Search

Resumo O objetivo deste artigo é avaliar a prevalência e fatores associados aos Transtornos Mentais Comuns (TMC) em quilombolas residentes em comunidades rurais localizadas no norte de Minas Gerais, Brasil. Trata-se de estudo transversal realizado em 2019 a partir de entrevistas estruturadas e aplicação do Self Reporting Questionnaire (SRQ-20). Foi conduzida regressão logística binária. A prevalência de TMC foi de 38,7%. Houve maior chance de TMC entre quilombolas do sexo feminino (OR: 2,69; IC95% 2,00-3,62), com 1 a 8 anos de estudo (OR: 1,70; IC95% 1,15-2,51), renda familiar entre 1 a 1,5 salário mínimo (OR: 2,51; IC95% 1,60-3,94); que sofreram discriminação em serviços de saúde (OR: 2,44; IC95% 1,44-4,13); com autorrelato de doença pulmonar (OR: 2,10; IC95% 1,25-3,54), doença cardíaca (OR: 1,58; IC95% 1,01-2,50) e insuficiência renal crônica (OR: 1,97; IC95% 1,08-3,94), e com autopercepção de saúde negativa (OR: 3,07; IC95% 2,31-4,07). A alta prevalência de TMC observada neste estudo demonstra a necessidade de políticas de atenção à saúde mental voltadas para as populações vulnerabilizadas, como as comunidades quilombolas, a fim de mitigar o sofrimento mental e favorecer uma atenção profissional contextualizada com as singularidades das condições de vida e saúde desse grupo populacional.

Background Telmisartan is a non-peptide angiotensin II receptor antagonist which acts by ACE/AngII/AT1 axis blockade (ARB). In the last years increasing evidence of its metabolic benefits pointed out this drug as the most promising ARB for nonalcoholic fatty liver disease (NAFLD) treatment. The aim of the present study was to investigate the Telmisartan effect on treating NAFLD in mice fed with a high-fat diet evaluating liver gene modulation. Twenty-four male mice were divided into four groups and fed for 60 days with a standard diet (ST), standard diet plus TEL (ST+TEL 5 mg/kg/day by gavage for 4 weeks), high-fat diet (HFD), or high-fat diet plus TEL (HFD+TEL 5 mg/kg/day by gavage for 4 weeks). Body weight, lipid profile, insulin, alanine transaminase, and aspartate aminotransferase were evaluated. Liver histology was analyzed. US imaging was performed to access liver dimension and echogenicity and also epididymal fat pad thickness. The expression of proinflammatory resistin/TRL4/MYD88 pathway was analyzed. Results The main findings showed that TEL reduced the resistin, TRL4, and Myd88 liver expression in the HFD + TEL group when compared to the obese control group (HFD). Decreased hepatic steatosis in the HFD + TEL group demonstrated by US measurements of the liver longitudinal axis and echogenicity were observed. In addition, TEL reduced epididymal adipose pad thickness, body weight, transaminases, and improved glucose tolerance test and HDL cholesterol. Conclusions We observed that Telmisartan treatment improved metabolism, decreasing NAFLD. Graphical Abstract Telmisartan improves metabolic and lipid profile and liver steatosis of obese mice

Resumo A atividade física é um comportamento complexo e influenciado por variáveis sociodemográficas e clínicas. A melhor compreensão desses fatores possibilita considerar a associação deles com a atividade física. O objetivo deste estudo foi estimar os efeitos do nível socioeconômico, idade, gordura corporal e sintomas depressivos na frequência de atividade física entre adultos. Trata-se de um estudo transversal de base populacional conduzido com 808 indivíduos. Foram avaliadas as inter-relações entre as variáveis nível socioeconômico, idade, gordura corporal e sintomas depressivos no nível de atividade física total, por meio da técnica “path analysis”. Observou-se efeito direto negativo e significativo da idade (β = -0,113; p < 0,004) nos níveis de atividade física. A idade (β = 0,376; p < 0,001) influenciou a gordura corporal, com efeito positivo e significativo. Os sintomas de depressão foram influenciados negativamente pelo nível socioeconômico (β = -0,126; p < 0,001) e positivamente pela idade (β = 0,244; p < 0,001) e gordura corporal (β = 0,169; p < 0,004). O nível socioeconômico, a gordura corporal e os sintomas depressivos não influenciaram diretamente os níveis de atividade física. Concluindo, os resultados mostraram que o avançar da idade contribui para a redução da prática de atividade física. Abstract Physical activity is a complex behavior influenced by sociodemographic and clinical factors. A better understanding of the relationships between these factors is essential to better understanding their influence on physical activity. The objective of this study was to examine the association between socioeconomic status, age, body fat, and depressive symptoms and level of physical activity among adults. We conducted a cross-sectional population-based study with 808 individuals to examine the interrelations between the above factors and their influence on level of physical activity using path analysis. Age had a significant direct negative effect on level of physical activity (β = -0.113, p < 0.004) and a significant positive effect on body fat (β = 0.376, p < 0.001). Depressive symptoms were negatively influenced by socioeconomic status (β = -0.126, p < 0.001) and positively influenced by age (β = 0.244, p < 0.001) and body fat (β = 0.169; p < 0.004). Socioeconomic status, body fat and depressive symptoms did not directly influence level of physical activity. This study concludes that level of physical activity declines with advancing age.

Os homens quilombolas exercem atividades produtivas que exigem grande força física, em ambientes propiciadores de diversos riscos, acidentes e agravos à saúde. O objetivo deste estudo foi cartografar os processos de trabalho de homens quilombolas em três territórios da região Norte de Minas, no Estado de Minas Gerais, Brasil. Para sua construção, utilizamos o referencial metodológico da Cartografia proposto pelos filósofos Gilles Deleuze & Félix Guattari. Os dados foram produzidos por meio da observação dos processos de trabalho, entrevistas individuais e registros das afetações em um diário cartográfico. A Análise de Discurso possibilitou a elaboração de um fluxograma descritor e a definição de três categorias temáticas. Nos territórios rastreados, a intersecção de gênero, raça e classe colabora diretamente para a execução de atividades na carvoaria, pedreira e bananal. Esses ambientes são altamente insalubres, com presença de calor e fumaça, métodos que geram grande esforço físico e poeira de sílica, exposição excessiva ao sol e uso de agrotóxicos. A integração entre a vigilância em saúde do trabalhador (VISAT) e o Ministério Público do Trabalho permite a articulação de uma rede intersetorial de educação popular, assistência técnica, qualificação e capacitação profissional. Essas medidas terão impacto direto no processo saúde-doença, na qualidade de vida dos trabalhadores e na preservação ambiental dos territórios cartografados.

Introduction: Patient-centered care has been associated with positive results in medical practice. Objective: The aim of this study was to evaluate the attitudes of students and teachers from a Brazilian medical school regarding the physician-patient relationship and verify associated factors. Methods: This was an analytical cross-sectional study carried out in a public university, using the PPOS “Patient-Practitioner Orientation Scale” as well as a sociodemographic questionnaire. The subjects were regularly enrolled students attending the second semester of 2015 and their teachers. Mann-Whitney and Kruskal-Wallis tests were used to examine the effect of sociodemographic variables and the interaction with the scores found for students and teachers. Results: A total of 212 students were surveyed, corresponding to 57.1% of the enrolled students in the medical course. The value of the total PPOS score found for the students was 4.35 (± 0.5 SD), and the mean total score of PPOS among female students (4.43) was significantly higher than that in males (4.23) (p < 0.001), indicating more patient-centered attitudes in that group. Regarding medical teachers, 77 (56%) participated. The total score of PPOS was 4.52 (± 0.5 SD), with a more patient-centered attitude among teachers in comparison to students (4.35) (p = 0.001). However, there is a clear need for progress in both groups. Conclusion: The analysis of the students’ and teachers’ attitudes about the physician-patient relationship disclosed an unknown scenario, with more patient-centered attitudes verified among teachers despite the need for improvements by both. Further research is needed to evaluate not only the attitude but the behavior of these subjects. Resumo: Introdução: O cuidado centrado no paciente tem sido associado a resultados positivos. Objetivo: o objetivo deste estudo foi avaliar atitudes de estudantes e professores de uma faculdade de medicina brasileira quanto à relação médico-paciente e verificar fatores associados. Métodos: Trata-se de um estudo transversal analítico realizado em uma universidade pública, utilizando a PPOS - “Patient-Practitioner Orientation Scale” e um questionário sociodemográfico. Os sujeitos eram estudantes do curso de medicina e professores da instituição em questão no segundo semestre de 2015. Os testes de Mann-Whitney e Kruskal-Wallis foram utilizados para examinar o efeito das variáveis sociodemográficas e a interação com os escores encontrados para estudantes e professores. Resultados: Foram pesquisados 212 estudantes, correspondendo a 57,1% dos acadêmicos matriculados no curso de medicina. O valor do escore total da PPOS encontrado para os estudantes foi de 4,35 (± 0,5 DP), e o escore total médio da PPOS entre estudantes do sexo feminino (4,43) foi significativamente maior do que o masculino (4,23) (p

Faculty Development seeks to support educators in a range of functions in the areas of teaching, research, extension, management and evaluation. The aim of this study was to evaluate faculty development based on the social representations constructed by the teachers of a medical course. A qualitative survey was carried out, using the analytical method of discourse analysis and social representation as a theoretical contribution. Twelve teachers were randomly selected, and a semi-structured interview was conducted for the data collection. The responses, recorded in audio, were transcribed and discourse analysis was performed with the aim of mapping the social representations constructed by the subjects. The social representations were grouped into two categories: institutional development and personal development. Within the category institutional development, three subcategories were identified: Guiding principles of Faculty Development Programs, Teaching-learning strategies used in Faculty Development Programs, and Skills to be developed by faculty. Within the category Personal development, two subcategories were identified: Development as a person and as a social being, and Professional development. Over the years, a variety of social representations have been constructed in relation to the nature of teaching in medical education, but it is only in recent decades that managers and teachers of educational institutions have begun to focus more closely on this topic. In the present study, it was observed that for faculty development to be effective, the educator must have a desire to learn; however, institutional support and recognition are also essential. Faculty Development Programs must be flexible and adaptable, to meet the needs of the institution and its professors, and encourage reflection on their practices, though the exchange of experiences, the development of interpersonal relationships, and collaboration. However, it is vital to identify and facilitate the development of leadership skills, and to systematically evaluate the process and the results achieved. This will encourage teachers to develop in their academic careers and thereby increase the professionalization of teaching. Managers and teachers can sustain a shared mission to win resources, adapt to change, strive for excellence in the leadership of the organization in a national and international context, and consequently, provide a quality medical education.

