43 results on '"Sean Walkowiak"'
Search Results
2. Ergot in Canadian cereals – relevance, occurrence, and current status
- Author
-
Sean Walkowiak, Dale Taylor, Bin Xiao Fu, Dainna Drul, Kerri Pleskach, and Sheryl A. Tittlemier
- Subjects
Plant Science ,Agronomy and Crop Science - Published
- 2022
3. Evaluation of two high-throughput genotyping systems for rapid identification of Canadian wheat varieties
- Author
-
Sung-Jong Lee, Tigst Demeke, Mathieu Dusabenyagasani, Danny Saydak, Daniel Perry, and Sean Walkowiak
- Subjects
Plant Science ,Horticulture ,Agronomy and Crop Science - Abstract
In this study, we report an updated panel of 32 DNA markers used for identification of wheat varieties and assess their performance in the OpenArray and SmartChip high-throughput genotyping systems. While both systems are unique and offer different advantages and disadvantages, both systems can successfully identify Canadian wheat varieties.
- Published
- 2023
4. Author Correction: A high-throughput skim-sequencing approach for genotyping, dosage estimation and identifying translocations
- Author
-
Laxman Adhikari, Sandesh Shrestha, Shuangye Wu, Jared Crain, Liangliang Gao, Byron Evers, Duane Wilson, Yoonha Ju, Dal‑Hoe Koo, Pierre Hucl, Curtis Pozniak, Sean Walkowiak, Xiaoyun Wang, Jing Wu, Jeffrey C. Glaubitz, Lee DeHaan, Bernd Friebe, and Jesse Poland
- Subjects
Multidisciplinary - Published
- 2023
5. First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada
- Author
-
Yishan Zhang, Sharandeep Singh, Shimosh Kurera, Janice Bamforth, Samuel Holden, Mehrdad Abbasi, Vincent Fetterley, Ana Sofia Alfonso, Ramandeep Bamrah, Sean Walkowiak, and Gurcharn Singh Brar
- Subjects
Plant Science ,Agronomy and Crop Science - Abstract
Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5’TCATC GGCCACGTCGACTCT3’) and EF1-R3 (5’TACCAGCCTCGAACTCACCA3’). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch’s postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.
- Published
- 2023
6. Wheat doubled haploids have a marked prevalence of chromosomal aberrations
- Author
-
Sandesh Shrestha, Dal‐Hoe Koo, Byron Evers, Shuangye Wu, Sean Walkowiak, Pierre Hucl, Curtis Pozniak, Allan Fritz, and Jesse Poland
- Subjects
chromosomal aberration ,wheat ,speed breeding ,Genetics ,plant breeding ,food and beverages ,DH ,Plant Science ,aneuploidy ,doubled haploid ,Agronomy and Crop Science ,digital karyotyping - Abstract
Doubled haploid (DH) lines developed by two wheat breeding programs (Kansas State University and the University of Saskatchewan) were evaluated to determine the extent of chromosomal aberrations induced during the DH development process.This study utilized the digital karyotyping method, based on sequencing depth and read mapping, to identify chromosomal aberration in individual wheat plants.The supplementary materials generated from this study are available here.
- Published
- 2022
- Full Text
- View/download PDF
7. A survey of Fusarium species and ADON genotype on Canadian wheat grain
- Author
-
Janice Bamforth, Tiffany Chin, Tehreem Ashfaq, Niradha Withana Gamage, Kerri Pleskach, Sheryl A. Tittlemier, Maria Antonia Henriquez, Shimosh Kurera, Sung-Jong Lee, Bhaktiben Patel, Tom Gräfenhan, and Sean Walkowiak
- Subjects
General Medicine - Abstract
IntroductionWheat is a staple food that is important to global food security, but in epidemic years, fungal pathogens can threaten production, quality, and safety of wheat grain. Globally, one of the most important fungal diseases of wheat is Fusarium head blight (FHB). This disease can be caused by several different Fusarium species with known differences in aggressiveness and mycotoxin-production potential, with the trichothecene toxin deoxynivalenol (DON) and its derivatives being of particular concern. In North America, the most predominant species causing FHB is F. graminearum, which has two distinct sub-populations that are commonly classified into two main chemotypes/genotypes based on their propensity to form trichothecene derivatives, namely 15-acetyldeoxynivalenol (15-ADON) and 3-acetyldeoxynivalenol (3-ADON).Materials and methodsWe used a panel of 13 DNA markers to perform species and ADON genotype identification for 55, 444 wheat kernels from 7, 783 samples originating from across Canada from 2014 to 2020.Results and discussionBased on single-seed analyses, we demonstrate the relationships between Fusarium species and trichothecene chemotype with sample year, sample location, wheat species (hexaploid and durum wheat), severity of Fusarium damaged kernels (FDK), and accumulation of DON. Results indicate that various Fusarium species are present across wheat growing regions in Canada; however, F. graminearum is the most common species and 3-ADON the most common genotype. We observed an increase in the occurrence of the 3-ADON genotype, particularly in the western Prairie regions. Our data provides important information on special-temporal trends in Fusarium species and chemotypes that can aid with the implementation of integrated disease management strategies to control the detrimental effects of this devastating disease.
- Published
- 2022
- Full Text
- View/download PDF
8. An autoactive
- Author
-
Philippa, Borrill, Rohit, Mago, Tianyuan, Xu, Brett, Ford, Simon J, Williams, Adinda, Derkx, William D, Bovill, Jessica, Hyles, Dhara, Bhatt, Xiaodi, Xia, Colleen, MacMillan, Rosemary, White, Wolfram, Buss, István, Molnár, Sean, Walkowiak, Odd-Arne, Olsen, Jaroslav, Doležel, Curtis J, Pozniak, and Wolfgang, Spielmeyer
- Subjects
Plant Breeding ,Binding Sites ,Nucleotides ,Dwarfism ,Triticum ,Plant Proteins - Abstract
Semidwarfing genes have greatly increased wheat yields globally, yet the widely used gibberellin (GA)-insensitive genes
- Published
- 2022
9. An autoactive NB-LRR gene causes Rht13 dwarfism in wheat
- Author
-
Philippa Borrill, Rohit Mago, Tianyuan Xu, Brett Ford, Simon J Williams, Adinda Derkx, William D Bovill, Jessica Hyles, Dhara Bhatt, Xiaodi Xia, Colleen MacMillan, Rosemary White, Wolfram Buss, István Molnár, Sean Walkowiak, Odd-Arne Olsen, Jaroslav Doležel, Curtis J Pozniak, and Wolfgang Spielmeyer
- Subjects
Multidisciplinary - Abstract
Semidwarfing genes have greatly increased wheat yields globally, yet the widely used gibberellin (GA)-insensitive genes Rht-B1b and Rht-D1b have disadvantages for seedling emergence. Use of the GA-sensitive semidwarfing gene Rht13 avoids this pleiotropic effect. Here, we show that Rht13 encodes a nucleotide-binding site/leucine-rich repeat ( NB-LRR ) gene. A point mutation in the semidwarf Rht-B13b allele autoactivates the NB-LRR gene and causes a height reduction comparable with Rht-B1b and Rht-D1b in diverse genetic backgrounds. The autoactive Rht-B13b allele leads to transcriptional up-regulation of pathogenesis-related genes including class III peroxidases associated with cell wall remodeling. Rht13 represents a new class of reduced height ( Rht ) gene, unlike other Rht genes, which encode components of the GA signaling or metabolic pathways. This discovery opens avenues to use autoactive NB-LRR genes as semidwarfing genes in a range of crop species, and to apply Rht13 in wheat breeding programs using a perfect genetic marker.
- Published
- 2022
10. Artificial Intelligence: A Promising Tool in Exploring the Phytomicrobiome in Managing Disease and Promoting Plant Health
- Author
-
Liang Zhao, Sean Walkowiak, and Wannakuwattewaduge Gerard Dilantha Fernando
- Subjects
Ecology ,Plant Science ,Ecology, Evolution, Behavior and Systematics - Abstract
There is increasing interest in harnessing the microbiome to improve cropping systems. With the availability of high—throughput and low—cost sequencing technologies, gathering microbiome data is becoming more routine. However, the analysis of microbiome data is challenged by the size and complexity of the data, and the incomplete nature of many microbiome databases. Further, to bring microbiome data value, it often needs to be analyzed in conjunction with other complex data that impact on crop health and disease management, such as plant genotype and environmental factors. Artificial intelligence (AI), boosted through deep learning (DL), has achieved significant breakthroughs and is a powerful tool for managing large complex datasets such as the interplay between the microbiome, crop plants, and their environment. In this review, we aim to provide readers with a brief introduction to AI techniques, and we introduce how AI has been applied to areas of microbiome sequencing taxonomy, the functional annotation for microbiome sequences, associating the microbiome community with host traits, designing synthetic communities, genomic selection, field phenotyping, and disease forecasting. At the end of this review, we proposed further efforts that are required to fully exploit the power of AI in studying phytomicrobiomes.
