and resulted in the reasonable change of surgical program. The preoperative MRI examination group ( n =30) had lower rate of tumor-positive resection margins than control group for invasive ductal carcinoma (23.3% vs 40.0%, P =0.02), but there was no significant difference (21.4% vs 26.9%, P =0.10) between two groups for ductal carcinoma in situ ( n =28). The preoperative MRI examination group ( n =14) had lower rate of tumor-positive resection margins than control group for the other pathologic types of breast carcinoma (14.3% vs 38.9%, P =0.02). The statistical analysis on the basis of Logistic regression model showed that some main MRI findings, including change surrounding the tumor, distance between tumor and nipple and tumor size, had the significant influence on the rate of tumor-positive resection margins. Conclusion: Preoperative dynamic contrast-enhanced MRI significantly increased the accuracy of resection margins evaluation, and greatly reduced the rate of tumor-positive resection margins after breast conserving surgery in patients with early non-mass breast carcinoma.

The implant prosthesis has been extensively used in clinic recently, and implant failure is appearing. Many factors may cause the failure, and they work together generally. This paper summarizes and analyzes the failure cases related to implant treatment and relevant risk factors of oral implants in Department of Implantation, School of Stomatology, The Fourth Military Medical University during the past six years, in order to improve the success rate of implant prosthesis and provide guidance for clinical application.

Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose.

A cross-sectional cohort study was conducted to investigate whether ghrelin level in obese women predicts the quality of life (QOL). A total of 307 subjects fulfilled the criteria: (1) age between 20 and 65 years old, (2) body mass index ≥27 kg/m 2 (3) waist circumference ≥80 cm were enrolled in the study. All subjects were assigned to one of the plasma ghrelin level categories according to the quartiles. The median of age and BMI of the 307 obese women were 45 ± 18 years and 29.9 ± 4.1 kg/m 2 , respectively. The main outcome evaluated is the associations of plasma ghrelin level and QOL, which were evaluated using multiple linear regression analysis. Results of linear trend test show significant statistical difference in plasma lipoproteins (triglyceride, cholesterol, HDL-cholestero and LDL-cholesterol = and levels of obesity-related hormone peptides, including leptin, adiponectin, insulin among quartiles of ghrelin. Multiple liner regression analysis of serum obesity-related hormone peptide level and QOL using stepwise method shows ghrelin concentration was the only predictor of QOL, including PCS-12 level (β = -0.18, p = 0.001), MCS-12 level (β = -0.14, p = 0.009), WHOQOL-BREF scores: physical (β = -0.13, p = 0.03), psychological (β = -0.16, p = 0.007), social (β = -0.21, p =  < 0.001), and environmental (β = -0.22, p =  <0.001), after adjusting other factors for obese female subjects. This study demonstrated that ghrelin concentration is strongly associated with QOL level among obese women. Hence, ghrelin concentration might be a valuable marker to be monitored in obese women.

Objective: This study was aimed to explore the role of long noncoding RNA (lncRNA) AB073614 and its potential mechanisms in the glioma development., Materials and Methods: Expression levels of lncRNA AB073614 in glioma tissues and glioma cell lines were evaluated by quantitative real-time PCR (qRT-PCR). MTT assays were conducted to explore the impact of AB073614 down-regulation on the proliferation of human glioma cells. The effects of AB073614 knockdown on cell proliferation and migration were evaluated by in vitro assays. EMT-related molecular markers expression level was detected by qRT-PCR assay and Western blot analysis., Results: We confirmed that AB073614 was significantly upregulated in glioma tissues and cell lines (p < 0.01). In vitro studies demonstrated that knockdown of AB073614 inhibits U251 cell proliferation and migration. Moreover, knockdown of AB073614 could inhibit epithelial-mesenchymal transition (EMT) phenotype in glioma cells., Conclusions: AB073614 functions as a tumor promoter in glioma. This finding may provide a therapeutic approach for future treatment of glioma.