The objective of this study was to evaluate the actions offered in the Teacher Development Program from the perceptions of the teachers of the medical course of a public university that has been working with active teaching and learning methods since 2002. After each action of the program, an evaluation instrument was applied to the participants, and the answers were submitted to content analysis and then organized into three categories: infrastructure and logistics, the teaching-learning strategies and the developed content. Teachers highlight the importance of organization and planning of activities and the environment in which these actions are developed; they emphasize the importance of using teaching-learning strategies that allow greater reflection on own practice and the integration of theory and practice. They point out that the themes proposed were timely and necessary, they recognize the importance of being in development, they talk about the motivation from the experiences lived. It is concluded that the Teacher Development is a process through which the teacher is in transformation, through a conscious and constant reflection of his own practice. This process can be promoted by institutional investments and by the regulatory mechanisms of institutions, constituted of an evaluation referenced in objective indicators, consistent with the goals to be achieved. In this sense, it is necessary to invest in permanent education, because long-term programs allow the development of the teacher´s and the institution´s needs. O objetivo deste estudo foi avaliar as ações oferecidas em um Programa de Desenvolvimento Docente a partir da percepção dos professores do curso de medicina de uma universidade pública que utiliza métodos ativos de ensino-aprendizagem desde 2002. Após cada ação do programa, um instrumento de avaliação foi aplicado aos participantes, e respostas foram submetidas à análise do conteúdo e em seguida foram organizadas em três categorias: infraestrutura e logística, estratégias de ensino-aprendizagem utilizadas, e conteúdo desenvolvido. Os professores destacam a importância da organização e planejamento das atividades e do ambiente em que essas ações se desenvolveram; Enfatizam a importância de utilizar estratégias de ensino-aprendizagem que possibilitem maior reflexão sobre a própria prática e a integração da teoria e a prática. Apontam que os temas propostos foram oportunos e necessários, reconhecem a importância de estarem em desenvolvimento, falam sobre a motivação a partir das experiências vivenciadas. Conclui-se que o Desenvolvimento Docente é um processo pelo qual o professor está em transformação, por meio de uma reflexão consciente e constante de sua própria prática. Esse processo pode ser promovido pelos investimentos institucionais e pelos mecanismos reguladores das instituições constituídos por uma avaliação referenciada em indicadores objetivos, coerentes com as metas a serem alcançadas. Nesse sentido, é necessário investir na educação permanente, pois os programas em longo prazo permitem trabalhar as necessidades do professor e da instituição. El objetivo de este estudio fue evaluar las acciones ofrecidas en un Programa de Desarrollo Docente a partir de la percepción de los profesores del curso de medicina de una universidad pública que utiliza métodos activos de enseñanza - aprendizaje desde 2002. Después de cada acción del programa, un instrumento de evaluación se aplicó a los participantes, y las respuestas se sometieron al análisis del contenido y luego se organizaron en tres categorías: infraestructura y logística, estrategias de enseñanza - aprendizaje utilizadas, y contenido desarrollado. Los profesores destacan la importancia de la organización y planificación de las actividades y del ambiente en que esas acciones se desarrollaron; Enfatizan la importancia de utilizar estrategias de enseñanza - aprendizaje que posibiliten una mayor reflexión sobre la propia práctica y la integración de la teoría y la práctica. Se señalan que los temas propuestos fueron oportunos y necesarios, reconocen la importancia de estar en desarrollo, hablan sobre la motivación a partir de las experiencias vivenciadas. Se concluye que el Desarrollo Docente es un proceso por el cual el profesor está en transformación, por medio de una re?exión consciente y constante de su propia práctica. Este proceso puede ser promovido por las inversiones institucionales y por los mecanismos reguladores de las instituciones constituidos por una evaluación referenciada en indicadores objetivos, coherentes con las metas a ser alcanzadas. En este sentido, es necesario invertir en la educación permanente, pues los programas a largo plazo permiten trabajar las necesidades del profesor y de la institución.

O estudo mapeou as condições de trabalho de homens quilombolas residentes no norte do estado de Minas Gerais, Brasil. Utilizou-se o método cartográfico proposto por Gilles Deleuze e Félix Guattari. Os dados foram produzidos em 23 comunidades, por meio de entrevistas individuais, observação de campo e registro das afetações em um diário. A análise de discurso possibilitou a construção de três categorias temáticas e a elaboração de um fluxograma descritor das linhas de força do trabalho. A intersecção de raça/etnia, gênero, região, classe e escolaridade colabora para a precariedade e informalidade ocupacional. No trabalho, as linhas flexíveis permitem vivências de prazer e as linhas duras, o desenvolvimento de adoecimento mental. Nesse sentido, as políticas públicas focadas nos quilombolas necessitam de articulação e fortalecimento pelo Estado, além do esforço para a participação de todos os atores envolvidos, principalmente os homens quilombolas. This study mapped the working conditions of Quilombola men living in the north of the State of Minas Gerais, Brazil using the cartographic method proposed by Gilles Deleuze and Félix Guattari. The data were produced in 23 communities using individual interviews, field observations and documentation of affectations in a diary. Discourse analysis enabled the construction of three thematic categories and a flow diagram depicting the lines of work force. The intersection between race/ethnicity, gender, region, class, and level of education contributes to employment precariousness and informality. With regard to work, the flexible lines allow experiences of pleasure and the hard lines lead to the development of mental illness. Policies directed at Quilombolas therefore need to be articulated and strengthened by the government and efforts are needed to promote the participation of all actors involved, especially Quilombola men. El estudio mapeó las condiciones de trabajo de hombres quilombolas residentes en el norte del Estado de Minas Gerais, Brasil. Se utilizó el método cartográfico propuesto por Gilles Deleuze y Félix Guattari. Los datos se obtuvieron en 23 comunidades, por medio de entrevistas individuales, observación de campo y registro de las afectaciones en un diario. El Análisis de Discurso posibilitó la construcción de tres categorías temáticas y la elaboración de un diagrama de flujo descriptor de las líneas de fuerza del trabajo. La intersección de raza/etnia, género, región, clase y escolaridad colabora para la precariedad e informalidad ocupacional. En el trabajo, las líneas flexibles permiten vivencias de placer y las líneas duras el desarrollo de la enfermedad mental. En ese sentido, las políticas públicas enfocadas en los quilombolas necesitan articulación y fortalecimiento por parte del estado, además del esfuerzo para la participación de todos los actores envueltos, principalmente los hombres quilombolas.

Introduction: Patient-centered care has been associated with positive results in medical practice. Objective: The aim of this study was to evaluate the attitudes of students and teachers from a Brazilian medical school regarding the physician-patient relationship and verify associated factors. Methods: This was an analytical cross-sectional study carried out in a public university, using the PPOS “Patient-Practitioner Orientation Scale” as well as a sociodemographic questionnaire. The subjects were regularly enrolled students attending the second semester of 2015 and their teachers. Mann-Whitney and Kruskal-Wallis tests were used to examine the effect of sociodemographic variables and the interaction with the scores found for students and teachers. Results: A total of 212 students were surveyed, corresponding to 57.1% of the enrolled students in the medical course. The value of the total PPOS score found for the students was 4.35 (± 0.5 SD), and the mean total score of PPOS among female students (4.43) was significantly higher than that in males (4.23) (p < 0.001), indicating more patient-centered attitudes in that group. Regarding medical teachers, 77 (56%) participated. The total score of PPOS was 4.52 (± 0.5 SD), with a more patient-centered attitude among teachers in comparison to students (4.35) (p = 0.001). However, there is a clear need for progress in both groups. Conclusion: The analysis of the students’ and teachers’ attitudes about the physician-patient relationship disclosed an unknown scenario, with more patient-centered attitudes verified among teachers despite the need for improvements by both. Further research is needed to evaluate not only the attitude but the behavior of these subjects.

To analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil.This was a cross-sectional study conducted in 2019 through structured interviews and waist circumference measurement; Poisson regression was used, separated by gender, to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and 95% confidence interval (95%CI).56.6% (95% CI 50.9;62.0) of the observed quilombolas presented abdominal obesity; in the adjusted analysis, among men, there was an association of the outcome with age ≥60 years old (60-69 years old: PR=2.52 - CI95% 1.33; 4.75), not being a smoker (PR=1.73 - 95%CI 1.17;2.55) and reported arterial hypertension (PR=1.42 - 95%CI 1.11;1.80), while in women, it was associated with age ≥50 years old (50-59 years old: PR=1.25 - 95% CI 1.01;1.54), smoking cessation (PR=1.26 - 95% CI 1.00; 1.58), consumption of chicken with skin (PR=1.09 - 95% CI 1.00;1.19) and hypertension (PR=1.22 - 95% CI 1.11;1.36).There was high prevalence of abdominal obesity among quilombolas. It was higher in the elderly, smokers, former smokers and those with hypertension.Analisar a prevalência de obesidade abdominal e fatores associados em comunidades quilombolas do norte de Minas Gerais, Brasil.Estudo transversal realizado em 2019, a partir de entrevistas estruturadas e mensuração do perímetro da cintura; empregou-se regressão de Poisson, separada por sexo, para calcular razões de prevalência (RP) da obesidade abdominal ajustadas pelas variáveis independentes e intervalo de confiança de 95% (IC95%).56,6% (IC95% 50,9;62,0) dos quilombolas observados apresentaram obesidade abdominal; na análise ajustada, entre homens, verificou-se associação do desfecho com idade de ≥60 anos (60-69 anos: RP=2,52 - IC95% 1,33;4,75), não ser tabagista (RP=1,73 - IC95% 1,17;2,55) e referir hipertensão arterial (RP=1,42 - IC95% 1,11;1,80), enquanto, nas mulheres, associou-se com idade ≥50 anos (50-59 anos: RP=1,25 - IC95% 1,01;1,54), ex-tabagismo (RP=1,26 - IC95% 1,00;1,58), consumo de frango com pele (RP=1,09 - IC95% 1,00;1,19) e hipertensão (RP=1,22 - IC95% 1,11;1,36).Encontrou-se prevalência de obesidade abdominal alta entre os quilombolas, maior nos idosos, hipertensos, fumantes e ex-fumantes.Analizar la prevalencia de obesidad abdominal y factores asociados en comunidades quilombolas del norte de Minas Gerais, Brasil.Estudio transversal realizado en 2019 a partir de entrevistas y medición de la circunferencia de la cintura; se utilizó la regresión de Poisson para calcular las razones de prevalencia (RP) de la obesidad abdominal ajustadas por variables independientes y un intervalo de confianza del 95% (IC95%).56,6% (IC95% 50,9;62,0) tenía obesidad abdominal; entre los hombres hubo una asociación del resultado con la edad ≥60 años (60-69 años: RP=2,52 - IC95% 1,33;4,75), no fumadores (RP=1,73 - IC95% 1,17;2,55) e hipertensión (RP=1,42; IC95% 1,11;1,80); en las mujeres, se asoció con la edad ≥50 años (50-59 años: RP=1,25 - IC95% 1,01;1,54), exfumadoras (RP=1,26 - IC95% 1,00;1,58), consumo de pollo con piel (RP=1,09 - IC95% 1,00;1,19) e hipertensión (RP=1,22 - IC95% 1,11;1,36).La prevalencia de obesidad abdominal fue alta entre quilombolas, y fue mayor en ancianos, hipertensos, fumadores y exfumadores.