- Published
- 2023
11. Multiple wheat genomes reveal global variation in modern breeding
- Author
-
Gonzalo Garcia Accinelli, Simon G. Krattinger, Luca Venturini, Fuminori Kobayashi, Allen K. Fritz, Emily Delorean, Hikmet Budak, Gabriel Keeble-Gagnère, Keith A. Gardner, Valentyna Klymiuk, Pierre Hucl, Ksenia V. Krasileva, Kanako Kawaura, Jianzhong Wu, Neil McKenzie, Bernardo J. Clavijo, Kirby T. Nilsen, Heidrun Gundlach, Sateesh Kagale, Sylvie Cloutier, Cristobal Uauy, Manuel Spannagl, Masaomi Hatakeyama, Juan J. Gutierrez-Gonzalez, Anne Fiebig, Tony Kuo, Erik Legg, Gwyneth Halstead-Nussloch, Michael W. Bevan, Jonathan M. Wright, Jennifer Ens, David Swarbreck, Jasline Deek, Jemima Brinton, Sudharsan Padmarasu, Venkat Bandi, Christine Fosker, Hiroyuki Kanamori, Josquin Tibbets, Nils Stein, James Cockram, Rie Shimizu-Inatsugi, Anthony Hall, Philomin Juliana, Curtis J. Pozniak, Yusuke Nabeka, Beat Keller, Timothy Paape, Sean Walkowiak, Pierre R. Fobert, Lawrence Percival-Alwyn, Curt A. McCartney, Gary J. Muehlbauer, Kenneth J. Chalmers, Shuhei Nasuda, Burkhard Steuernagel, Dinushika Thambugala, Ricardo H. Ramirez-Gonzalez, Krystalee Wiebe, Ian Small, Klaus F. X. Mayer, Toshiaki Tameshige, Cécile Monat, Darren Heavens, Jun Sese, Andrew G. Sharpe, Ravi P. Singh, Matthew D. Clark, Alejandro C. Costamagna, Axel Himmelbach, Hirokazu Handa, Mulualem T. Kassa, Carl Gutwin, Bin Xiao Fu, Catharine Aquino, Uwe Scholz, Georg Haberer, Tomohiro Ban, Joanna Melonek, Amidou N’Diaye, Dario Copetti, Kazuki Murata, Assaf Distelfeld, Liangliang Gao, Nick Fradgley, Markus C. Kolodziej, Jorge Nunez Siri, Arvind K. Bharti, Thomas Wicker, Brook Byrns, Dal-Hoe Koo, Tsuyoshi Tanaka, Hiroyuki Tsuji, Peter Langridge, Chu Shin Koh, Kentaro Shimizu, Jesse Poland, and Martin Mascher
- Subjects
Insecta ,Internationality ,DNA Copy Number Variations ,General Science & Technology ,Acclimatization ,Centromere ,Plant genetics ,Introgression ,NLR Proteins ,Genomics ,Plant disease resistance ,Biology ,Genes, Plant ,Genetic Introgression ,Polymorphism, Single Nucleotide ,Genome ,Article ,Plant breeding ,Polyploidy ,Structural variation ,Animals ,Cloning, Molecular ,Triticum ,Plant Diseases ,Plant Proteins ,Comparative genomics ,Multidisciplinary ,Chromosome Mapping ,Genetic Variation ,food and beverages ,Haplotypes ,Evolutionary biology ,DNA Transposable Elements ,Edible Grain ,Genome, Plant - Abstract
Advances in genomics have expedited the improvement of several agriculturally important crops but similar efforts in wheat (Triticum spp.) have been more challenging. This is largely owing to the size and complexity of the wheat genome1, and the lack of genome-assembly data for multiple wheat lines2,3. Here we generated ten chromosome pseudomolecule and five scaffold assemblies of hexaploid wheat to explore the genomic diversity among wheat lines from global breeding programs. Comparative analysis revealed extensive structural rearrangements, introgressions from wild relatives and differences in gene content resulting from complex breeding histories aimed at improving adaptation to diverse environments, grain yield and quality, and resistance to stresses4,5. We provide examples outlining the utility of these genomes, including a detailed multi-genome-derived nucleotide-binding leucine-rich repeat protein repertoire involved in disease resistance and the characterization of Sm16, a gene associated with insect resistance. These genome assemblies will provide a basis for functional gene discovery and breeding to deliver the next generation of modern wheat cultivars., Comparison of multiple genome assemblies from wheat reveals extensive diversity that results from the complex breeding history of wheat and provides a basis for further potential improvements to this important food crop.
- Published
- 2020
12. De Novo Genome Assembly of the Japanese Wheat Cultivar Norin 61 Highlights Functional Variation in Flowering Time and Fusarium-Resistant Genes in East Asian Genotypes
- Author
-
Sean Walkowiak, Sudharsan Padmarasu, Martin Mascher, Emily Delorean, Georg Haberer, Masaomi Hatakeyama, Curtis J. Pozniak, Tomohiro Ban, Kanako Kawaura, Kentaro Shimizu, Jesse Poland, Shuhei Nasuda, Toshiaki Tameshige, Tetsuya Nakazaki, Dario Copetti, Juan J. Gutierrez-Gonzalez, Kazuki Murata, Klaus F. X. Mayer, Nils Stein, Thomas Wicker, Fuminori Kobayashi, Hiroyuki Tsuji, Rie Shimizu-Inatsugi, Jun Sese, Axel Himmelbach, Catharine Aquino, Kazusa Nishimura, Moeko Okada, Gary J. Muehlbauer, Tony Kuo, Manuel Spannagl, Cécile Monat, and Hirokazu Handa
- Subjects
0106 biological sciences ,0301 basic medicine ,Physiology ,Sequence assembly ,Plant Science ,AcademicSubjects/SCI01180 ,Bread wheat ,01 natural sciences ,Genome ,chemistry.chemical_compound ,Fusarium ,Genotype ,Cultivar ,Phylogeny ,Triticum ,Disease Resistance ,2. Zero hunger ,Genetics ,Asia, Eastern ,Chromosome Mapping ,food and beverages ,General Medicine ,Norin 61 ,ddc ,Florigen ,Genome, Plant ,Rapid Paper ,Locus (genetics) ,Flowers ,Asian germplasm ,Biology ,Genes, Plant ,Chromosomes, Plant ,Polyploidy ,Cytogenetics ,03 medical and health sciences ,Adaptation ,Asian Germplasm ,Bread Wheat ,Genome Assembly ,Allele ,Gene ,Genetic Association Studies ,Genome assembly ,AcademicSubjects/SCI01210 ,Genetic Variation ,Sequence Analysis, DNA ,Cell Biology ,030104 developmental biology ,chemistry ,Sequence Alignment ,010606 plant biology & botany - Abstract
Bread wheat is a major crop that has long been the focus of basic and breeding research. Assembly of its genome has been difficult because of its large size and allohexaploid nature (AABBDD genome). Following the first reported assembly of the genome of the experimental strain Chinese Spring (CS), the 10+ Wheat Genomes Project was launched to produce multiple assemblies of worldwide modern cultivars. The only Asian cultivar in the project is Norin 61, a representative Japanese cultivar adapted to grow across a broad latitudinal range, mostly characterized by a wet climate and a short growing season. Here, we characterize the key aspects of its chromosome-scale genome assembly spanning 15 Gb with a raw scaffold N50 of 22 Mb. Analysis of the repetitive elements identified chromosomal regions unique to Norin 61 that encompass a tandem array of the pathogenesis-related 13 family. We report novel copy-number variations in the B homeolog of the florigen gene FT1/VRN3, pseudogenization of its D homeolog and the association of its A homeologous alleles with the spring/winter growth habit. Furthermore, the Norin 61 genome carries typical East Asian functional variants different from CS, ranging from a single nucleotide to multi-Mb scale. Examples of such variation are the Fhb1 locus, which confers Fusarium head-blight resistance, Ppd-D1a, which confers early flowering, Glu-D1f for Asian noodle quality and Rht-D1b, which introduced semi-dwarfism during the green revolution. The adoption of Norin 61 as a reference assembly for functional and evolutionary studies will enable comprehensive characterization of the underexploited Asian bread wheat diversity.