Lymphangioleiomyomatosis (LAM) is a rare multisystem disease occurring almost exclusively in premenopausal women and characterized by cystic lung destruction, abdominal tumors (renal angiomyolipomas (AML)), and involvement of the axial lymphatics (adenopathy, lymphangioleiomyomas). Serum vascular endothelial growth factor-D (VEGF-D), a lymphangiogenic factor, has been recently considered as a novel marker for LAM. Herein we report the diagnostic and differential diagnostic value of serum VEGF-D in LAM patients and evaluate the change of serum VEGF-D levels before and after treatment with sirolimus. The study group included 66 patients with LAM (47 definite LAM and 19 probable LAM based on European Respiratory Society guidelines), 14 patients with other polycystic lung diseases, and 20 healthy female controls. Serum VEGF-D levels were quantified by enzyme-linked immunoassay (ELISA). Serum VEGF-D levels were significantly increased in definite LAM patients compared with healthy controls (3890.3±373.3 pg/ml vs. 413.3±33.2 pg/ml, p<0.05). The optimal cutoff point for LAM diagnosis was 692.5 pg/ml with sensitivity of 97.9% and specificity of 100%. In probable LAM patients, serum VEGF-D levels were all greater than 692.5 pg/ml. Serum VEGF-D levels were significantly increased in definite LAM patients who had chylothorax compared with those without chylothorax (5153.9±598.3 pg/ml vs. 2869.8±372.8 pg/ml, p<0.05). But serum VEGF-D levels in LAM patients with/without pneumothorax, AML, and lymphangioleiomyomas were not significantly changed. Serum VEGF-D levels in definite LAM patients and patients with other cystic lung diseases were 3890.3±373.3 pg/ml and 412.6±27.5 pg/ml, respectively (p <0.05). We determined an optimal cutoff value of 688.5pg/ml, resulting in sensitivity of 97.9% and specificity of 100%. Following a median of 12-month treatment with sirolimus, serum VEGF-D levels decreased from 3135.0±909.4 pg/ml to 1731.8±621.2 pg/ml and symptoms improved. Our study found that serum VEGF-D levels were significantly higher in LAM patients compared with healthy controls and patients with other polycystic lung diseases and that the levels were further increased when complicated by chylothorax. Serum VEGF-D levels may be useful for diagnosis and differential diagnosis with high specificity and sensitivity as well as for following treatment response with sirolimus.

To date, no study has investigated the association between CYP1A2-163C/A polymorphism and bladder cancer risk in a Chinese population. Here, we extracted genomic DNA from peripheral white blood cells, and differentiated CYP1A2 alleles by polymerase chain reaction-based restriction fragment length polymorphism methods. Differences in genotype frequencies between the cases and controls were evaluated using a chi-square test. The odds ratio (OR) and its 95% confidence interval (CI) were calculated using an unconditional logistic regression model. This revealed that the -163A allele was present at a significantly increased frequency in bladder cancer patients compared to healthy controls (44.10 vs 22.25%, P < 0.001). The prevalence of CC genotype, CA genotype, and AA genotype was 34.91, 41.98, and 23.11% in bladder cancer patients, and 64.00, 27.50, and 8.5% in the controls, respectively. Therefore, significant differences in the frequencies of -163 genotypes were found between bladder cancer patients and controls (P < 0.001). We found that the AA genotype was significantly associated with increased bladder cancer risk (OR = 3.72; 95%CI = 1.55-7.16; P = 0.02), and the -163A carriers were at increased risk of bladder cancer in a multivariate COX regression model (OR = 4.89, 95%CI = 2.78-10.87, P = 0.01). We conclude that the CYP1A2-163C/A polymorphism is associated with increased susceptibility to bladder cancer in the Chinese population.

At present, dental implant technology with high chewing efficiency and good appearance in esthetics has been widely used. However, some problems may be found in the follow-up procedure of implant prostheses, and one of them is food impaction. This article discussed the causes of food impaction in the posterior region with implant prostheses and provided treatment strategies to this biological complication.