Resumo Objetivo: investigar a condição de saúde bucal, o acesso a serviços odontológicos e fatores sociodemográficos associados a essa acessibilidade em idosos quilombolas rurais do norte do estado de Minas Gerais, Brasil. Método: trata-se de um estudo analítico e transversal de base populacional, no qual foi utilizada uma amostragem por conglomerados com probabilidade proporcional ao tamanho (n=406). A coleta de dados envolveu a realização de entrevistas estruturadas e exames clínicos odontológicos. Resultados: verificou-se que a maioria dos idosos possuía baixa renda e baixa escolaridade. Observou-se que parcela expressiva dos indivíduos relatou acesso a um cirurgião-dentista (97,5%) e que havia realizado a última consulta odontológica há três anos ou mais (60,4%). Foi verificado ainda que a maior parte dos idosos era edêntula (52,0%) e que a maioria dos pesquisados necessitava de próteses (88%). Um alto índice CPO-D foi constatado nos indivíduos estudados (valor médio de 27,25). Idade avançada, ausência de companheiro e aposentadoria se mostraram associadas ao acesso irregular aos serviços odontológicos. Conclusão: os idosos quilombolas locais possuíam uma condição precária de saúde bucal e tinham acesso restrito aos serviços odontológicos. Idade, estado conjugal e situação laboral demonstraram associação com baixa acessibilidade aos serviços de saúde bucal nos idosos investigados.

Objective: To verify the prevalence of common mental disorders and associated factors in nursing technicians. Method: Cross-sectional analytical study conducted at a university hospital. A questionnaire with sociodemographic, educational and work-related variables and the Self Reporting Questionnaire-20 were used to verify the presence of common mental disorders. Association analysis was performed using the chi-squared test, with a significance level of 5%. Results: 280 nursing technicians participated in the study. The prevalence of common mental disorders was 46.9%. The variables family income (p=0.021) and working exclusively in health area (p

Resumo Introdução Os exames integram o sistema de saúde e contribuem para o avanço da assistência. A sua solicitação pelos médicos deve ser realizada adequadamente, podendo ser influenciada por diferentes aspectos. Objetivo Desenvolver e validar um instrumento de avaliação de aspectos que influenciam a solicitação de exames. Método Trata-se de um estudo transversal e analítico que passou pelas seguintes etapas: 1) identificação dos aspectos que influenciam a solicitação de exames na prática médica; 2) verificação da validade aparente e validade de conteúdo; 3) verificação da validade de construto; 4) análise da confiabilidade; 5) verificação da validade discriminante, aplicada a 158 médicos de família e emergencistas no norte de Minas Gerais. Resultados O instrumento permaneceu com 36 itens, psicometricamente válidos, agrupados em cinco dimensões: particularidade pessoal do médico; estrutura e processos do sistema de saúde; características do paciente; preparo profissional; e dificuldade para a realização do exame. O instrumento apresentou validade aparente, validade de conteúdo, validade de construto, nível satisfatório de confiabilidade e validade discriminante. Conclusão O instrumento de avaliação dos aspectos que influenciam a solicitação de exames na prática médica tem a possibilidade de identificar a influência particular de cada aspecto e de cada dimensão que interfere na prática de solicitação de exames. Abstract Background Exams are part of the health system, and they contribute to the advancement of care. The request of exams by physicians must be performed properly, and can be influenced by different aspects. Objective Develop and validate an instrument to evaluate aspects that influence the request for exams. Method This is a cross-sectional, analytical study conducted in the following steps: 1) Identification of the aspects that influence the request for exams in medical practice; 2) Verification of apparent and content validity; 3) Verification of construct validity; 4) Reliability analysis; 5) Verification of discriminant validity applied to 158 family and emergency physicians in the north of Minas Gerais state. Results The instrument was composed of 36 psychometrically valid items grouped into five dimensions: particularity of the physician, structure and processes of the health system, characteristics of the patient, professional expertise, and difficulty conducting the exam. The instrument presented apparent and content validity, construct validity, satisfactory level of reliability, and discriminant validity. Conclusion The instrument to assess aspects that influence the request of exams in medical practice can identify the particular influence of each aspect and each dimension that interferes with the practice of requesting exams.

CNPq - Conselho Nacional de Desenvolvimento Científico e Tecnológico FAPEMIG - Fundação de Amparo à Pesquisa do Estado de Minas Gerais CAPES - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Non-alcoholic fatty liver disease (NAFLD) is currently considered an important component of metabolic syndrome (MetS). The spectrum of NAFLD includes conditions that range from simple hepatic steatosis to non-alcoholic steatohepatitis. NAFLD is correlated with liver-related death and is predicted to be the most frequent indication for liver transplantation by 2030. Insulin resistance is directly correlated to the central mechanisms of hepatic steatosis in NAFLD patients, which is strongly correlated to the imbalance of the renin–angiotensin system, that is involved in lipid and glucose metabolism. Among the emerging treatment approaches for NAFLD is the anti-hypertensive agent telmisartan, which has positive effects on liver, lipid, and glucose metabolism, especially through its action on the renin–angiotensin system, by blocking the ACE/AngII/AT1 axis and increasing ACE2/Ang(1–7)/Mas axis activation. However, treatment with this drug is only recommended for patients with an established indication for anti-hypertensive therapy. Thus, there is an increased need for large randomized controlled trials with the aim of elucidating the effects of telmisartan on liver disease, especially NAFLD. From this perspective, the present review aims to provide a brief examination of the pathogenesis of NAFLD/NASH and the role of telmisartan on preventing liver disorders and thus to improve the discussion on potential therapies.

Objective To evaluate the interrelations between adiposity, sociodemographic characteristics, and lifestyle of a Brazilian adult population. Methods We conducted a cross-sectional study with 808 individuals over 18 years. The structural equation model evaluated the interrelations between sociodemographic conditions, practice of physical activities and food intake in relation to adiposity. Results Age presented a positive and significant effect on adiposity (β = 0.41; p = 0.001) and food intake (β = 0.36; p Conclusion The present study found a significant association between the model's variables, with age advancement and female sex associated with high adiposity.

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.

Physical activity is a complex behavior influenced by sociodemographic and clinical factors. A better understanding of the relationships between these factors is essential to better understanding their influence on physical activity. The objective of this study was to examine the association between socioeconomic status, age, body fat, and depressive symptoms and level of physical activity among adults. We conducted a cross-sectional population-based study with 808 individuals to examine the interrelations between the above factors and their influence on level of physical activity using path analysis. Age had a significant direct negative effect on level of physical activity (β = -0.113, p0.004) and a significant positive effect on body fat (β = 0.376, p0.001). Depressive symptoms were negatively influenced by socioeconomic status (β = -0.126, p0.001) and positively influenced by age (β = 0.244, p0.001) and body fat (β = 0.169; p0.004). Socioeconomic status, body fat and depressive symptoms did not directly influence level of physical activity. This study concludes that level of physical activity declines with advancing age.A atividade física é um comportamento complexo e influenciado por variáveis sociodemográficas e clínicas. A melhor compreensão desses fatores possibilita considerar a associação deles com a atividade física. O objetivo deste estudo foi estimar os efeitos do nível socioeconômico, idade, gordura corporal e sintomas depressivos na frequência de atividade física entre adultos. Trata-se de um estudo transversal de base populacional conduzido com 808 indivíduos. Foram avaliadas as inter-relações entre as variáveis nível socioeconômico, idade, gordura corporal e sintomas depressivos no nível de atividade física total, por meio da técnica “path analysis”. Observou-se efeito direto negativo e significativo da idade (β = -0,113; p0,004) nos níveis de atividade física. A idade (β = 0,376; p0,001) influenciou a gordura corporal, com efeito positivo e significativo. Os sintomas de depressão foram influenciados negativamente pelo nível socioeconômico (β = -0,126; p0,001) e positivamente pela idade (β = 0,244; p0,001) e gordura corporal (β = 0,169; p0,004). O nível socioeconômico, a gordura corporal e os sintomas depressivos não influenciaram diretamente os níveis de atividade física. Concluindo, os resultados mostraram que o avançar da idade contribui para a redução da prática de atividade física.

CNPq - Conselho Nacional de Desenvolvimento Científico e Tecnológico FAPEMIG - Fundação de Amparo à Pesquisa do Estado de Minas Gerais CAPES - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Background: the complex pathophysiology of obesity includes low-grade chronic inflammation of white adipose tissue, an increase in plasma levels of pro-inflammatory cytokines as well as genetic factors, which have all emerged as important risk factors. Objective: evaluate the association between the TNFα-308G/A variant and sociodemographic, clinical and behavioral variables in an urban population using overall and central obesity as the measured outcome. Methods: a cross-sectional population-based study was conducted. Anthropometric measures and genotyping were assessed in 808 individuals. The associations were tested using the hierarchical theoretical model and multiple logistic regressions. Results: thirty-one percent of subjects were overweight while 19.4% were obese. No association was observed between genotype frequencies of TNFα-308G/A and either obesity or other variables of adiposity, including waist circumference, waist to height ratio, conicity index, and fat mass. However, age, gender, physical inactivity, and other comorbidities were associated with measures of excess adiposity in the hierarchical model. The phase angle of AA genotype was lower than GA and GG genotypes (p < 0.05). Conclusion: the rs1800629 SNP of the TNFA gene was not associated with the adiposity indicators evaluated in this based population study. However, AA genotype is more likely to have low cellular membrane integrity.

RESUMO Objetivou-se compreender a solicitação de exames por médicos na Atenção Primária à Saúde. Trata-se de estudo qualitativo, com médicos de família de Montes Claros (MG). Os dados foram obtidos por entrevista não estruturada e examinados via análise do discurso. A solicitação de exames é influenciada pela formação profissional, pelas características da Estratégia Saúde da Família - primeiro contato para as questões de saúde; realização do cuidado integral, continuado e coordenado pela equipe -, pela possibilidade de gerir o tempo de atendimento, pelo trabalho multiprofissional e pelas dificuldades enfrentadas - demanda dos pacientes por exames e pressão dos gestores por menos solicitações. ABSTRACT This is a qualitative study with family physicians from Montes Claros (MG), aimed at understanding the request for exams by physicians in Primary Health Care. Data were obtained by means of unstructured interviews and were examined through discourse analysis. The request for exams is influenced by professional education; by Family Health Strategy characteristics, the first contact on health issues; by carrying out integral and continued care, coordinated by the team; by the possibility of managing attendance duration; by multi-professional work; and by difficulties faced: demand for exams by the patients and pressure by managers for less requests.