- Published
- 2020
13. The Aegilops ventricosa 2NvS segment in bread wheat: cytology, genomics and breeding
- Author
-
Curtis J. Pozniak, Trevor W. Rife, Ravi P. Singh, Cécile Monat, Paula Silva, Daljit Singh, Jesse Poland, Martin Mascher, Bernd Friebe, Kevin M. Dorn, Manuel Spannagl, Philomin Juliana, Sean Walkowiak, Gary J. Muehlbauer, Nils Stein, Cristiano Lemes da Silva, Dal-Hoe Koo, Allan K. Fritz, Xu Wang, Burkhard Steuernagel, Thomas Lux, Liangliang Gao, and Marshall Clinesmith
- Subjects
Genetic Markers ,0106 biological sciences ,Candidate gene ,Aegilops ,Genomics ,Aegilops ventricosa ,Biology ,Stem rust ,01 natural sciences ,Rust ,Chromosomes, Plant ,03 medical and health sciences ,Gene Expression Regulation, Plant ,Genetics ,Gene family ,Triticum ,Plant Diseases ,Plant Proteins ,030304 developmental biology ,Molecular breeding ,0303 health sciences ,Wheat diseases ,Basidiomycota ,Chromosome Mapping ,food and beverages ,Bread ,General Medicine ,biology.organism_classification ,Plant Breeding ,Original Article ,Agronomy and Crop Science ,010606 plant biology & botany ,Biotechnology - Abstract
Key message The first cytological characterization of the 2NvS segment in hexaploid wheat; complete de novo assembly and annotation of 2NvS segment; 2NvS frequency is increasing 2NvS and is associated with higher yield. Abstract The Aegilops ventricosa 2NvS translocation segment has been utilized in breeding disease-resistant wheat crops since the early 1990s. This segment is known to possess several important resistance genes against multiple wheat diseases including root knot nematode, stripe rust, leaf rust and stem rust. More recently, this segment has been associated with resistance to wheat blast, an emerging and devastating wheat disease in South America and Asia. To date, full characterization of the segment including its size, gene content and its association with grain yield is lacking. Here, we present a complete cytological and physical characterization of this agronomically important translocation in bread wheat. We de novo assembled the 2NvS segment in two wheat varieties, ‘Jagger’ and ‘CDC Stanley,’ and delineated the segment to be approximately 33 Mb. A total of 535 high-confidence genes were annotated within the 2NvS region, with > 10% belonging to the nucleotide-binding leucine-rich repeat (NLR) gene families. Identification of groups of NLR genes that are potentially N genome-specific and expressed in specific tissues can fast-track testing of candidate genes playing roles in various disease resistances. We also show the increasing frequency of 2NvS among spring and winter wheat breeding programs over two and a half decades, and the positive impact of 2NvS on wheat grain yield based on historical datasets. The significance of the 2NvS segment in wheat breeding due to resistance to multiple diseases and a positive impact on yield highlights the importance of understanding and characterizing the wheat pan-genome for better insights into molecular breeding for wheat improvement.
- Published
- 2020
14. Genomic prediction of agronomic traits in wheat using different models and cross-validation designs
- Author
-
Pierre Hucl, Sean Walkowiak, John M. Clarke, Ron Knox, Teketel A. Haile, Amidou N’Diaye, Curtis J. Pozniak, and Richard D. Cuthbert
- Subjects
0106 biological sciences ,education.field_of_study ,Breeding program ,Population ,food and beverages ,Small population size ,General Medicine ,Computational biology ,Biology ,Quantitative trait locus ,01 natural sciences ,Cross-validation ,Genetic gain ,Genetics ,Plant breeding ,education ,Agronomy and Crop Science ,Selection (genetic algorithm) ,010606 plant biology & botany ,Biotechnology - Abstract
Genomic predictions across environments and within populations resulted in moderate to high accuracies but across-population genomic prediction should not be considered in wheat for small population size. Genomic selection (GS) is a marker-based selection suggested to improve the genetic gain of quantitative traits in plant breeding programs. We evaluated the effects of training population (TP) composition, cross-validation design, and genetic relationship between the training and breeding populations on the accuracy of GS in spring wheat (Triticum aestivum L.). Two populations of 231 and 304 spring hexaploid wheat lines that were phenotyped for six agronomic traits and genotyped with the wheat 90 K array were used to assess the accuracy of seven GS models (RR-BLUP, G-BLUP, BayesB, BL, RKHS, GS + de novo GWAS, and reaction norm) using different cross-validation designs. BayesB outperformed the other models for within-population genomic predictions in the presence of few quantitative trait loci (QTL) with large effects. However, including fixed-effect marker covariates gave better performance for an across-population prediction when the same QTL underlie traits in both populations. The accuracy of prediction was highly variable based on the cross-validation design, which suggests the importance to use a design that resembles the variation within a breeding program. Moderate to high accuracies were obtained when predictions were made within populations. In contrast, across-population genomic prediction accuracies were very low, suggesting that the evaluated models are not suitable for prediction across independent populations. On the other hand, across-environment prediction and forward prediction designs using the reaction norm model resulted in moderate to high accuracies, suggesting that GS can be applied in wheat to predict the performance of newly developed lines and lines in incomplete field trials.
- Published
- 2020
15. Copy number variation of TdDof controls solid-stemmed architecture in wheat
- Author
-
Peng Gao, Daoquan Xiang, Krystalee Wiebe, Sean Walkowiak, James Simmonds, Jennifer Ens, Curtis J. Pozniak, Richard D. Cuthbert, Amidou N’Diaye, Teagen D. Quilichini, Raju Datla, Ian R. Willick, Brook Byrns, Kirby T. Nilsen, Cristobal Uauy, Yuefeng Ruan, Emma J. Wallington, and Melanie Craze
- Subjects
Programmed cell death ,DNA Copy Number Variations ,Transgene ,Locus (genetics) ,Biology ,Genes, Plant ,chemistry.chemical_compound ,copy number variation (CNW) ,wheat ,solid stem ,Cultivar ,Copy-number variation ,Gene ,Triticum ,Plant Proteins ,Genetics ,Multidisciplinary ,Plant Stems ,Agricultural Sciences ,fungi ,food and beverages ,solid state ,Biological Sciences ,programmed cell death (PCD) ,copy number variation (CNV) ,chemistry ,Dof transcription factor ,Pith ,DNA ,Transcription Factors - Abstract
Significance Solid-stemmed wheat cultivars are resistant to the wheat stem sawfly, an important agricultural pest. Here, we identify TdDof as the causal gene that controls stem solidness in wheat. We show that copy number gain of TdDof correlates with its increased expression and the solid-stem phenotype. Our results suggest TdDof could function as a key regulator of genes involved in programmed cell death of the pith parenchyma cells. This research provides the framework to manipulate stem architecture in wheat and other monocots, which can be applied toward downstream agricultural and industrial applications. These include enhancing wheat stem sawfly resistance, modifying carbon partitioning and water-soluble carbohydrate remobilization in plants under drought and temperature stress, and bioenergy production., Stem solidness is an important agronomic trait of durum (Triticum turgidum L. var. durum) and bread (Triticum aestivum L.) wheat that provides resistance to the wheat stem sawfly. This dominant trait is conferred by the SSt1 locus on chromosome 3B. However, the molecular identity and mechanisms underpinning stem solidness have not been identified. Here, we demonstrate that copy number variation of TdDof, a gene encoding a putative DNA binding with one finger protein, controls the stem solidness trait in wheat. Using map-based cloning, we localized TdDof to within a physical interval of 2.1 Mb inside the SSt1 locus. Molecular analysis revealed that hollow-stemmed wheat cultivars such as Kronos carry a single copy of TdDof, whereas solid-stemmed cultivars such as CDC Fortitude carry multiple identical copies of the gene. Deletion of all TdDof copies from CDC Fortitude resulted in the loss of stem solidness, whereas the transgenic overexpression of TdDof restored stem solidness in the TdDof deletion mutant pithless1 and conferred stem solidness in Kronos. In solid-stemmed cultivars, increased TdDof expression was correlated with the down-regulation of genes whose orthologs have been implicated in programmed cell death (PCD) in other species. Anatomical and histochemical analyses revealed that hollow-stemmed lines had stronger PCD-associated signals in the pith cells compared to solid-stemmed lines, which suggests copy number-dependent expression of TdDof could be directly or indirectly involved in the negative regulation of PCD. These findings provide opportunities to manipulate stem development in wheat and other monocots for agricultural or industrial purposes.