Objective: We tested whether injection of contrast medium via right or left arm would affect venous artifacts on head and neck multislice spiral computed tomography (CT) angiography., Patients and Methods: 326 patients were enrolled. Each patient was injected with 10 ml of contrast medium at 5 ml/sec. Time of peak contrast value plus an additional 1 sec was defined as delay time. Another 40 ml of contrast medium were injected with the same injection speed. The scanning area ranged from the aortic arch to the top of the head. Left and right forearms were used for intravenous injections of contrast medium in, respectively, 151 and 175 patients. Comparative analyses of image quality included determining contrast medium residues remaining in the superior vena cava, brachiocephalic vein, or subclavian vein, and comparisons of quality of three-dimensional CT angiography., Results: In 75% of head and neck angiographies, the delay time of the common carotid artery ranged from 16 to 22 sec. In 60% of the images, the quality was graded as excellent, with the left arm injection resulting in delay time of > 23 sec and the right arm delay time of > 18 sec. The CT imaging quality after contrast injections via left or right arms was statistically significant (p < 0.05). The image quality after right arm injection was better than after left arm injection., Conclusions: Intravenous injection of contrast medium via right arm reduces artifacts from contrast medium residues and improves the image quality of head and neck CT angiography.

Although a number of studies have shown that chemical hybridizing agents (CHAs) affect anther growth and regulate cell-cycle progression, little is known about the molecular and cellular mechanisms involved. Proliferating cell nuclear antigen (PCNA) is an essential factor in DNA replication, and in many other processes in eukaryotic cells. In this study, the open reading frame of TaPCNA, the PCNA in wheat (Triticum aestivum L.), was cloned by reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis revealed that this gene was 792-bp long and encoded a protein with 234 amino acids. Alignment of the TaPCNA-predicted sequence revealed a high degree of identity with PCNAs from other plant species. A subcellular localization assay indicated that TaPCNA was localized in the nucleus. The TaPCNA was cloned into the prokaryotic expression plasmid pET32a, and the recombinant plasmid was transformed into BL21 (DE3). TaPCNA expression was induced by 0.5 mM isopropyl-beta-D-thiogalactopyranoside and verified using sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blot assays, which indicated that the fusion protein was successfully expressed. The gene involved in the G1-to-S transition, Histone H4, was downregulated by 1376- CIMS, which is a chemically induced male sterility line. However, a semi-quantitative RT-PCR revealed that TaPCNA expression was upregulated in 1376-CIMS. Our results suggest that CHAs (SQ-1) induce DNA damage in wheat anthers. DNA damage results in either the delay or arrest of cell-cycle progression, which affects anther development. This study will help to elucidate the mechanisms of SQ-1-induced male sterility.

A facile fabrication of flower-shaped porphyrin Janus colloids with oriented arrangement was demonstrated based on the interfacial assembly and water droplet template. The as-fabricated colloidal crystals from flower-shaped Janus particles show a special optical signal produced from the hierarchical structures.

Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 10 4 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.

SFTS virus (SFTSV) is a novel bunyavirus that causes severe fever with thrombocytopenia syndrome (SFTS), an emerging infectious disease that occurred in China in recent years, with an average case fatality rate of 10-12%. Intervention in the early clinical stage is the most effective measure to reduce the mortality rate of disease. To elucidate the natural course of and immune mechanisms associated with the pathogenesis of SFTSV, 59 laboratory-confirmed SFTS patients in the acute phase, who were hospitalized between October 2010 and September 2011, were enrolled in this study, and the patients sera were dynamically collected and tested for SFTSV viral RNA load, 34 cytokines or chemokines and other related laboratory parameters. All clinical diagnostic factors in the acute phase of SFTS were evaluated and assessed. The study showed that the severity of the disease in 11 (18.6%) patients was associated with abdominal pain (p 0.007; OR = 21.95; 95% CI, 2.32-208.11) and gingival bleeding (p 0.001; OR=122.11; 95% CI, 6.41-2328). The IP-10, TNF-α, IL-6, IL-10, granzyme B and HSP70 levels were higher over the 7-8 days in severe cases, accompanied by altered AST, CK and LDH levels. HSP70 (p 0.012; OR=8.29; 95% CI, 1.58-43.40) was independently correlated with the severity of the early acute phase of SFTSV infection. The severity of SFTS can be predicted based on the presence of symptoms such as abdominal pain and gingival bleeding and on the level of HSP70 in the acute phase of the disease., (© 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.)