Background Recent studies have shown a relationship between adiposity traits and a low-grade inflammation of adipose tissue resulting from chronic activation of the innate immune system as interleukin-1 beta (IL-1β). However, this association remains controversial. Besides, the Quilombola communities that have presumed different genetic background and it could change the obesity vulnerability. Objective To estimate the association between IL-1β and adiposity traits like obesity or abdominal obesity in Quilombola communities. A cross-sectional population-based study was conducted the northern region of Minas Gerais with the representative sample of 756 individuals aged ≥ 18 years. The swab oral was used for DNA extraction and the IL-1β rs1143634 polymorphism was evaluated by RFLP-PCR. The interviewed and measures were done using specific protocols. It was estimated to outcomes: the overweight (body mass index ≥ 25 kg/m2), abdominal obesity (waist circumference ≥ 88 cm for women and ≥ 102 cm for men), and the high conicity index (≥ 1.18 cm or women e ≥ 1.25 cm for men). Poisson regression multivariate models were constructed considering genotype and the outcomes, adjusted for socioeconomic and lifestyle variables. Results The distribution of IL-1β for the TT genotype was (11.9%), CT (25.1%) and CC (63.0%). The women TT carriers showed a higher regular soft drink consumption (p = 0.048). The height was lower in man TT carriers (p = 0.041) and lower weight (p = 0.025). The CT genotype showed higher BMI (p = 0.037). The CT and TT carriers showed less prevalence ratio to abdominal obesity even adjusted to socioeconomic and lifestyle variables, there no associations between genotype and overweight or high conicity index. Conclusions In conclusion, after socioeconomic and lifestyle adjustment T variant of rs1143634 is a protection factor for central obesity in Quilombola communities.

Resumo: Este estudo tem como objetivo compreender o significado de competência na percepção dos docentes dos módulos de Habilidades e Atitudes. Trata-se de uma pesquisa descritiva e exploratória. A escolha do referencial teórico e metodológico considerou a perspectiva hermenêutica. O estudo foi realizado em uma universidade pública com docentes do curso de Medicina, por meio de entrevista individual e não estruturada. Os dados foram submetidos à análise do discurso evidenciando as categorias empíricas: “Competência como eixo norteador e estruturante às necessidades educacionais”; “Docência na educação médica: a prática profissional possibilita habilidades” e “Estratégias para o desenvolvimento docente”. Considera-se que as mudanças requeridas no curso médico precisam encontrar apoio na gestão e na liderança dos professores, na implementação de um programa de desenvolvimento do corpo docente, que se tornará um valioso instrumento de reflexão para os educadores, a fim de melhorar o exercício da docência no curso médico. Abstract: This study aims to understand the meaning of competence in the perception of the teachers in the modules of Skills and Attitudes. It's a descriptive and exploratory research. The choice of the theoretical and methodological framework considered the hermeneutic perspective. The study was conducted in a public university in the medical school, through individual and unstructured interview. The data were submitted to discourse analysis showing the empirical categories, "Competence as a guiding and structuring axis to educational needs"; "The teaching in medical education: professional practice and enabling skills" and "Strategies for teacher development". It is considered that the required changes in medical school need to find support in the management and leadership of teachers in the implementation of a faculty development program, which will become a valuable tool of reflection for educators in order to improve exercise of teaching in the medical school.

Objetivo: Compreender a percepção e utilização da educação em saúde para o uso racional de medicamentos (URM) pelos médicos inseridos na atenção primária em saúde. Métodos: Tratou-se de pesquisa qualitativa, descritiva e exploratória, realizada em 2011, com sete médicos da Estratégia de Saúde da Família, por meio de entrevista individual semiestruturada. Dados foram analisados pela técnica de análise do conteúdo, emergindo três categorias temáticas e suas subcategorias: percepção do conceito de uso racional de medicamentos de forma parcial; percepção do conceito de educação em saúde de forma parcial; não valorização da potencialidade da utilização da educação em saúde no uso racional de medicamento. Resultados: Os resultados evidenciaram que a percepção dos médicos é fragmentada e dividida em conceitos relacionados aos profissionais, à enfermidade, ao medicamento e ao paciente e comunidade. Conclusão: A utilização da educação em saúde pelos médicos prioriza o modelo tradicional de educação em saúde, privilegiando a transmissão do conhecimento técnico-científico.

O programa de pós-graduação, no Brasil, traz novas perspectivas no âmbito educacional, social e científico, contribuindo para a formação de mestres e doutores. O objetivo desta pesquisa foi verificar como é realizada a avaliação dos programas de pós-graduação, buscando compreender o surgimento, desenvolvimento e aspectos atuais de tal avaliação, dando ênfase aos programas de pós-graduação da saúde. A metodologia utilizada foi uma revisão de literatura, em bases indexadas da literatura, no período de outubro a dezembro de 2013. Constatou-se que a exigência da pós-graduação, sendo frequente, em virtude das especificidades das áreas de atuação dos profissionais, está sendo avaliada de maneira satisfatória por órgãos como o Ministério da Educação (MEC) e a Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes), tendo qualidade satisfatória. Pode-se ainda depreender que embora tenha aumentado o investimento e a pesquisa na área da saúde, ainda há pouco crescimento em detrimento de áreas multidisciplinares e exatas.

The objective of this study was to evaluate the actions offered in the Teacher Development Program from the perceptions of the teachers of the medical course of a public university that has been working with active teaching and learning methods since 2002. After each action of the program, an evaluation instrument was applied to the participants, and the answers were submitted to content analysis and then organized into three categories: infrastructure and logistics, the teaching-learning strategies and the developed content. Teachers highlight the importance of organization and planning of activities and the environment in which these actions are developed; they emphasize the importance of using teaching–learning strategies that allow greater re?ection on own practice and the integration of theory and practice. They point out that the themes proposed were timely and necessary, they recognize the importance of being in development, they talk about the motivation from the experiences lived. It is concluded that the Teacher Development is a process through which the teacher is in transformation, through a conscious and constant reflection of his own practice. This process can be promoted by institutional investments and by the regulatory mechanisms of institutions, constituted of an evaluation referenced in objective indicators, consistent with the goals to be achieved. In this sense, it is necessary to invest in permanent education, because long-term programs allow the development of the teacher´s and the institution´s needs.ResumoO objetivo deste estudo foi avaliar as ações oferecidas em um Programa de Desenvolvimento Docente a partir da percepção dos professores do curso de medicina de uma universidade pública que utiliza métodos ativos de ensino-aprendizagem desde 2002. Após cada ação do programa, um instrumento de avaliação foi aplicado aos participantes, e respostas foram submetidas à análise do conteúdo e em seguida foram organizadas em três categorias: infraestrutura e logística, estratégias de ensino-aprendizagem utilizadas, e conteúdo desenvolvido. Os professores destacam a importância da organização e planejamento das atividades e do ambiente em que essas ações se desenvolveram; Enfatizam a importância de utilizar estratégias de ensino-aprendizagem que possibilitem maior reflexão sobre a própria prática e a integração da teoria e a prática. Apontam que os temas propostos foram oportunos e necessários, reconhecem a importância de estarem em desenvolvimento, falam sobre a motivação a partir das experiências vivenciadas. Conclui-se que o Desenvolvimento Docente é um processo pelo qual o professor está em transformação, por meio de uma re?exão consciente e constante de sua própria prática. Esse processo pode ser promovido pelos investimentos institucionais e pelos mecanismos reguladores das instituições constituídos por uma avaliação referenciada em indicadores objetivos, coerentes com as metas a serem alcançadas. Nesse sentido, é necessário investir na educação permanente, pois os programas em longo prazo permitem trabalhar as necessidades do professor e da instituição.ResumenEl objetivo de este estudio fue evaluar las acciones ofrecidas en un Programa de Desarrollo Docente a partir de la percepción de los profesores del curso de medicina de una universidad pública que utiliza métodos activos de enseñanza - aprendizaje desde 2002. Después de cada acción del programa, un instrumento de evaluación se aplicó a los participantes, y las respuestas se sometieron al análisis del contenido y luego se organizaron en tres categorías: infraestructura y logística, estrategias de enseñanza - aprendizaje utilizadas, y contenido desarrollado. Los profesores destacan la importancia de la organización y planificación de las actividades y del ambiente en que esas acciones se desarrollaron; Enfatizan la importancia de utilizar estrategias de enseñanza - aprendizaje que posibiliten una mayor reflexión sobre la propia práctica y la integración de la teoría y la práctica. Se señalan que los temas propuestos fueron oportunos y necesarios, reconocen la importancia de estar en desarrollo, hablan sobre la motivación a partir de las experiencias vivenciadas. Se concluye que el Desarrollo Docente es un proceso por el cual el profesor está en transformación, por medio de una re?exión consciente y constante de su propia práctica. Este proceso puede ser promovido por las inversiones institucionales y por los mecanismos reguladores de las instituciones constituidos por una evaluación referenciada en indicadores objetivos, coherentes con las metas a ser alcanzadas. En este sentido, es necesario invertir en la educación permanente, pues los programas a largo plazo permiten trabajar las necesidades del profesor y de la institución.Keywords: Educational development, Medical education, Professional development, Qualitative research.Palavras-chave: Desenvolvimento e educação, Formação médica, Desenvolvimento profissional, Pesquisa qualitativa.Palabras claves: Desarrollo y educación, Formación médica, Desarrollo profesional, Investigación cualitativa.ReferencesABID, Kauser. Faculty development: a need in time for educators in healthcare. J Pak Med Assoc, v. 63, n. 4, p. 428-431, Apr., 2013.ALMEIDA, Maria Tereza Carvalho; BATISTA, Nildo Alves. Ser docente em métodos ativos de ensino-aprendizagem na formação do médico. Rev Bras Educ Med, v. 35, n. 4, p. 468-476, julho, 2011.ALMEIDA, Maria Tereza Carvalho; MAIA, Fernanda Alves; BATISTA, Nildo Alves. Gestão nas escolas médicas e sustentabilidade dos programas de desenvolvimento docente. Avaliação: Revista da Avaliação da Educação Superior, v. 18, n. 2, p. 299-310, jul., 2013.ANDERSON, Winston A. et al. Changing the culture of Science Education at research universities. Science Education, v. 331, p.152-153, Jan., 2011.ARMSTRONG, Elizabeth G.; BARSION, Sylvia J. Creating “Innovator’s DNA” in Health Care Education. Academic Medicine, v. 88, n. 3, p. 342-348, Mar., 2013.ARMSTRONG, Elizabeth G.; DOYLE, Jennifer; BENNETT, Nancy L. Transformative professional development of physicians as educators: assessment of a model. Academic Medicine, v. 78, n. 7, p. 702-708, Jul., 2003.AUSUBEL, David Paul. A aprendizagem significativa: a teoria de David Ausubel. São Paulo: Moraes, 1982.BALMER, Dorene F.; RICHARDS, Boyd F. Faculty development as transformation: Lessons learned from a process-oriented program. Teaching and learning in medicine, v. 24, n. 3, p. 242-247, Jul., 2012.BARDIN, Laurence. Análise de conteúdo. 3ed. Lisboa: Almedina, 2004.CATE, Olle Ten et al. Faculty development through international exchange: The IMEX initiative. Medical teacher, v. 36, n. 7, p. 591-595, Jun., 2014.CECIM, Ricardo Burg. Educação permanente em saúde: desafio ambicioso e necessário. Interface – Comunicação, Saúde e Educação, v. 9, n. 16, p. 161-177, fev., 2005.CENTRA, John A. Types of faculty development programs. The Journal of Higher Education, v. 49, n. 2, p. 151-162, 1978.CHOU, Calvin L. et al. The Impact of a Faculty Learning Community on Professional and Personal Development: The Facilitator Training Program of the American Academy on Communication in Healthcare. Academic Medicine, v. 89, n. 7, p. 1051-1056, Jul., 2014.COSTA, Nilce Maria da Silva Campos. Docência no ensino médico: por que é tão difícil mudar?. Rev bras educ méd, v. 31, n. 1, p. 21-30, 2007.DEWEY, John. Experiência e Natureza - Lógica - a Arte Como Experiência - Vida e Educação - Teoria da Vida moral. 2 ed. São Paulo: Abril cultural, 1985.DONABEDIAN, Avedis. Evaluating physician competence. Bulletin of the World Health Organization, v. 78, n. 6, p. 857-860, 2000.EBRAHIMI, Sedigheh; KOJURI, Javad. Assessing the Impact of Faculty Development Fellowship in Shiraz University of Medical Sciences. Arch Iran Med, v. 15, n. 2, p. 79-81, Feb., 2012.FREIRE, Paulo. Pedagogia da autonomia: saberes necessários à prática educativa. São Paulo: Paz e Terra, 1996.GADAMER, Hans Georg. Verdade e Método: traços fundamentais de uma hermenêutica filosófica. Petrópolis: Vozes, 1999.HABERMAS, Jurgen. Conhecimento e interesse. Rio de Janeiro: Ed. Zahar, 1987.KIRKPATRICK, Donald L. Como implementar os quatro níveis de avaliação de treinamento de equipes: um guia prático. 1 ed, Rio de Janeiro: Artmed, 2010.KNIGHT, Amy M. et al. Long?Term Follow?Up of a Longitudinal Faculty Development Program in Teaching Skills. Journal of general internal medicine, v. 20, n. 8, p. 721-725, Aug., 2005.MOORE, Philippa. Logros más alla de los objetivos: evaluación cualitativa de un programa de formación en educación médica. Revista médica de Chile, v. 142, n. 3, p. 336-343, mar., 2014.MORAHAN, Page S.; FLEETWOOD, J. Do we really value what our faculty do? Academic Physician & Scientist, p. 7-9, Sep.-Oct., 2009.NÓVOA, António. Formação de professores e profissão docente. Lisboa: Publicações Dom Quixote. Cap. 1, p. 1-27. 1992.PELIZZARI, Adriana et al. Teoria da aprendizagem significativa segundo Ausubel. Revista PEC, v. 2, n. 1, p. 37-42, jul., 2002.PERRON, Noelle Junod et al. Impact of a faculty development program for teaching communication skills on participants’ practice. Postgraduate medical journal, v. 90, n. 1063, p. 245-250, Apr., 2014.SARIKAYA, Ozlem et al. The impact of a faculty development program: evaluation based on the self-assessment of medical educators from preclinical and clinical disciplines. Advances in physiology education, v. 34, n. 2, p. 35-40, Jun., 2010.SCHÖN, Donald. A. Formar professores como profissionais reflexivos. In: NÓVOA, Antônio. Os professores e sua formação. Lisboa: Dom Quixote. v. 2, p. 77-91, 1992.SIMPSON, Deborah et al. Fifteen years of aligning faculty development with primary care clinician–educator roles and academic advancement at the Medical College of Wisconsin. Academic Medicine, v. 81, n. 11, p. 945-953, Nov., 2006.SINGH, Tejinder et al. Impact of a fellowship program for faculty development on the self-efficacy beliefs of health professions teachers: A longitudinal study. Medical teacher, v. 35, n. 5, p. 359-364, Jun., 2013.STEINERT, Yvonne et al. A systematic review of faculty development initiatives designed to improve teaching effectiveness in medical education: BEME Guide No. 8. Medical teacher, v. 28, n. 6, p. 497-526, Sep., 2006.STEINERT, Yvonne et al. Faculty development as an instrument of change: A case study on teaching professionalism. Academic Medicine, v. 82, n. 11, p. 1057-1064, Nov., 2007.WILKERSON, LuAnn; IRBY, David M. Strategies for improving teaching practices: a comprehensive approach to faculty development. Academic Medicine, v. 73, n. 4, p. 387-396, Apr., 1998.