- Published
- 2020
16. Recent Advances in Sequencing of Cereal Genomes
- Author
-
Sean Walkowiak, Curtis J. Pozniak, and Kirby T. Nilsen
- Subjects
Computational biology ,Biology ,Genome - Published
- 2021
17. A High-Throughput Skim-sequencing Approach for Genotyping, Dosage Estimation and Identifying Translocations
- Author
-
D. L. Wilson, Pierre Hucl, Shuanyge Wu, Curtis J. Pozniak, Xiaoyun Wang, Jeffrey C. Glaubitz, Jesse Poland, Laxman Adhikari, Sandesh Shrestha, Dal-Hoe Koo, Yoonha Ju, Lee R. DeHaan, Bernd Friebe, Sean Walkowiak, Jing Wu, Byron Evers, Jared Crain, and Liangliang Gao
- Subjects
Genetic Markers ,Whole genome sequencing ,Multidisciplinary ,Genotype ,Genotyping Techniques ,biology ,High-Throughput Nucleotide Sequencing ,Foundation (evidence) ,Hordeum ,biology.organism_classification ,Polymorphism, Single Nucleotide ,DNA sequencing ,Plant Breeding ,Engineering management ,Work (electrical) ,Political science ,Agency (sociology) ,Thinopyrum intermedium ,International development ,Genotyping ,Genome, Plant ,Triticum - Abstract
The development of next generation sequencing (NGS) enabled a shift from array-based genotyping to high-throughput genotyping by directly sequencing genomic libraries. Even though whole genome sequencing was initially too costly for routine analysis in large populations, such as those utilized for breeding or genetic studies, continued advancements in genome sequencing and bioinformatics have provided the opportunity to utilize whole-genome information. As new sequencing platforms can routinely provide high-quality sequencing data for sufficient genome coverage, a limitation comes in the time and high cost of library construction when multiplexing a large number of samples. Here we describe a high-throughput whole-genome skim-sequencing (skim-seq) approach that can be utilized for a broad range of genotyping and genomic characterization. Using optimized low-volume Illumina Nextera chemistry, we developed a skim-seq method and combined up to 960 samples in one multiplex library using dual index barcoding. With the dual-index barcoding, the number of samples for multiplexing can be adjusted depending on amount of data required and extended to 3,072 samples or more. Panels of double haploid wheat lines (Triticum aestivum, CDC Stanley x CDC Landmark), wheat-barley (T. aestivum x Hordeum vulgare) and wheat-wheatgrass (Triticum durum x Thinopyrum intermedium) introgression lines as well as known monosomic wheat stocks were genotyped using the skim-seq approach. Bioinformatics pipelines were developed for various applications where sequencing coverage ranged from 1x down to 0.01x per sample. Using reference genomes, we detected chromosome dosage, identified aneuploidy, and karyotyped introgression lines from the low coverage skim-seq data. Leveraging the recent advancements in genome sequencing, skim-seq provides an effective and low-cost tool for routine genotyping and genetic analysis, which can track and identify introgressions and genomic regions of interest in genetics research and applied breeding programs.
- Published
- 2021
18. The effects of crop attributes, selection, and recombination on Canadian bread wheat molecular variation
- Author
-
William Hargreaves, Jennifer Enns, Sean Walkowiak, Krystalee Wiebe, Curtis J. Pozniak, Amidou N’Daiye, and Lewis Lukens
- Subjects
0106 biological sciences ,0301 basic medicine ,Germplasm ,Canada ,Linkage disequilibrium ,Breeding program ,Single-nucleotide polymorphism ,Plant Science ,QH426-470 ,Biology ,01 natural sciences ,SB1-1110 ,03 medical and health sciences ,Genotype ,Genetics ,Allele ,Gene ,Triticum ,Recombination, Genetic ,Plant culture ,food and beverages ,Bread ,Plant Breeding ,030104 developmental biology ,Habit (biology) ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
Cultivated germplasm provides an opportunity to investigate how crop agronomic traits, selection for major genes, and differences in crossing‐over rates drive patterns of allelic variation. To identify how these factors correlated with allelic variation within a collection of cultivated bread wheat (Triticum aestivum L.), we generated genotypes for 388 accessions grown in Canada over the past 170 yr using filtered single nucleotide polymorphism (SNP) calls from an Illumina Wheat iSelect 90K SNP‐array. Entries’ breeding program, era of release, grain texture, kernel color, and growth habit contributed to allelic differentiation. Allelic diversity and linkage disequilibrium (LD) of markers flanking some major loci known to affect traits such as gluten strength, growth habit, and grain color were consistent with selective sweeps. Nonetheless, some flanking markers of major loci had low LD and high allelic diversity. Positive selection may have acted upon homoeologous genes that had significant enrichment for the gene ontology terms ‘response‐to‐auxin’ and ‘response‐to‐wounding.’ Long regions of LD, spanning approximately one‐third the length of entire chromosomes, were associated with many pericentromeric regions. These regions were also characterized by low diversity. Enhancing recombination across these regions could generate novel allele combinations to accelerate Canadian wheat improvement.
- Published
- 2021
19. Fusarium Head Blight in Durum Wheat: Recent Status, Breeding Directions, and Future Research Prospects
- Author
-
Jemanesh K. Haile, Hadley R. Kutcher, Curtis J. Pozniak, Hermann Buerstmayr, Barbara Steiner, Sean Walkowiak, John M. Clarke, Kirby T. Nilsen, and Amidou N’Diaye
- Subjects
0106 biological sciences ,0301 basic medicine ,Germplasm ,Fusarium ,Canada ,Plant Science ,Plant disease resistance ,Biology ,01 natural sciences ,03 medical and health sciences ,chemistry.chemical_compound ,Vomitoxin ,Cultivar ,Plant breeding ,Common wheat ,Triticum ,Disease Resistance ,Research ,food and beverages ,biology.organism_classification ,Plant Breeding ,Test weight ,030104 developmental biology ,chemistry ,Agronomy ,Agronomy and Crop Science ,Genome-Wide Association Study ,010606 plant biology & botany - Abstract
Fusarium head blight (FHB) is a major fungal disease affecting wheat production worldwide. Since the early 1990s, FHB, caused primarily by Fusarium graminearum, has become one of the most significant diseases faced by wheat producers in Canada and the United States. The increasing FHB problem is likely due to the increased adoption of conservation tillage practices, expansion of maize production, use of susceptible wheat varieties in rotation, and climate variability. Durum wheat (Triticum turgidum sp. durum) is notorious for its extreme susceptibility to FHB and breeding for resistance is complicated because sources of FHB resistance are rare in the primary gene pool of tetraploid wheat. Losses due to this disease include yield, test weight, seed quality, food and feed quality, and when severe, market access. More importantly, it is the contamination with mycotoxins, such as deoxynivalenol, in Fusarium-infected durum kernels that causes the most serious economic as well as food and feed safety concerns. Several studies and thorough reviews have been published on germplasm development and breeding for FHB resistance and the genetics and genomics of FHB resistance in bread or common wheat (T. aestivum); however, similar reviews have not been conducted in durum wheat. Thus, the aim of this review is to summarize and discuss the recent research efforts to mitigate FHB in durum wheat, including quantitative trait locus mapping, genome-wide association studies, genomic prediction, mutagenesis and characterization of genes and pathways involved in FHB resistance. It also highlights future directions, FHB-resistant germplasm, and the potential role of morphological traits to enhance FHB resistance in durum wheat.
- Published
- 2019
20. Histology and RNA Sequencing Provide Insights Into Fusarium Head Blight Resistance in AAC Tenacious
- Author
-
Maria Antonia Henriquez, Kirby T. Nilsen, Oscar I Molina, Harpinder Randhawa, Raman Dhariwal, Brook Byrns, Sean Walkowiak, Curtis J. Pozniak, and Santosh Kumar
- Subjects
Fusarium ,biology ,Hypha ,QTL ,Inoculation ,food and beverages ,Plant Science ,Fungus ,lcsh:Plant culture ,Plant disease resistance ,biology.organism_classification ,Microbiology ,histology ,resistance ,transcriptomics ,FHB ,breeding ,AAC Tenacious ,Grain quality ,lcsh:SB1-1110 ,Cultivar ,Original Research ,Cell wall thickening - Abstract
Fusarium head blight (FHB) is a serious fungal disease affecting wheat and other cereals worldwide. This fungus causes severe yield and quality losses from a reduction in grain quality and contamination of grain with mycotoxins. Intensive breeding efforts led to the release of AAC Tenacious, which was the first spring wheat cultivar registered in Canada with a resistant (R) rating to FHB. To elucidate the physiological mechanisms of resistance, we performed histological and transcriptomic analyses of AAC Tenacious and a susceptible control Roblin after inoculation with Fusarium graminearum (Fg). The spikelet and rachis of infected wheat spikes were hand sectioned and monitored by confocal and fluorescent microscopy. Visible hyphae were observed within the inoculated spikelets for AAC Tenacious; however, the infection was largely restricted to the point of inoculation (POI), whereas the adjacent florets in Roblin were heavily infected. Significant cell wall thickening within the rachis node below the POI was evident in AAC Tenacious compared to Roblin in response to Fg inoculation. Rachis node and rachilla tissues from the POI and the rachis node below the POI were collected at 5 days post inoculation for RNAseq. Significant changes in gene expression were detected in both cultivars in response to infection. The rachis node below the POI in AAC Tenacious had fewer differentially expressed genes (DEGs) when compared to the uninoculated control, likely due to its increased disease resistance. Analysis of DEGs in Roblin and AAC Tenacious revealed the activation of genes and pathways in response to infection, including those putatively involved in cell wall modification and defense response.