Angular-type pyranocoumarins (APs), the derivatives of khellactone, are widely documented as the main active constituents in Peucedani Radix (Chinese name: Qian-hu). Owing to the natural occurrence of chiral centers, enantiomers of APs are extensively distributed in the original plant, and enantioselective performances have been definitely demonstrated for these enantiomers. In current study, the chemical characterization of the major and minor APs in Peucedani Radix was performed using ultra high performance liquid chromatography coupled with diode array detector and hybrid ion trap-orbitrap mass spectrometry. On the other hand, a heart-cut two-dimensional achiral-chiral liquid chromatography combining triple quadropole-linear ion trap mass spectrometry system (2D LC-MS/MS) was developed for simultaneous enantiospecific quantification of eighteen coumarins, including seven pairs of enantiomers. Eleven APs (1-11) were recruited to propose UV absorption characteristics and electrospray ionization fragmentation patterns of APs. A total of 42 components were categorized into APs based on their UV spectral properties and identified according to the proposed mass fragmentation pathways, while two linear-type furanocoumarins (12-13) were unambiguously assigned by further purification. A Capcell core RP-C18 column was employed in the primary LC dimension to achieve efficient racemic separation for the main chemical constituents (1-9 and 12-13) in Peucedani Radix, while a Chiralpak AD-RH column was utilized in the secondary dimension to contribute enantioselective separation for seven enantiomerically enriched components (1, 3 and 5-9). Collectively, the results provided the chemical evidences for revealing the material basis of the therapeutic effects of Peucedani Radix, and the developed 2D LC-MS/MS system in the present study is expected to be an ideal tool for the quality control of Peucedani Radix as well as a reliable technique for complex matrices containing both achiral and chiral components., (Copyright © 2014. Published by Elsevier B.V.)

Purpose: To perform a systematic review and meta-analysis to define the role of procalcitonin (PCT) in identifying infectious complication in organ transplant recipients., Methods: We searched EMBASE, MEDLINE, the Cochrane database, and reference lists of relevant articles, with no language restrictions, published from inception through May 2013. We selected original research that reported the diagnostic performance of PCT alone or when compared with other biomarkers to diagnose infectious complication among organ transplant recipients. We summarized test performance characteristics with the use of forest plots, hierarchical summary receiver operating characteristic curves, and bivariate random-effects models., Results: We found 7 qualifying studies (studying 1226 episodes of suspected infection with 186 confirmed infectious episodes) from 4 countries. The patients were lung, kidney, liver, and heart transplant recipients. Bivariate pooled sensitivity, specificity, positive likelihood ratios, and negative likelihood ratios for identification of bacterial infections in patients after transplantation were 85% (95% confidence interval [CI], 75%-92%), 81% (95% CI, 72%-88%), 4.41 (95% CI, 2.86-6.81), and 0.18 (95% CI, 0.10-0.33), respectively. Of the 4 studies that reported the experience of liver transplant patients, the pooled sensitivity, specificity, positive likelihood ratios, and negative likelihood ratios were 90% (95% CI, 75%-97%), 85% (95% CI, 77%-91%), 6.12 (95% CI, 3.79-9.88), and 0.11 (95% CI, 0.04-0.32), respectively. There was no evidence of significant heterogeneity., Conclusion: The existing literature suggests reasonable sensitivity and specificity for the PCT test in identifying infection complications among patients undergoing solid organ transplantation. Given the imperfect sensitivity and specificity of the PCT test, medical decisions should be based on both PCT test results and clinical findings., (Copyright © 2014 Elsevier Inc. All rights reserved.)