A qualidade de vida tornou-se uma importante medida de impacto em saúde. Sua avaliação relacionada às doenças e seus fatores de risco tem acrescido na população em geral. Objetivo: Verificar a qualidade de vida e a presença de associação com fatores de risco para as doenças crônicas não transmissíveis na população urbana do município de Montes Claros, Minas Gerais. Métodos: Estudo transversal de base populacional. A amostra foi calculada considerando-se a prevalência do fator de risco sobrepeso de 30% e corrigida para um efeito de delineamento de 30%. Amostragem por conglomerados de setores censitários urbanos. Sorteou-se 17 setores censitários e entrevistou-se 648 moradores de idade maior ou igual a 18 anos. Os fatores de risco para as doenças crônicas não transmissíveis foram verificadas e a qualidade de vida também através do SF-36. Resultados: Alguns dos fatores de risco foram associados a piores escores no questionário SF-36. Conclusão: a presença de alguns fatores de risco para as doenças crônicas tem impacto na qualidade de vida.

A qualidade de vida tornou-se uma importante medida de impacto em saúde. Sua avaliação relacionada às doenças e seus fatores de risco tem acrescido na população em geral. Objetivo: Verificar a qualidade de vida e a presença de associação com fatores de risco para as doenças crônicas não transmissíveis na população urbana do município de Montes Claros, Minas Gerais. Métodos: Estudo transversal de base populacional. A amostra foi calculada considerando-se a prevalência do fator de risco sobrepeso de 30% e corrigida para um efeito de delineamento de 30%. Amostragem por conglomerados de setores censitários urbanos. Sorteou-se 17 setores censitários e entrevistou-se 648 moradores de idade maior ou igual a 18 anos. Os fatores de risco para as doenças crônicas não transmissíveis foram verificadas e a qualidade de vida também através do SF-36. Resultados: Alguns dos fatores de risco foram associados a piores escores no questionário SF-36. Conclusão: a presença de alguns fatores de risco para as doenças crônicas tem impacto na qualidade de vida.Quality of life has become an important yardstick of the impact on health. Its evaluation related to diseases and associated risk factors has increased in the population in general. This article seeks to assess the quality of life and the presence of the association with risk factors for non-communicable chronic diseases in the urban population of the city of Montes Claros in the State of Minas Gerais. It is a population-based cross-sectional study. The sample was calculated considering the prevalence of risk factors of overweight of 30% and corrected for a variation of 30%. Cluster sampling was conducted on urban census sectors. Seventeen census sectors were selected and 648 residents aged e" 18 years were interviewed. The risk factors for non-communicable chronic diseases as well as the quality of life were verified using the SF-36 questionnaire. Some risk factors were associated with the lowest scores on the SF-36 questionnaire. The presence of some risk factors for chronic diseases has an impact on quality of life.

Background and Objective Recent evidence suggests that the use of fluoxetine could reduce periodontal disease severity. However, the effect of fluoxetine on periodontal disease has not been tested in the context of conditioned fear stress (CFS). We hypothesized that inhibition of chronic stress by fluoxetine might decrease the levels of bone loss in periodontal disease. The aim of the present study was to analyze the effect of fluoxetine on bone loss in chronic periodontitis. Material and Methods Fourteen Wistar rats were submitted to ligature-induced periodontal disease and divided into four groups (A–D). Groups A (n = 3) and B (n = 4) were not stressed, while Groups C (n = 3) and D (n = 4) were submitted to a CFS paradigm for 38 d. Daily fluoxetine (20 mg/kg) was administered to Groups B and D from day 20 to day 39, at which point the rats were submitted to an open field test and killed on day 40. Mandibles were removed for histological and immunohistochemical analyses. Results Stress was associated with a higher level of bone loss in Group C compared with Group A. Additionally, no differences in bone loss were observed among Groups A, B and D. Conclusion We showed that stress is associated with the progression of bone loss in a CFS model in rats and that fluoxetine treatment reduces the bone loss.

Trata-se de um estudo ecológico de tendência temporal, cujo objetivo é verificar a dinâmica populacional conforme os censos de 1980, 1991 e 2000 e o perfil de mortalidade no período entre 1996 e 2005, em Montes Claros (MG). Utilizou-se o banco de dados dos sistemas de informação do Datasus e IBGE. Os principais resultados indicam que o grupo de idosos passou de 4,1% em 1980, 5,0% em 1991, para 6,6% em 2000. Sobre a mortalidade proporcional por causa básica, as doenças do aparelho circulatório foram a primeira causa básica de óbito, sendo 23,05% em 1996 e 28,26% em 2005; seguiram-se as neoplasias, 14,13% em 1996 e 15,69% em 2005, causas externas de morbidade e mortalidade, 11,87% em 1996 e 12,74% em 2005 e doenças infecciosas e parasitárias, 8,42% em 1996 e 5,43% em 2005. O perfil de mortalidade acompanhou a dinâmica populacional do município, observando redução de doenças infecciosas e um aumento das doenças crônicas, compatível com o processo de envelhecimento populacional.This study is an ecological study of time trend. The objective of this study is to assess the population dynamics as the 1980 Census, 1991 and 2000, and the profile of mortality in the period between 1996 and 2005, in Montes Claros, Minas Gerais State. We used the information systems database of Datasus and IBGE. The main results indicate that the elderly group increased from 4.1% in 1980, 5.0% in 1991 to 6.6% in 2000. On the proportional mortality by cause, diseases of the circulatory system were the first cause of death, and 23.05% in 1996 and 28.26% in 2005, followed by cancer 14.13% in 1996 and 15.69% in 2005, external causes of morbidity and mortality 11.87% in 1996 and 12.74% in 2005 and infectious and parasitic diseases 8.42% in 1996 and 5.43% in 2005. The profile of mortality followed the population dynamics of the city observed a reduction of infectious diseases and an increase in chronic diseases, consistent with the process of population aging.