- Published
- 2021
21. Profiling of Bacillus cereus on Canadian grain
- Author
-
Tom Gräfenhan, Janice Bamforth, Niradha Withana Gamage, Sean Walkowiak, Kathryn Bernard, and Tehreem Ashfaq
- Subjects
Microorganism ,Bacillus cereus ,Bacillus ,Pathology and Laboratory Medicine ,Toxicology ,Genome ,Flax ,Invertebrate Genomics ,Medicine and Health Sciences ,Toxins ,Flowering Plants ,Phylogeny ,Triticum ,Genetics ,Multidisciplinary ,Bacterial Genomics ,Microbial Genetics ,Eukaryota ,High-Throughput Nucleotide Sequencing ,Genomics ,Plants ,Bacterial Pathogens ,Cereus ,Medical Microbiology ,Wheat ,Medicine ,Pathogens ,Research Article ,Canada ,Science ,Toxic Agents ,Bacterial Toxins ,Microbial Genomics ,Biology ,Microbiology ,Bacterial Proteins ,Bacterial Genetics ,Grasses ,Microbial Pathogens ,Comparative genomics ,Whole genome sequencing ,Bacteria ,Whole Genome Sequencing ,business.industry ,Organisms ,Biology and Life Sciences ,Computational Biology ,Bacteriology ,Genome Analysis ,biology.organism_classification ,Food safety ,Animal Genomics ,Edible Grain ,business ,Genome, Bacterial - Abstract
Microorganisms that cause foodborne illnesses challenge the food industry; however, environmental studies of these microorganisms on raw grain, prior to food processing, are uncommon. Bacillus cereus sensu lato is a diverse group of bacteria that is common in our everyday environment and occupy a wide array of niches. While some of these bacteria are beneficial to agriculture due to their entomopathogenic properties, others can cause foodborne illness; therefore, characterization of these bacteria is important from both agricultural and food safety standpoints. We performed a survey of wheat and flax grain samples in 2018 (n = 508) and 2017 (n = 636) and discovered that B. cereus was present in the majority of grain samples, as 56.3% and 85.2%, in two years respectively. Whole genome sequencing and comparative genomics of 109 presumptive B. cereus isolates indicates that most of the isolates were closely related and formed two genetically distinct groups. Comparisons to the available genomes of reference strains suggested that the members of these two groups are not closely related to strains previously reported to cause foodborne illness. From the same data set, another, genetically more diverse group of B. cereus was inferred, which had varying levels of similarity to previously reported strains that caused disease. Genomic analysis and PCR amplification of genes linked to toxin production indicated that most of the isolates carry the genes nheA and hbID, while other toxin genes and gene clusters, such as ces, were infrequent. This report of B. cereus on grain from Canada is the first of its kind and demonstrates the value of surveillance of bacteria naturally associated with raw agricultural commodities such as cereal grain and oilseeds.
- Published
- 2021
22. Historic recombination in a durum wheat breeding panel enables high-resolution mapping of Fusarium head blight resistance quantitative trait loci
- Author
-
Jay Ross, Heather L. Campbell, Emma Hsueh, Sean Walkowiak, Santosh Kumar, Yuefeng Ruan, Kerry Boyle, Prabhath Lokuruge, Christine Sidebottom, Curtis J. Pozniak, Richard D. Cuthbert, Asheesh K. Singh, David Konkin, Janet A. Condie, Ehsan Sari, Shawn Yates, Maria Antonia Henriquez, Pierre R. Fobert, Andrew J. Burt, and Ron Knox
- Subjects
0106 biological sciences ,0301 basic medicine ,Linkage disequilibrium ,Plant genetics ,Quantitative Trait Loci ,Population ,lcsh:Medicine ,Genome-wide association study ,Single-nucleotide polymorphism ,Biology ,Quantitative trait locus ,01 natural sciences ,Linkage Disequilibrium ,Article ,Plant breeding ,03 medical and health sciences ,Quantitative Trait, Heritable ,Fusarium ,Genetic Predisposition to Disease ,Selection, Genetic ,Allele ,lcsh:Science ,education ,Genetic Association Studies ,Triticum ,Disease Resistance ,Plant Diseases ,Recombination, Genetic ,Genetics ,education.field_of_study ,Multidisciplinary ,lcsh:R ,Haplotype ,Chromosome Mapping ,food and beverages ,030104 developmental biology ,Host-Pathogen Interactions ,lcsh:Q ,Plant biotechnology ,Plant sciences ,Genome-Wide Association Study ,010606 plant biology & botany - Abstract
The durum wheat line DT696 is a source of moderate Fusarium head blight (FHB) resistance. Previous analysis using a bi-parental population identified two FHB resistance quantitative trait loci (QTL) on chromosome 5A: 5A1 was co-located with a plant height QTL, and 5A2 with a major maturity QTL. A Genome-Wide Association Study (GWAS) of DT696 derivative lines from 72 crosses based on multi-environment FHB resistance, plant height, and maturity phenotypic data was conducted to improve the mapping resolution and further elucidate the genetic relationship of height and maturity with FHB resistance. The Global Tetraploid Wheat Collection (GTWC) was exploited to identify durum wheat lines with DT696 allele and additional recombination events. The 5A2 QTL was confirmed in the derivatives, suggesting the expression stability of the 5A2 QTL in various genetic backgrounds. The GWAS led to an improved mapping resolution rendering the 5A2 interval 10 Mbp shorter than the bi-parental QTL mapping interval. Haplotype analysis using SNPs within the 5A2 QTL applied to the GTWC identified novel haplotypes and recombination breakpoints, which could be exploited for further improvement of the mapping resolution. This study suggested that GWAS of derivative breeding lines is a credible strategy for improving mapping resolution.
- Published
- 2020
23. A haplotype-led approach to increase the precision of wheat breeding
- Author
-
Ricardo H. Ramirez-Gonzalez, Simon Orford, Manuel Spannagl, Jemima Brinton, Curtis J. Pozniak, James Simmonds, Sean Walkowiak, Simon Griffiths, Cristobal Uauy, Georg Haberer, Luzie U. Wingen, and Wheat Genome
- Subjects
0106 biological sciences ,0301 basic medicine ,Plant genetics ,Genotyping Techniques ,QH301-705.5 ,Population ,Medicine (miscellaneous) ,Biology ,01 natural sciences ,Genome ,General Biochemistry, Genetics and Molecular Biology ,Article ,03 medical and health sciences ,Genetic variation ,Biology (General) ,education ,Genotyping ,Triticum ,Genetic diversity ,education.field_of_study ,business.industry ,Haplotype ,Genetic Variation ,food and beverages ,Genomics ,Biotechnology ,Plant Breeding ,030104 developmental biology ,Haplotypes ,General Agricultural and Biological Sciences ,business ,Genome, Plant ,010606 plant biology & botany - Abstract
Crop productivity must increase at unprecedented rates to meet the needs of the growing worldwide population. Exploiting natural variation for the genetic improvement of crops plays a central role in increasing productivity. Although current genomic technologies can be used for high-throughput identification of genetic variation, methods for efficiently exploiting this genetic potential in a targeted, systematic manner are lacking. Here, we developed a haplotype-based approach to identify genetic diversity for crop improvement using genome assemblies from 15 bread wheat (Triticum aestivum) cultivars. We used stringent criteria to identify identical-by-state haplotypes and distinguish these from near-identical sequences (~99.95% identity). We showed that each cultivar shares ~59 % of its genome with other sequenced cultivars and we detected the presence of extended haplotype blocks containing hundreds to thousands of genes across all wheat chromosomes. We found that genic sequence alone was insufficient to fully differentiate between haplotypes, as were commonly used array-based genotyping chips due to their gene centric design. We successfully used this approach for focused discovery of novel haplotypes from a landrace collection and documented their potential for trait improvement in modern bread wheat. This study provides a framework for defining and exploiting haplotypes to increase the efficiency and precision of wheat breeding towards optimising the agronomic performance of this crucial crop., Brinton, Uauy and colleagues utilize genomic data from the 10+ Wheat Genome Project to develop a useful tool for studying and generating new wheat cultivars. This framework uses advanced exploitation of wheat haplotypes to bring newfound precision and efficiency to wheat breeding.