Aquaporin-1 (AQP1) is the principle water channel in the peripheral nervous system (PNS) and is specifically localized to Schwann cells in the PNS. However, the pathophysiological role of AQP1 in peripheral nerves is poorly understood. Here, we utilized RNA interference by lentiviral transduction to specifically down-regulate AQP1 expression and a lentiviral overexpression protocol to up-regulate AQP1 expression, in primary Schwann cell cultures. AQP1 gene silencing resulted in a cell shrinkage phenotype, while AQP1 gene overexpression caused a cell swelling phenotype, as validated by cell volume determinations. Secondly, we utilized an in vitro hypoxia model in Schwann cells to mimic in vivo facial nerve injury. We demonstrated that AQP1 expression was induced within 8h following hypoxia injury in vitro, and that AQP1 knockdown (KD) caused the cells to resist edema following hypoxia. Finally, we investigated the hypoxic regulation of the AQP1 gene, as well as the involvement of Hypoxia-inducible factor-1α (HIF-1α) in AQP1 modulation and we found that KD of HIF-1α decreased hypoxia-dependent induction of endogenous AQP1 expression at both the mRNA and protein levels. Taken together, these results indicate that (1) AQP1 is an important factor responsible for the fast water transport of cultured Schwann cells and is involved in cell plasticity; (2) AQP1 alterations may be a primary factor in hypoxia-induced peripheral nerve edema; (3) HIF-1α participates in the hypoxic induction of the AQP1 gene; (4) AQP1 inhibition might provide a new therapeutic alternative for the treatment of some forms of peripheral nerve edema., (Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.)

Aims: The innate immune-receptor nucleotide oligomerization domain (NOD) protein recognizes intracellular bacterial peptidoglycan. Activation of the innate immune system contributes to the development and progression of insulin resistance. The present study aimed to determine the presence of NOD1 and NOD2 in human adipose cells as well as to assess their functionality., Methods: Subcutaneous abdominal fat from obese subjects was biopsied and characterized for NOD expression using quantitative real-time PCR (qPCR). Human adipocytes were stimulated with iE-DAP (NOD1-specific ligand), and NOD1, proinflammatory cytokine production and nuclear factor (NF)-κB activation were quantified using qPCR, enzyme-linked immunosorbent assay (Elisa) and luciferase assay. Insulin-stimulated glucose uptake was determined by measuring 2-deoxy-D-[(3)H] glucose uptake. Expression and phosphorylation of IRS-1, Akt and JNK were evaluated using Western blotting., Results: NOD1/NOD2 mRNA expression was induced during adipocyte differentiation and enhanced in human adipose depots. Stimulation of isolated human adipocytes with iE-DAP induced NF-κB p65 nuclear translocation and a marked increase in proinflammatory cytokine production, including MCP-1, IL-6 and IL-8. NOD1 activation weakened insulin signal transduction as revealed by increased JNK and IRS-1 Ser307 phosphorylation, inhibited IRS-1 tyrosine phosphorylation, and reduced insulin-induced phosphorylation of Akt on Ser473 and Thr308 in human adipocytes. Moreover, NOD1 activation reduced insulin-induced glucose uptake, leading to insulin resistance., Conclusion: These results suggest that NOD1 signaling could be one of the links between innate immunity and insulin resistance in human adipocytes. This study provides supporting evidence for NOD1 protein as a component of innate immunity involved in insulin resistance., (Copyright © 2012 Elsevier Masson SAS. All rights reserved.)

(±)-Praeruptorin A (PA) is the major component of Peucedani Radix. The present study investigated stereoselectivity in PA metabolism in liver microsomes of rats (RLMs) and humans (HLMs), for the first time. PA was enantioseparated by semi-preparative chiral HPLC. Metabolic profiles of the dextrorotatory (dPA) and the levorotatory (lPA) forms in HLMs and RLMs were determined using LC-MS/MS. (-)-cis-Khellactone (D1) prepared from basic hydrolysis of dPA, and (3'R, 4'R)-4'-angeloyl-khellactone (L8) and (3'R, 4'R)-3'-angeloyl-khellactone (L9) isolated from a scale-up incubation of lPA with rat plasma were unambiguously identified by LC-MS/MS and NMR analysis. Other metabolites were tentatively identified using LC-MS/MS. In the absence of NADPH-regenerating system, dPA remained intact, however, lPA yielded L8 and L9 via a carboxylesterase(s)-mediated process. In the presence of NADPH-regenerating system, lPA produced 9 (L1-9) metabolites in both species, while dPA generated 12 (D1-12) and 6 (D1-3, 6, 9 and 10) metabolites in RLMs and HLMs, respectively. Hydrolysis, oxidation and acyl migration were demonstrated to be the predominant pathways for both enantiomers. Both enantiomers were eliminated faster in RLMs than in HLMs, while lPA showed greater species difference. PA enantiomers exhibited stereoselective metabolism in RLMs and HLMs, implying chiral discrimination in their actions.