Trata-se de um estudo ecológico de tendência temporal, cujo objetivo é verificar a dinâmica populacional conforme os censos de 1980, 1991 e 2000 e o perfil de mortalidade no período entre 1996 e 2005, em Montes Claros (MG). Utilizou-se o banco de dados dos sistemas de informação do Datasus e IBGE. Os principais resultados indicam que o grupo de idosos passou de 4,1% em 1980, 5,0% em 1991, para 6,6% em 2000. Sobre a mortalidade proporcional por causa básica, as doenças do aparelho circulatório foram a primeira causa básica de óbito, sendo 23,05% em 1996 e 28,26% em 2005; seguiram-se as neoplasias, 14,13% em 1996 e 15,69% em 2005, causas externas de morbidade e mortalidade, 11,87% em 1996 e 12,74% em 2005 e doenças infecciosas e parasitárias, 8,42% em 1996 e 5,43% em 2005. O perfil de mortalidade acompanhou a dinâmica populacional do município, observando redução de doenças infecciosas e um aumento das doenças crônicas, compatível com o processo de envelhecimento populacional. This study is an ecological study of time trend. The objective of this study is to assess the population dynamics as the 1980 Census, 1991 and 2000, and the profile of mortality in the period between 1996 and 2005, in Montes Claros, Minas Gerais State. We used the information systems database of Datasus and IBGE. The main results indicate that the elderly group increased from 4.1% in 1980, 5.0% in 1991 to 6.6% in 2000. On the proportional mortality by cause, diseases of the circulatory system were the first cause of death, and 23.05% in 1996 and 28.26% in 2005, followed by cancer 14.13% in 1996 and 15.69% in 2005, external causes of morbidity and mortality 11.87% in 1996 and 12.74% in 2005 and infectious and parasitic diseases 8.42% in 1996 and 5.43% in 2005. The profile of mortality followed the population dynamics of the city observed a reduction of infectious diseases and an increase in chronic diseases, consistent with the process of population aging.

Inserido no universo do cuidado de enfermagem à pessoa idosa, o estudo descreve o perfil sociodemográfico e verifica o uso de medicação segundo gênero em idosos cadastrados em um PSF. MÉTODO: Estudo quantitativo, descritivo, transversal com pesquisa de campo. Utilizou-se o questionário semiestruturado, possibilitando identificar o perfil desses usuários, as principais morbidades, os medicamentos utilizados e as dificuldades relatadas por eles quanto ao uso dos medicamentos. O universo foi de 211 idosos. Na análise dos dados utilizou-se o programa SPSS, priorizando a associação estatística de forma analítica. RESULTADOS: Entre os idosos em uso de medicamentos, verificou-se predominância feminina, renda familiar e escolaridade baixas, idosos vivendo com familiares e sem dificuldades no uso de medicamentos. Uso de medicamentos foi comum em mais de 90% dos idosos. Verificou-se associação para "ausência de dificuldades no uso do medicamento" e "orientações do PSF" (PInserido en el universo del cuidado de enfermería al anciano, el estudio describe el perfil sociodemográfico y verifica el uso de medicación según género en acianos asistidos en una unidad del Programa de Salud Familiar. MÉTODO: Estudio cuantitativo, descriptivo y transversal con trabajo de campo. Fue utilizado cuestionario seme-estructurado, posibilitando identificar el perfil de los usuarios, las principales morbilidades, los medicamentos utilizados y las dificultades relatadas por ellos en relación al uso de los medicamentos. En el análisis de los dados, fue utilizado el programa SPSS, priorizando la asociación estadística de forma analítica. RESULTADOS: Entre los ancianos con uso de medicamentos, fue verificado predominancia femenina, renda familiar y escolaridad bajas, ancianos viviendo con los familiares y sin dificultades en uso de los medicamentos. El uso de medicamento fue común en más de 90% de los ancianos. Fue verificado asociación para "ausencia de dificultades en uso de medicamento" y "orientaciones del Programa de Salud Familiar" (pInserted in the care universe of nursing to the elderly people, the study describes the socio-demographic profile and verifies the medication use according to gender among elders from a Family Health Program unit. METHOD: This is a quantitative, descriptive and cross-sectional study with field research. It was used a semi-structured questionnaire, enabling to identify the profile of these users, main morbidities, used medicaments and related difficulties by them regarding the medication use. The research universe was 211 elders. In the date analysis was used SPSS software, prioritizing analytic statistic association. RESULTS: Among elderly in medication use verified female predominance, low family income and low schooling and elders living with their familiars and without difficulties in medication use. The medication use was common in moreover 90% of elders. It was verified association to "lack of difficulties in medication use" and "Family Health Program orientations" (p

Este estudo objetivou compreender quais os modelos educacionais têm sido aplicados às atividades de educação em saúde. Trata-se de uma revisão de literatura, sobre o tema “Modelos de Educação” e “Educação em Saúde”, utilizando como referenciais livros-textos contemporâneos de especialistas da área de educação e periódicos sobre tais temas, disponíveis nas principais bases de dados. Os resultados revelaram que o Modelo Tradicional de educação em saúde objetiva transmissão do conhecimento e experiência do educador, atribuindo uma importância suprema ao conteúdo ensinado, esperando que os educandos o absorvam sem modificações e o reproduzam fielmente. Já, o modelo dialógico compreende a educação em saúde como um processo de conscientização, mudança e transformação, caracterizada por uma filosofia emancipatória dos sujeitos. This study aimed at determining which educational models have been applied to the activities health education. This is a review of literature on the topic “Models of Education” and “Health Education”, using as reference contemporary books of specialists in the field of education and journals on such topics available in major databases. The results showed that the Traditional Model of health education aims to transfer the knowledge and experience of the educator, giving a paramount importance to the content taught, hoping that the students absorb unchanged and faithfully reproduce. The model based on dialogue understands the in health education as a process of awareness, change and transformation, characterized by a philosophy of emancipatory subject. Este estudio tuvo como objetivo determinar modelos educativos que se han aplicado a las actividades de educación en salud. Es una revisión de la literatura sobre el tema “Modelos de Educación”, “Educación para la Salud”, utilizando como referencia libros contemporáneos, revistas sobre temas tales disponible en las principales bases de datos. Resultados mostraron que Modelo Tradicional de educación para la salud tiene por objeto transferencia de experiências, conocimientos de al educador, lo que da una importancia primordial a los contenidos enseñados, con esperanza de que estudiantes absorber la misma, la reproducción fiel. Modelo basado en el diálogo entiende la educación para la salud como proceso de sensibilización, el cambio, la transformación, que se caracteriza por una filosofía del sujeto emancipatorio.

Este estudo objetivou compreender quais os modelos educacionais têm sido aplicados às atividades de educação em saúde. Trata-se de uma revisão de literatura, sobre o tema “Modelos de Educação” e “Educação em Saúde”, utilizando como referenciais livros-textos contemporâneos de especialistas da área de educação e periódicos sobre tais temas, disponíveis nas principais bases de dados. Os resultados revelaram que o Modelo Tradicional de educação em saúde objetiva transmissão do conhecimento e experiência do educador, atribuindo uma importância suprema ao conteúdo ensinado, esperando que os educandos o absorvam sem modificações e o reproduzam fielmente. Já, o modelo dialógico compreende a educação em saúde como um processo de conscientização, mudança e transformação, caracterizada por uma filosofia emancipatória dos sujeitos.Este estudio tuvo como objetivo determinar modelos educativos que se han aplicado a las actividades de educación en salud. Es una revisión de la literatura sobre el tema “Modelos de Educación”, “Educación para la Salud”, utilizando como referencia libros contemporáneos, revistas sobre temas tales disponible en las principales bases de datos. Resultados mostraron que Modelo Tradicional de educación para la salud tiene por objeto transferencia de experiências, conocimientos de al educador, lo que da una importancia primordial a los contenidos enseñados, con esperanza de que estudiantes absorber la misma, la reproducción fiel. Modelo basado en el diálogo entiende la educación para la salud como proceso de sensibilización, el cambio, la transformación, que se caracteriza por una filosofía del sujeto emancipatorio.This study aimed at determining which educational models have been applied to the activities health education. This is a review of literature on the topic “Models of Education” and “Health Education”, using as reference contemporary books of specialists in the field of education and journals on such topics available in major databases. The results showed that the Traditional Model of health education aims to transfer the knowledge and experience of the educator, giving a paramount importance to the content taught, hoping that the students absorb unchanged and faithfully reproduce. The model based on dialogue understands the in health education as a process of awareness, change and transformation, characterized by a philosophy of emancipatory subject.

OBJETIVO: Identificar variáveis associadas a internações sensíveis ao cuidado primário. MÉTODOS: Inquérito de morbidade hospitalar realizado com amostra aleatória de 660 pacientes internados em enfermarias de clínica médica e cirúrgica de hospitais conveniados com o Sistema Único de Saúde, em Montes Claros, MG, de 2007 a 2008. Foram realizadas entrevistas com os pacientes e seus familiares utilizando formulário próprio e pesquisa aos prontuários. A definição das condições consideradas sensíveis ao cuidado primário baseou-se na lista do Ministério da Saúde. A associação entre variáveis socioeconômicas e de saúde com as internações sensíveis foi analisada utilizando-se análises bivariadas e de regressão logística múltipla. RESULTADOS: O percentual de internações sensíveis ao cuidado primário no grupo estudado foi de 38,8% (n=256). As variáveis que se mantiveram estatisticamente associadas com as condições sensíveis ao cuidado primário foram: internação prévia (OR=1,62; IC 95%: 1,51;2,28), visitas regulares a unidades de saúde (OR=2,20; IC 95%: 1,44;3,36), baixa escolaridade (OR=1,50; IC 95%: 1,02;2,20), controle de saúde não realizado por equipe de saúde da família (OR=2,48; IC 95%: 1,64;3,74), internação solicitada por médicos que não atuam na equipe de saúde da família (OR=2,25; IC 95%: 1,03;4,94) e idade igual ou superior a 60 anos (OR=2,12; IC 95%: 1,45;3,09). CONCLUSÕES: As variáveis associadas às internações sensíveis são sobretudo próprias do paciente, como idade, escolaridade e internações prévias, mas o controle regular da saúde fora da Estratégia de Saúde da Família duplica a probabilidade de internação.RESUMEN OBJETIVO: Identificar variables asociadas a internaciones sensibles al cuidado primario. MÉTODOS: Pesquisa de morbilidad hospitalaria realizada con muestra aleatoria de 660 pacientes internados en enfermerías de clínica médica y quirúrgica de hospitales conveniados con el Sistema Único de Salud, en Montes Claros, Sureste de Brasil, de 2007 a 2008. Fueron realizadas entrevistas con los pacientes y sus familiares utilizando formulario propio y pesquisa a los prontuarios. La definición de las condiciones consideradas sensibles al cuidado primario se basó en la lista del Ministerio de la Salud de Brasil. La asociación entre variables socioeconómicas y de salud con las internaciones sensibles fue analizada utilizándose análisis bivariados y de regresión logística múltiple. RESULTADOS: El porcentaje de internaciones sensibles al cuidado primario en el grupo estudiado fue de 38,8% (n=256). Las variables que se mantuvieron estadísticamente asociadas con las condiciones sensibles al cuidado primario fueron: internación previa (OR=1,62; IC 95%: 1,51;2,28), visitas regulares a unidades de salud (OR=2,20; IC 95%: 1,44;3,36), baja escolaridad (OR=1,50; IC 95%: 1,02;2,20), control de salud no realizado por equipo de salud de la familia (OR=2,48; IC 95%; 1,64;3,74), internación solicitada por médicos que no actúan en el equipo de salud de la familia (OR=2,25; IC 95%: 1,03;4,94) y edad igual o superior a 60 años (OR=2,12; IC 95%: 1,45;3,09). CONCLUSIONES: Las variables asociadas a las internaciones sensibles son sobretodo propias del paciente, como edad, escolaridad e internaciones previas, pero el control regular de la salud fuera de la Estrategia de Salud de la Familia duplica la probabilidad de internación.OBJECTIVE: To identify variables associated with hospitalizations sensitive to primary care. METHODS: A hospital morbidity survey was conducted using a random sample of 660 patients hospitalized in clinical and surgical wards of hospitals that had service agreements with the Brazilian National Health System (SUS), in the municipality of Montes Claros, Southeastern Brazil, between 2007 and 2008. Interviews were held with patients and members of their families using a specific form, and the patients' medical files were investigated. The definition of conditions considered sensitive to primary care was based on the Ministry of Health's list. Associations shown by socioeconomic and health variables in relation to hospitalizations sensitive to primary care were analyzed using bivariate and multiple logistic regression analyses. RESULTS: The percentage of hospitalizations sensitive to primary care in the study group was 38.8% (n = 256). The variables that remained statistically associated with conditions considered sensitive to primary care were: previous hospitalization (OR = 1.62; 95% CI: 1.51;2.28); regular visits to healthcare units (OR = 2.20; 95% CI: 1.44;3.36); low schooling level (OR = 1.50; 95% CI: 1.02;2.20); health checks not performed by the family health team (OR = 2.48; 95% CI: 1.64;3.74); hospitalization requested by physicians who were not part of the family health team (OR = 2.25; 95% CI: 1.03;4.94); and age greater than or equal to 60 years (OR = 2.12; 95% CI: 1.45;3.09). CONCLUSIONS: The variables associated with hospitalizations sensitive to primary care are particularly those relating to patients, such as age, schooling level and previous hospitalization, but regular health checks outside of the Family Health Strategy doubled the likelihood of hospitalization.