- Published
- 2020
24. Chromosome-scale genome assembly provides insights into rye biology, evolution, and agronomic potential
- Author
-
D. Brian Fowler, Jens Keilwagen, Sudharsan Padmarasu, Monika Rakoczy-Trojanowska, Thomas Lux, Andreas Börner, David Swarbreck, Mariana Báez, Curtis J. Pozniak, Frank Ordon, Allan K. Fritz, Andreas Houben, Uğur Sesiz, Viktor Korzun, Ian Small, Jesse Poland, André Laroche, Heidrun Gundlach, Alan H. Schulman, Anthony Hall, Gemy Kaithakottil, Hakan Özkan, Jizeng Jia, Klaus F. X. Mayer, Martin Mascher, Jaroslav Doležel, Xue-Feng Ma, M. Timothy Rabanus-Wallace, Sezgi Biyiklioglu-Kaya, Bernd Hackauf, Matthias Heuberger, Mona Schreiber, Beat Keller, Helena Toegelová, Jan Vrána, Hikmet Budak, Burkhard Steuernagel, Coraline R. Praz, Axel Himmelbach, Uwe Scholz, Vijay K. Tiwari, Anatoly V. Voylokov, Nidhi Rawat, Brook Byrns, Joanna Melonek, David Konkin, Nils Stein, Hanna Bolibok-Bragoszewska, Jana Čížková, Hana Šimková, Sean Walkowiak, Brande B. H. Wulff, Eva Bauer, Stefan Stojałowski, Jamie Larsen, Beata Myśków, Manuel Spannagl, Natalia Tsvetkova, Andy Sharpe, Qiang Li, Liangliang Guo, Thomas Wicker, Dörthe Siekmann, Institute of Biotechnology, Biosciences, and Viikki Plant Science Centre (ViPS)
- Subjects
Crops, Agricultural ,0106 biological sciences ,Secale ,Plant genetics ,Karyotype ,Introgression ,Sequence assembly ,Retrotransposon ,Genetic Introgression ,01 natural sciences ,Genome ,genomics ,plant genetics ,plant breeding ,Article ,Plant breeding ,4111 Agronomy ,03 medical and health sciences ,Gene Expression Regulation, Plant ,Stress, Physiological ,Genetics ,Gene family ,Plant Immunity ,Domestication ,Triticeae ,Gene ,Triticum ,Plant Proteins ,030304 developmental biology ,2. Zero hunger ,0303 health sciences ,biology ,digestive, oral, and skin physiology ,Chromosome Mapping ,food and beverages ,Chromosome ,Genomics ,Triticale ,11831 Plant biology ,biology.organism_classification ,Adaptation, Physiological ,ddc ,Evolutionary biology ,Gene pool ,Genetic isolate ,Genome, Plant ,010606 plant biology & botany - Abstract
Rye (Secale cereale L.) is an exceptionally climate-resilient cereal crop, used extensively to produce improved wheat varieties via introgressive hybridization and possessing the entire repertoire of genes necessary to enable hybrid breeding. Rye is allogamous and only recently domesticated, thus giving cultivated ryes access to a diverse and exploitable wild gene pool. To further enhance the agronomic potential of rye, we produced a chromosome-scale annotated assembly of the 7.9-gigabase rye genome and extensively validated its quality by using a suite of molecular genetic resources. We demonstrate applications of this resource with a broad range of investigations. We present findings on cultivated rye’s incomplete genetic isolation from wild relatives, mechanisms of genome structural evolution, pathogen resistance, low-temperature tolerance, fertility control systems for hybrid breeding and the yield benefits of rye–wheat introgressions., A chromosome-scale genome assembly of rye inbred line ‘Lo7’ provides insights into its incomplete genetic isolation from wild relatives, mechanisms of genome structural evolution and the yield benefits of rye–wheat introgressions.
- Published
- 2019
25. Genomic prediction of agronomic traits in wheat using different models and cross-validation designs
- Author
-
Teketel A, Haile, Sean, Walkowiak, Amidou, N'Diaye, John M, Clarke, Pierre J, Hucl, Richard D, Cuthbert, Ron E, Knox, and Curtis J, Pozniak
- Subjects
Polyploidy ,Plant Breeding ,Genetics, Population ,Phenotype ,Genotype ,Models, Genetic ,Quantitative Trait Loci ,Genomics ,Genetic Association Studies ,Triticum - Abstract
Genomic predictions across environments and within populations resulted in moderate to high accuracies but across-population genomic prediction should not be considered in wheat for small population size. Genomic selection (GS) is a marker-based selection suggested to improve the genetic gain of quantitative traits in plant breeding programs. We evaluated the effects of training population (TP) composition, cross-validation design, and genetic relationship between the training and breeding populations on the accuracy of GS in spring wheat (Triticum aestivum L.). Two populations of 231 and 304 spring hexaploid wheat lines that were phenotyped for six agronomic traits and genotyped with the wheat 90 K array were used to assess the accuracy of seven GS models (RR-BLUP, G-BLUP, BayesB, BL, RKHS, GS + de novo GWAS, and reaction norm) using different cross-validation designs. BayesB outperformed the other models for within-population genomic predictions in the presence of few quantitative trait loci (QTL) with large effects. However, including fixed-effect marker covariates gave better performance for an across-population prediction when the same QTL underlie traits in both populations. The accuracy of prediction was highly variable based on the cross-validation design, which suggests the importance to use a design that resembles the variation within a breeding program. Moderate to high accuracies were obtained when predictions were made within populations. In contrast, across-population genomic prediction accuracies were very low, suggesting that the evaluated models are not suitable for prediction across independent populations. On the other hand, across-environment prediction and forward prediction designs using the reaction norm model resulted in moderate to high accuracies, suggesting that GS can be applied in wheat to predict the performance of newly developed lines and lines in incomplete field trials.
- Published
- 2019
26. Machine learning analyses of methylation profiles uncovers tissue-specific gene expression patterns in wheat
- Author
-
Aron T. Cory, Curtis J. Pozniak, Andrew G. Sharpe, Stephen J. Robinson, Sean Walkowiak, Amidou N’Diaye, Kirby T. Nilsen, and Brook Byrns
- Subjects
0106 biological sciences ,0301 basic medicine ,lcsh:QH426-470 ,Plant Science ,Biology ,lcsh:Plant culture ,Machine learning ,computer.software_genre ,01 natural sciences ,Epigenesis, Genetic ,Machine Learning ,03 medical and health sciences ,Transcription (biology) ,Gene expression ,Genetics ,lcsh:SB1-1110 ,Epigenetics ,Promoter Regions, Genetic ,Gene ,Triticum ,Regulation of gene expression ,business.industry ,Tissue-Specific Gene Expression ,Methylation ,DNA Methylation ,lcsh:Genetics ,030104 developmental biology ,DNA methylation ,Artificial intelligence ,business ,Agronomy and Crop Science ,computer ,010606 plant biology & botany - Abstract
DNA methylation is a mechanism of epigenetic modification in eukaryotic organisms. Generally, methylation within genes promoter inhibits regulatory protein binding and represses transcription, whereas gene body methylation is associated with actively transcribed genes. However, it remains unclear whether there is interaction between methylation levels across genic regions and which site has the biggest impact on gene regulation. We investigated and used the methylation patterns of the bread wheat cultivar Chinese Spring to uncover differentially expressed genes (DEGs) between roots and leaves, using six machine learning algorithms and a deep neural network. As anticipated, genes with higher expression in leaves were mainly involved in photosynthesis and pigment biosynthesis processes whereas genes that were not differentially expressed between roots and leaves were involved in protein processes and membrane structures. Methylation occurred preponderantly (60%) in the CG context, whereas 35 and 5% of methylation occurred in CHG and CHH contexts, respectively. Methylation levels were highly correlated (r = 0.7 to 0.9) between all genic regions, except within the promoter (r = 0.4 to 0.5). Machine learning models gave a high (0.81) prediction accuracy of DEGs. There was a strong correlation (p‐value = 9.20×10−10) between all features and gene expression, suggesting that methylation across all genic regions contribute to gene regulation. However, the methylation of the promoter, the CDS and the exon in CG context was the most impactful. Our study provides more insights into the interplay between DNA methylation and gene expression and paves the way for identifying tissue‐specific genes using methylation profiles.
- Published
- 2019
27. Mapping of Genetic Loci Conferring Resistance to Leaf Rust From Three Globally Resistant Durum Wheat Sources
- Author
-
Karim Ammar, Alexander Loladze, Amidou N’Diaye, Kirby T. Nilsen, Dhouha Kthiri, Susanne Dreisigacker, Sean Walkowiak, and Curtis J. Pozniak
- Subjects
0106 biological sciences ,0301 basic medicine ,Candidate gene ,Population ,Single-nucleotide polymorphism ,Plant Science ,lcsh:Plant culture ,Quantitative trait locus ,Plant disease resistance ,01 natural sciences ,Rust ,resistance ,leaf rust ,03 medical and health sciences ,Wheat leaf rust ,single nucleotide polymorphism (SNP) ,lcsh:SB1-1110 ,education ,Original Research ,Genetics ,education.field_of_study ,biology ,durum wheat ,food and beverages ,Puccinia triticina ,biology.organism_classification ,030104 developmental biology ,quantitative trait loci ,Puccinia recondita ,010606 plant biology & botany - Abstract
Genetic resistance in the host plant is the most economical and environmentally friendly strategy for controlling wheat leaf rust, caused by Puccinia triticina Eriks. The durum wheat lines Gaza (Middle East), Arnacoris (France) and Saragolla (Italy) express high levels of resistance to the Mexican races of P. triticina. Three recombinant inbred line (RIL) populations, derived from crosses of each of these resistance sources to the susceptible line ATRED #2, were evaluated for leaf rust reactions at CIMMYT’s leaf rust nurseries in Mexico. Genetic analyses of host reactions suggested oligogenic control of resistance in all populations. The F8 RILs from each cross were genotyped using the Illumina iSelect 90K array, and high-density genetic maps were constructed for each population. Using composite interval mapping, a total of seven quantitative trait loci (QTL) that provide resistance to leaf rust were identified. Two QTL designated as QLr.usw-6BS and QLr.usw-6BL were identified on chromosome 6B in Gaza, which explained up to 78.5% and 21.3% of the observed leaf rust severity variance, respectively. A major QTL designated as QLr.usw-7BL was detected on the long arm of chromosome 7B in Arnacoris, which accounted for up to 65.9% of the disease severity variance. Arnacoris also carried a minor QTL on chromosome 1BL, designated as QLr.usw-1BL.1 that explained up to 17.7% of the phenotypic variance. Three QTL conferred leaf rust resistance in Saragolla, namely QLr.usw-2BS, QLr.usw-3B, and QLr.usw-1BL.2, which accounted for up to 42.3, 9.4, and 7.1% of the phenotypic variance, respectively. Markers flanking each QTL were physically mapped against the durum wheat reference sequence and candidate genes involved in disease resistance were identified within the QTL intervals. The QTL identified in this study and their closely linked markers are useful resources for gene pyramiding and breeding for durable leaf rust resistance in durum wheat.
- Published
- 2019
28. Durum wheat genome highlights past domestication signatures and future improvement targets
- Author
-
Ron MacLachlan, Elisabetta Frascaroli, Nils Stein, Matteo Gnocchi, Sven Twardziok, Heidrun Gundlach, Daniela Marone, Arthur T. O. Melo, Marco Moscatelli, Gabriella Sonnante, Steven S. Xu, Roberto Tuberosa, Silvio Salvi, Sean Walkowiak, Raz Avni, Axel Himmelbach, E. Mica, Reem Joukhadar, Raj K. Pasam, Jasline Deek, Marco Maccaferri, Andrew G. Sharpe, Domenica Nigro, Aldo Ceriotti, Sezgi Biyiklioglu, Ron Knox, Paolo Cozzi, Curtis J. Pozniak, Gregory J. Taylor, Kevin Y. H. Liang, Caterina Marè, Hakan Özkan, Nicola Pecchioni, Anna M. Mastrangelo, Verena M. Prade, Alessandra Stella, Sara Giulia Milner, Martin Mascher, Iago Hale, Luigi Cattivelli, Krystalee Wiebe, Shiaoman Chao, Elisabetta Mazzucotelli, Klaus F. X. Mayer, Michael O. Pumphrey, Agata Gadaleta, Jennifer Ens, Pasquale De Vita, Assaf Distelfeld, Thomas Lux, Cristina Crosatti, Massimiliano Lauria, Chu Shin Koh, Luciano Milanesi, Neil S. Harris, Barbara Lazzari, Simona Corneti, Matthew J. Hayden, Paolo Bagnaresi, Benjamin Kilian, Justin D. Faris, John M. Clarke, Andrea Manconi, Manuel Spannagl, Francesca Desiderio, Primetta Faccioli, Danara Ormanbekova, Hikmet Budak, Çukurova Üniversitesi, Maccaferri M., Harris N.S., Twardziok S.O., Pasam R.K., Gundlach H., Spannagl M., Ormanbekova D., Lux T., Prade V.M., Milner S.G., Himmelbach A., Mascher M., Bagnaresi P., Faccioli P., Cozzi P., Lauria M., Lazzari B., Stella A., Manconi A., Gnocchi M., Moscatelli M., Avni R., Deek J., Biyiklioglu S., Frascaroli E., Corneti S., Salvi S., Sonnante G., Desiderio F., Mare C., Crosatti C., Mica E., Ozkan H., Kilian B., De Vita P., Marone D., Joukhadar R., Mazzucotelli E., Nigro D., Gadaleta A., Chao S., Faris J.D., Melo A.T.O., Pumphrey M., Pecchioni N., Milanesi L., Wiebe K., Ens J., MacLachlan R.P., Clarke J.M., Sharpe A.G., Koh C.S., Liang K.Y.H., Taylor G.J., Knox R., Budak H., Mastrangelo A.M., Xu S.S., Stein N., Hale I., Distelfeld A., Hayden M.J., Tuberosa R., Walkowiak S., Mayer K.F.X., Ceriotti A., Pozniak C.J., and Cattivelli L.
- Subjects
Adenosine Triphosphatase ,Triticum turgidum ssp. durum ,Quantitative Trait Loci ,Locus (genetics) ,Biology ,Genome ,Polymorphism, Single Nucleotide ,Synteny ,Chromosomes, Plant ,Chromosomes ,Domestication ,03 medical and health sciences ,0302 clinical medicine ,Adenosine Triphosphatases ,Cadmium ,Genetic Variation ,Genome, Plant ,Phylogeny ,Plant Breeding ,Plant Proteins ,Selection, Genetic ,Tetraploidy ,Triticum ,Genetic ,Genetic variation ,Genetics ,Plant breeding ,Polymorphism ,Selection ,030304 developmental biology ,2. Zero hunger ,0303 health sciences ,Genetic diversity ,cadmium accumulation ,Plant Protein ,food and beverages ,Plant ,Single Nucleotide ,ddc ,Genetic divergence ,genome sequencing ,030217 neurology & neurosurgery - Abstract
PubMedID: 30962619 The domestication of wild emmer wheat led to the selection of modern durum wheat, grown mainly for pasta production. We describe the 10.45 gigabase (Gb) assembly of the genome of durum wheat cultivar Svevo. The assembly enabled genome-wide genetic diversity analyses revealing the changes imposed by thousands of years of empirical selection and breeding. Regions exhibiting strong signatures of genetic divergence associated with domestication and breeding were widespread in the genome with several major diversity losses in the pericentromeric regions. A locus on chromosome 5B carries a gene encoding a metal transporter (TdHMA3-B1) with a non-functional variant causing high accumulation of cadmium in grain. The high-cadmium allele, widespread among durum cultivars but undetected in wild emmer accessions, increased in frequency from domesticated emmer to modern durum wheat. The rapid cloning of TdHMA3-B1 rescues a wild beneficial allele and demonstrates the practical use of the Svevo genome for wheat improvement. © 2019, The Author(s), under exclusive licence to Springer Nature America, Inc. Western Grains Research Foundation Ministry of Agriculture - Saskatchewan Israel Science Foundation: 1137/17 031A536 FP7 Food, Agriculture and Fisheries, Biotechnology: DROPS ID244347 Natural Sciences and Engineering Research Council of Canada InterOmics PB05 Genome Prairie United States-Israel Binational Science Foundation: 2015409 Genome Canada Saskatchewan Canola Development Commission 2819103915 PIR01_00017 3060-21000-038-00-D We acknowledge the funding support of: the Italian Ministry of Education and Research with projects CNR Flagship InterOmics PB05 (L.M., A.C., G.S.), PON ELIXIR CNR-BiOmics PIR01_00017 (L.M., M.G., M.Mo.) and PON ISCOCEM (P.D.); CREA project Interomics (L.C.); Fondazione in rete per la ricerca agroalimentare AGER project From Seed to Pasta (R.T.); FP7-KBBE Project DROPS ID244347 (R.T.); Genome Canada (A.G.S., C.P.); the Western Grain Research Foundation (A.G.S., C.P.); the Manitoba Wheat and Barley Commission (A.G.S., C.P.); the Saskatchewan Wheat Development Commission (A.G.S., C.P.); the Alberta Wheat Development Commission (A.G.S., C.P.); the Saskatchewan Ministry of Agriculture (A.G.S., C.P.); the administrative support of Genome Prairie (A.G.S., C.P.); Canadian Triticum Applied Genomics -CTAG2-(A.G.S., C.P.); Binational Science Foundation grant no. 2015409 (I.H., A.D.); Israel Science Foundation grant no. 1137/17 (A.D.); USDA-Agricultural Research Service Current Research Information System project 3060-21000-038-00-D (J.D.F., S.S.X.); German Federal Ministry of Food and Agriculture grant no. 2819103915 (N.S., K.F.X.M.); German Ministry of Education and Research grant no. 031A536 (K.F.X.M.); and Natural Sciences and Engineering Council of Canada grant nos. SPG 336119-06 and RGPIN 92787 (G.J.T., C.P.). The authors are grateful to E. Elias (North Dakota State University) for providing nine DW cultivars, included in the Global Tetraploid Wheat Collection and E. Scarpella (University of Alberta, Edmonton, Canada) for assistance with confocal microscopy.