CONTEXT AND OBJECTIVE: Homeopathy is a therapeutic system that uses small doses of substances to stimulate autoregulatory and self-healing processes. The aim of this study was to investigate the prevalence of the use of homeopathy by the population of Montes Claros, Brazil, and the socioeconomic profile of users. DESIGN AND SETTING: Probabilistic cross-sectional study with cluster sampling, in the city of Montes Claros, Minas Gerais. METHODS: This study was conducted by applying semi-structured questionnaires. The sample was composed of 3,080 people. For the statistical analysis, Student's t test and the chi-square test were used. The statistical significance level used was P < 0.05. RESULTS: We interviewed 3,090 people. The prevalence of the use of homeopathy was 2.4%. The factors associated with its use were female gender, schooling and income. The main reason that led to seeking homeopathy was "Conventional treatment did not have any effect". For 70.2% of the users, the cost of the treatment was considered reasonable or cheap. About 73% were satisfied or very satisfied with the treatment received through homeopathy. CONCLUSIONS: The prevalence of the use of homeopathy found here was less than that reported in other countries. People with higher income and schooling levels used homeopathy more frequently. There was higher prevalence among women. Most users declared themselves satisfied with the treatment received. CONTEXTO E OBJETIVO: A homeopatia é um sistema terapêutico que utiliza pequenas doses de substâncias para estimular processos de autocura e autorregulação. O objetivo deste estudo foi verificar a prevalência de utilização da homeopatia pela população de Montes Claros e o perfil socioeconômico do usuário. TIPO DE ESTUDO E LOCAL: Estudo transversal, probabilístico, por conglomerados, na cidade de Montes Claros, Minas Gerais. MÉTODOS: Estudo realizado por meio da aplicação de questionários semi-estruturados. A amostra foi composta por 3.080 pessoas. Na análise estatística, utilizou-se o teste t de Student e o teste do Qui-quadrado. A significância estatística considerada foi P < 0,05. RESULTADOS: Foram entrevistadas 3.090 pessoas. A prevalência de utilização da homeopatia foi de 2,4%. Os fatores associados à utilização foram: gênero feminino, escolaridade e renda. O principal motivo que levou a procura da homeopatia foi "o tratamento convencional não surtiu efeito". Para 70,2% dos usuários o custo do tratamento foi considerado suportável ou barato. Cerca de 73% ficaram satisfeitos ou muito satisfeitos com o tratamento recebido na homeopatia. CONCLUSÕES: A prevalência de uso de homeopatia encontrada ficou aquém da relatada em outros países. Pessoas com melhores níveis de renda e escolaridade utilizam homeopatia com maior frequência, assim como as mulheres. A maioria dos usuários declarou-se satisfeito com o tratamento recebido.

OBJETIVO: Verificar a prevalência de utilização e o perfil socioeconômico do usuário de medicina complementar e alternativa pela população de Montes Claros (MG). MÉTODOS: Estudo transversal, analítico. A amostra foi probabilística, por conglomerados, sendo a unidade amostral o domicílio e os entrevistados de ambos os sexos e maiores de 18 anos. Os dados foram coletados em uma cidade de porte médio de Minas Gerais utilizando formulários semi-estruturados. RESULTADOS: Foram entrevistadas 3.090 pessoas. A prevalência de uso de medicina complementar e alternativas foi, quando consideradas somente as que envolvem custos, como homeopatia, acupuntura, quiropraxia, medicina ortomolecular, técnicas de relaxamento/meditação e massagem, de 8,93% e 70%, quando incluímos todas as terapias arguidas. As prevalências foram: oração a Deus (52%), remédios populares (30,9%), exercícios físicos (25,5%), benzedeiras (15%), dietas populares (7,1%), massagem (4,9%), relaxamento/meditação (2,8%), homeopatia (2,4%), grupos de autoajuda (1,9%), quiropraxia (1,7%), acupuntura (1,5%) e medicina ortomolecular (0,2%). Mulheres, católicos, casados, melhor renda e escolaridade estiveram associados de forma positiva com a utilização das terapias que envolvem custos. CONCLUSÃO: Medicina complementar e alternativa é utilizada por número significativo da população. Gênero, religião, estado civil, renda e escolaridade estiveram associados positivamente com utilização de terapias alternativas. O acesso das pessoas de menor renda e escolaridade à medicina complementar e alternativa poderia aumentar a prevalência de utilização daquelas formas que envolvem custos. OBJECTIVE: To determine prevalence of utilization and social and economic profile of those using complementary and alternative medicine in the medium sized Brazilian city of Montes Claros, MG. METHODS: A transversal descriptive study was conducted. The sample of 3090 people was probabilistic, by clusters using the household as the sample unit for interview of both genders, older than 18 years. Data were collected by semi-structured questionnaires. RESULTS: Utilization of complementary and alternative medicine was of 8.9% when only those involving costs such as homeopathy, acupuncture, chiropractics, techniques of relaxation/ meditation and massage are considered and of 70.0%, when all therapies found were included. Prevalent were prayers to God (52.0%), popular medicines (30.9%), physical exercises (25.5%), faith healers (15.0%), popular diets (7.1%), massage (4.9%), relaxation/meditation (2.8%), homeopathy (2.4%), and groups of self-help (1.9%), chiropractics (1.7%), acupuncture (1.5%) and orthomolecular medicine (0.2%). Women, Catholic, married of higher income and education were positively associated with utilization of therapies involving expenses. CONCLUSIONS: Complementary and alternative medicine is used by a significant number of those interviewed. Gender, religion, marital status, income and education were positively associated with utilization of complementary and alternative medicine. Access of those with less income and education could increase the utilization of the options that involve expenses.

The main strategy for precocious detention of the cervical cancer is the cytopathologic examination. This objective study to identify the main cultural, social, economic factors, sexual and reproductive aspects and reasons for not the accomplishment of the cytopathologic examination in women; to verify a possible association of these variables with its knowledge on the purpose of this examination. This one is about a transversal study, whith the selection of 45 women registered in cadastre in three teams of the Family Health Strategy of Montes Claros (MG), in the period from September to December of 2006. It was realized the descriptive analysis and statistics, whose considered significance was p

OBJETIVO: Verificar a prevalência do transtorno mental comum (TMC) na população da cidade de Montes Claros, MG, e a existência de associação entre os fatores socioeconômicos e a utilização de práticas integrativas e complementares/medicina complementar e alternativa (PIC/MCA) com o TMC. MÉTODOS: Estudo transversal. População alvo: moradores de Montes Claros. A amostragem foi probabilística, com 3.090 pessoas. Utilizou-se formulário semi-estruturado e o self reporting questionnaire (SRQ-20) para identificação do TMC. Realizou-se regressão robusta de Poisson na análise com significância estatística considerada de p < 0,05. RESULTADOS: A prevalência de TMC foi de 23,2%, sendo 75% usuá­rios de PIC/MCA. Após controle para fatores de confusão, a prevalência de TMC foi maior naqueles com menor escolaridade (RP = 2,12; IC = 1,80-2,49); com menor nível econômico (RP = 1,92; IC = 1,07 - 3,44); com mais de 40 anos (RP = 1,30; IC = 1,15-1,48); do gênero feminino (RP = 2,99; IC = 1,50-3,58) e mais freqüente entre os que recorreram à homeopatia (RP = 1,52; IC = 1,12-2,08) e às benzedeiras (RP = 1,25; IC = 1,08-1,46). CONCLUSÕES: O TMC é muito freqüente na população de Montes Claros. As variáveis: escolaridade, nível econômico, idade e sexo, bem como a procura por homeopatia e benzedeiras estiveram associados ao TMC.OBJECTIVE: To verify the Common Mental Disorders (CMD) prevalence in Montes Claros, and existence of association among social economic factors and the Complementary and Alternative Medicine (CAM) utilization with CMD. METHODS: Cross-sectional study. Target population: Montes Claros residens. The sample was probabilistic with 3.090 people. A semi-structured questionnaire was used and the Self Reporting Questionnaire (SRQ-20) for identification of the CMD. It was done Poisson regression in the analysis with significance statistics considered of p < 0,05. RESULTS: The prevalence of CMD was of 23,2%, being 75% CAM users. The CMD prevalence was bigger in the those with minor schooling (RP = 2,12; IC = 1,80-2,49); minor economic level (RP = 1,92; IC = 1,07-3,44); over 40 years (RP = 1,30; IC = 1,15-1,48); in the women (RP = 2,99; IC = 1,50-3,58). It was more frequent among who turn to homeopathy (RP = 1,52; IC = 1,12-2,08) and spiritual healing by others (RP = 1,25; IC = 1,08-1,46). CONCLUSIONS: The CMD is very frequent in population of Montes Claros. The variables: schooling, economic level; age; sex as well as turn to homeopathy and spiritual healing by others.

OBJETIVO: Verificar a prevalência do transtorno mental comum (TMC) na população da cidade de Montes Claros, MG, e a existência de associação entre os fatores socioeconômicos e a utilização de práticas integrativas e complementares/medicina complementar e alternativa (PIC/MCA) com o TMC. MÉTODOS: Estudo transversal. População alvo: moradores de Montes Claros. A amostragem foi probabilística, com 3.090 pessoas. Utilizou-se formulário semi-estruturado e o self reporting questionnaire (SRQ-20) para identificação do TMC. Realizou-se regressão robusta de Poisson na análise com significância estatística considerada de p < 0,05. RESULTADOS: A prevalência de TMC foi de 23,2%, sendo 75% usuários de PIC/MCA. Após controle para fatores de confusão, a prevalência de TMC foi maior naqueles com menor escolaridade (RP = 2,12; IC = 1,80-2,49); com menor nível econômico (RP = 1,92; IC = 1,07 - 3,44); com mais de 40 anos (RP = 1,30; IC = 1,15-1,48); do gênero feminino (RP = 2,99; IC = 1,50-3,58) e mais freqüente entre os que recorreram à homeopatia (RP = 1,52; IC = 1,12-2,08) e às benzedeiras (RP = 1,25; IC = 1,08-1,46). CONCLUSÕES: O TMC é muito freqüente na população de Montes Claros. As variáveis: escolaridade, nível econômico, idade e sexo, bem como a procura por homeopatia e benzedeiras estiveram associados ao TMC. OBJECTIVE: To verify the Common Mental Disorders (CMD) prevalence in Montes Claros, and existence of association among social economic factors and the Complementary and Alternative Medicine (CAM) utilization with CMD. METHODS: Cross-sectional study. Target population: Montes Claros residens. The sample was probabilistic with 3.090 people. A semi-structured questionnaire was used and the Self Reporting Questionnaire (SRQ-20) for identification of the CMD. It was done Poisson regression in the analysis with significance statistics considered of p < 0,05. RESULTS: The prevalence of CMD was of 23,2%, being 75% CAM users. The CMD prevalence was bigger in the those with minor schooling (RP = 2,12; IC = 1,80-2,49); minor economic level (RP = 1,92; IC = 1,07-3,44); over 40 years (RP = 1,30; IC = 1,15-1,48); in the women (RP = 2,99; IC = 1,50-3,58). It was more frequent among who turn to homeopathy (RP = 1,52; IC = 1,12-2,08) and spiritual healing by others (RP = 1,25; IC = 1,08-1,46). CONCLUSIONS: The CMD is very frequent in population of Montes Claros. The variables: schooling, economic level; age; sex as well as turn to homeopathy and spiritual healing by others.

The purpose of this study was to assess the LEPR gene Gln223Arg polymorphism (rs1137101) in oral squamous cell carcinoma (OSCC) and in potentially malignant oral lesions (PMOL) in comparison to normal oral mucosa in a Brazilian population. Smokers (n = 89) were selected from a representative sample of 471 individuals from the general population of Montes Claros, Brazil. Participants were age and gender matched to patients with OSCC (n = 25) and oral epithelial dysplasia (n = 25). We investigated the LEPR Gln223Arg polymorphism (A>G; rs1137101) in these groups. Genotype variants were assessed by RFLP-PCR, using MspI (HPAII) restriction endonuclease. The institutional review board of the Universidade Estadual de Montes Claros approved the study (process number 2667/2011). Written informed consent for this study was obtained from all participants. The GG genotype (Arg223Arg) appears to be the more relevant polymorphic variant in OSCC. It occurred, approximately, twice as frequently in OSCC patients than in the general population. In contrast, the A allele in its homozygosis form (Gln223Gln) is significantly associated with the development of PMOL; 80% of the samples from the PMOL group exhibit AA genotype. Our findings suggest new insights regarding LEPR gene variations in the development of OSCC and PMOL.

Background Data obtained from oral health surveys are very important for identifying disease-susceptible groups and for developing dental care and prevention programs. So, the purpose of the current article was to investigate the prevalence of oral mucosa lesions (OMLs) in a population of Brazilian police. Material and Methods Interviews and oral cavity examinations were performed on a sample of 395 police officers who were randomly selected by the calibrated researcher. The number of individuals was obtained by a sample calculation using the finite population correction. The diagnostic criteria were based on the WHO (1997) criteria and adapted to Brazilian surveys. Results In total, 8.61% of the population presented some OML. Traumatic injuries and benign migratory glossitis (BMG) were the most prevalent lesions. Conclusions The prevalence of potentially malignant disorders was lower than among the Brazilian population.The most prevalent lesion among the police officers was related to trauma. Patients dissatisfied with oral health had a higher risk of presenting OMLs. Key words:Mouth disease, mouth mucosa, military personnel, public health, oral pathology, oral leukoplakia.

Hypertension is responsible for high morbidity and mortality as one of the most important cardiometabolic risk factors. The aim of the study was to investigate whether the Gln223Arg in the leptin receptor (LEPR) influences the prevalence of hypertension. A cross-sectional study was carried out in individuals aged ≥ 18 years. Polymorphism identification was performed using PCR-RFLP analysis. Participants with blood pressure ≥ 140/90 mmHg or medication use were considered hypertensive. Frequencies, means, cross-tabulations, and multivariate models were produced to study differences in hypertension prevalence by genotypes. The study includes 470 participants. The frequency of GG polymorphism variant was 10.43%, 46.81% AG, and 42.77% AA. The distribution of hypertension frequency by LEPR genotypes was the following: AA 43.8%, AG 40.4%, and GG 40.8%; there were no significant differences between groups. Comparative analysis which used multivariate Poisson regression adjusted by many potential confounders (age, sex, schooling, smoking, alcohol intake, obesity, and family history of parental obesity) did not modify this result. In this large sample of population-based study, the association of the LEPR Gln223Arg gene polymorphism with hypertension was not observed.

Objective To evaluate the knowledge about diagnostic imaging methods among primary care and medical emergency physicians. Materials and Methods Study developed with 119 primary care and medical emergency physicians in Montes Claros, MG, Brazil, by means of a structured questionnaire about general knowledge and indications of imaging methods in common clinical settings. A rate of correct responses corresponding to ≥ 80% was considered as satisfactory. The Poisson regression (PR) model was utilized in the data analysis. Results Among the 81 individuals who responded the questionnaire, 65% (n = 53) demonstrated to have satisfactory general knowledge and 44% (n = 36) gave correct responses regarding indications of imaging methods. Respectively, 65% (n = 53) and 51% (n = 41) of the respondents consider that radiography and computed tomography do not use ionizing radiation. The prevalence of a satisfactory general knowledge about imaging methods was associated with medical residency in the respondents' work field (PR = 4.55; IC 95%: 1.18-16.67; p-value: 0.03), while the prevalence of correct responses regarding indication of imaging methods was associated with the professional practice in primary health care (PR = 1.79; IC 95%: 1.16-2.70; p-value: 0.01). Conclusion Major deficiencies were observed as regards the knowledge about imaging methods among physicians, with better results obtained by those involved in primary health care and by residents.

Trata-se de um estudo de caso, descritivo, de base documental, que analisa a participação estudantil nas atividades de ensino-pesquisa-extensão propostas pelo PET-Saúde (Programa de Educação pelo Trabalho para a Saúde) da Universidade Estadual de Montes Claros e Secretaria Municipal de Saúde de Montes Claros - MG, no período de 2009-2011. A coleta de dados envolveu análise de documentos de participação em eventos científicos e relatórios gerados na condução do PET-Saúde. As atividades científicas analisadas foram aquelas propostas pelo PET-Saúde sob acompanhamento tutorial por professores da Unimontes, preceptores profissionais do serviço vinculadoà Estratégia Saúde da Família e acadêmicos da área da saúde: Odontologia, Medicina, Enfermagem, Ciências Biológicas e Educação Física. Destacam-se os benefícios dos projetos para a formação em saúde dos estudantes, educação permanente dos preceptores, integração ensino serviço tendo em vista a consolidação do Sistema Único de Saúde.

The leptin receptor gene has been reported to associate with insulin and glucose metabolism and adiposity in different study settings and various populations. Therefore, the aim of the study was to investigate the associations of the leptin receptor gene Gln223Arg polymorphism (LEPR Gln223Arg) with high capillary glucose levels. Cross-sectional study with probabilistic sample was carried out in individuals aged ≥18 years in an urban area of Montes Claros, MG, Brazil. The capillary glucose was considered high when ≥140 mg/dL. The genotypes of LEPR Gln223Arg distribution were as the following: 10.43% GG (n=49), 46.81% AG (n=220), and 42.77% AA (n=201), and there were no prevalence differences between genders, (P=0.57). Multivariate-adjusted models showed that there is no association between the polymorphism LEPR Gln223Arg and capillary high levels of glucose even when adjusted for age, sex, smoking, schooling, and parental history of obesity. In conclusion, no association between the polymorphism LEPR Gln223Arg and elevated blood glucose levels was detected.

Quality of life has become an important yardstick of the impact on health. Its evaluation related to diseases and associated risk factors has increased in the population in general. This article seeks to assess the quality of life and the presence of the association with risk factors for non-communicable chronic diseases in the urban population of the city of Montes Claros in the State of Minas Gerais. It is a population-based cross-sectional study. The sample was calculated considering the prevalence of risk factors of overweight of 30% and corrected for a variation of 30%. Cluster sampling was conducted on urban census sectors. Seventeen census sectors were selected and 648 residents aged e" 18 years were interviewed. The risk factors for non-communicable chronic diseases as well as the quality of life were verified using the SF-36 questionnaire. Some risk factors were associated with the lowest scores on the SF-36 questionnaire. The presence of some risk factors for chronic diseases has an impact on quality of life.

In the present study, we analyzed sociodemographical and clinical factors, and the Eastern Cooperative Oncology Group performance status (ECOG-PS) scale in head and neck squamous cell carcinoma (HNSCC) patients. We evaluated the impact of a range of variables on overall survival. We investigated a sample of HNSCC patients (n = 671), using sociodemographical and clinical information, and survival data collected from a review of epidemiological, clinical, and treatment reports. Statistical associations were analyzed by bivariate and multivariate statistical tests. Statistical significance was set at p

Inserido no universo do cuidado de enfermagem à pessoa idosa, o estudo descreve o perfil sociodemográfico e verifica o uso de medicação segundo gênero em idosos cadastrados em um PSF. MÉTODO: Estudo quantitativo, descritivo, transversal com pesquisa de campo. Utilizou-se o questionário semiestruturado, possibilitando identificar o perfil desses usuários, as principais morbidades, os medicamentos utilizados e as dificuldades relatadas por eles quanto ao uso dos medicamentos. O universo foi de 211 idosos. Na análise dos dados utilizou-se o programa SPSS, priorizando a associação estatística de forma analítica. RESULTADOS: Entre os idosos em uso de medicamentos, verificou-se predominância feminina, renda familiar e escolaridade baixas, idosos vivendo com familiares e sem dificuldades no uso de medicamentos. Uso de medicamentos foi comum em mais de 90% dos idosos. Verificou-se associação para "ausência de dificuldades no uso do medicamento" e "orientações do PSF" (P