- Published
- 2019
29. Haplotype Loci Under Selection in Canadian Durum Wheat Germplasm Over 60 Years of Breeding: Association With Grain Yield, Quality Traits, Protein Loss, and Plant Height
- Author
-
Amidou N’Diaye, Asheesh K. Singh, John M. Clarke, Kirby T. Nilsen, Fran R. Clarke, Curtis J. Pozniak, Jemanesh K. Haile, Sean Walkowiak, and Yuefeng Ruan
- Subjects
0106 biological sciences ,0301 basic medicine ,Germplasm ,haplotype ,protein loss ,Genome Scan ,Locus (genetics) ,Single-nucleotide polymorphism ,Plant Science ,Biology ,lcsh:Plant culture ,01 natural sciences ,quality traits ,plant height ,03 medical and health sciences ,lcsh:SB1-1110 ,Allele ,Genetic association ,Original Research ,Genetics ,Genetic diversity ,grain yield ,Haplotype ,food and beverages ,durum wheat ,030104 developmental biology ,loci under selection ,010606 plant biology & botany - Abstract
Durum wheat was introduced in the southern prairies of western Canada in the late nineteenth century. Breeding efforts have mainly focused on improving quality traits to meet the pasta industry demands. For this study, 192 durum wheat lines were genotyped using the Illumina 90K Infinium iSelect assay, and resulted in a total of 14,324 polymorphic SNPs. Genetic diversity changed over time, declining during the first 20 years of breeding in Canada, then increased in the late 1980s and early 1990s. We scanned the genome for signatures of selection, using the total variance Fst-based outlier detection method (Lositan), the hierarchical island model (Arlequin) and the Bayesian genome scan method (BayeScan). A total of 407 outliers were identified and clustered into 84 LD-based haplotype loci, spanning all 14 chromosomes of the durum wheat genome. The association analysis detected 54 haplotype loci, of which 39% contained markers with a complete reversal of allelic state. This tendency to fixation of favorable alleles corroborates the success of the Canadian durum wheat breeding programs over time. Twenty-one haplotype loci were associated with multiple traits. In particular, hap_4B_1 explained 20.6, 17.9 and 16.6% of the phenotypic variance of pigment loss, pasta b∗ and dough extensibility, respectively. The locus hap_2B_9 explained 15.9 and 17.8% of the variation of protein content and protein loss, respectively. All these pleiotropic haplotype loci offer breeders the unique opportunity for further improving multiple traits, facilitating marker-assisted selection in durum wheat, and could help in identifying genes as functional annotations of the wheat genome become available.
- Published
- 2018
- Full Text
- View/download PDF
30. Intraspecies Interaction of Fusarium graminearum Contributes to Reduced Toxin Production and Virulence
- Author
-
Sean Walkowiak, Owen Rowland, Li Wang, Christopher Thomas Bonner, Rajagopal Subramaniam, and Barbara A. Blackwell
- Subjects
Fusarium ,Physiology ,Trichothecene ,Virulence ,Microbiology ,Fungal Proteins ,chemistry.chemical_compound ,Species Specificity ,Gene Expression Regulation, Fungal ,Mycotoxin ,Gene ,Triticum ,biology ,Reverse Transcriptase Polymerase Chain Reaction ,Sequence Analysis, RNA ,Gene Expression Profiling ,fungi ,Fungal genetics ,food and beverages ,General Medicine ,Pathogenic fungus ,biology.organism_classification ,chemistry ,Host-Pathogen Interactions ,Microbial Interactions ,Genome, Fungal ,Transcriptome ,Trichothecenes ,Agronomy and Crop Science ,Bacteria - Abstract
Fusarium graminearum is a pathogenic fungus that causes Fusarium head blight in wheat and lowers the yield and quality of grains by contamination with the trichothecene mycotoxin deoxynivalenol. The fungi coexist and interact with several different fusaria as well as other plant pathogenic fungi and bacteria in the field. In Canada, F. graminearum exists as two main trichothecene chemotypes: 3-acetyldeoxynivalenol and 15-acetyldeoxynivalenol. To understand the potential interactions between two isolates of these chemotypes, we conducted coinoculation studies both in culture and in planta. The studies showed that intraspecies interaction reduces trichothecene yield in culture and disease symptoms in wheat. To elucidate the genes involved in the intraspecies interaction, expression profiling was performed on RNA samples isolated from coinoculated cultures, and potential genes were identified by using the genome sequences of the respective isolates.
- Published
- 2015
31. Characterization of a virulence gene responsive to nitrogen stress in Fusarium graminearum
- Author
-
Sean Walkowiak
- Published
- 2018
32. Whole Genome Sequencing and Comparative Genomics of Fusarium Head Blight Fungi
- Author
-
Sean Walkowiak
- Published
- 2018
33. Genetic analysis of resistance to stripe rust in durum wheat (Triticum turgidum L. var. durum)
- Author
-
Ron Knox, Aron T. Cory, Julio Huerta-Espino, Karim Ammar, Xue Lin, Hadley R. Kutcher, Sean Walkowiak, Pierre R. Fobert, Amidou N’Diaye, Curtis J. Pozniak, Andrew G. Sharpe, Kirby T. Nilsen, Yuefeng Ruan, Jemanesh K. Haile, Alexander Loladze, John M. Clarke, and Zhang, Aimin
- Subjects
0106 biological sciences ,0301 basic medicine ,Germplasm ,Candidate gene ,Canada ,Population ,Quantitative Trait Loci ,lcsh:Medicine ,Plant disease resistance ,Quantitative trait locus ,Biology ,Haploidy ,Genes, Plant ,01 natural sciences ,Genetic analysis ,Polymorphism, Single Nucleotide ,Chromosomes, Plant ,03 medical and health sciences ,Plant breeding ,lcsh:Science ,education ,Mexico ,Triticum ,Disease Resistance ,Plant Diseases ,Genetics ,education.field_of_study ,Multidisciplinary ,Basidiomycota ,lcsh:R ,Chromosome Mapping ,food and beverages ,Plant Breeding ,030104 developmental biology ,Phenotype ,Doubled haploidy ,lcsh:Q ,010606 plant biology & botany - Abstract
Stripe rust, caused by the fungal pathogen Puccinia striiformis Westend. f. sp. tritici Eriks, is an important disease of bread wheat (Triticum aestivum L.) worldwide and there is an indication that it may also become a serious disease of durum wheat (T. turgidum L. var. durum). Therefore, we investigated the genetic architecture underlying resistance to stripe rust in adapted durum wheat germplasm. Wheat infection assays were conducted under controlled conditions in Canada and under field conditions in Mexico. Disease assessments were performed on a population of 155 doubled haploid (DH) lines derived from the cross of Kofa (susceptible) and W9262-260D3 (moderately resistant) and on a breeding panel that consisted of 92 diverse cultivars and breeding lines. Both populations were genotyped using the 90K single-nucleotide polymorphism (SNP) iSelect assay. In the DH population, QTL for stripe rust resistance were identified on chromosome 7B (LOD 6.87-11.47) and chromosome 5B (LOD 3.88-9.17). The QTL for stripe rust resistance on chromosome 7B was supported in the breeding panel. Both QTL were anchored to the genome sequence of wild emmer wheat, which identified gene candidates involved in disease resistance. Exome capture sequencing identified variation in the candidate genes between Kofa and W9262-260D3. These genetic insights will be useful in durum breeding to enhance resistance to stripe rust.
- Published
- 2018
34. Characterization and mapping of leaf rust resistance in four durum wheat cultivars
- Author
-
Alexander Loladze, Amidou N’Diaye, Susanne Dreisigacker, Curtis J. Pozniak, Dhouha Kthiri, Karim Ammar, Kirby T. Nilsen, P. R. MacLachlan, and Sean Walkowiak
- Subjects
0106 biological sciences ,0301 basic medicine ,Leaves ,Genetic Linkage ,lcsh:Medicine ,Plant Science ,01 natural sciences ,Genotype ,lcsh:Science ,Triticum ,Disease Resistance ,Genetics ,Multidisciplinary ,Plant Anatomy ,Chromosome Mapping ,Eukaryota ,food and beverages ,Agriculture ,Plants ,Phenotype ,Wheat ,Research Article ,Genotyping ,Single-nucleotide polymorphism ,Crops ,Plant disease resistance ,Biology ,Genes, Plant ,Research and Analysis Methods ,Polymorphism, Single Nucleotide ,Molecular Genetics ,03 medical and health sciences ,Gene mapping ,Species Specificity ,Genetic linkage ,Plant breeding ,Grasses ,Molecular Biology Techniques ,Linkage Mapping ,Molecular Biology ,Plant Diseases ,Gene Mapping ,lcsh:R ,Bulked segregant analysis ,Organisms ,Biology and Life Sciences ,Plant Breeding ,030104 developmental biology ,Genetic marker ,lcsh:Q ,010606 plant biology & botany ,Crop Science ,Cereal Crops - Abstract
Widening the genetic basis of leaf rust resistance is a primary objective of the global durum wheat breeding effort at the International Wheat and Maize Improvement Center (CIMMYT). Breeding programs in North America are following suit, especially after the emergence of new races of Puccinia triticina such as BBG/BP and BBBQD in Mexico and the United States, respectively. This study was conducted to characterize and map previously undescribed genes for leaf rust resistance in durum wheat and to develop reliable molecular markers for marker-assisted breeding. Four recombinant inbred line (RIL) mapping populations derived from the resistance sources Amria, Byblos, Geromtel_3 and Tunsyr_2, which were crossed to the susceptible line ATRED #2, were evaluated for their reaction to the Mexican race BBG/BP of P. triticina. Genetic analyses of host reactions indicated that leaf rust resistance in these genotypes was based on major seedling resistance genes. Allelism tests among resistant parents supported that Amria and Byblos carried allelic or closely linked genes. The resistance in Geromtel_3 and Tunsyr_2 also appeared to be allelic. Bulked segregant analysis using the Infinium iSelect 90K single nucleotide polymorphism (SNP) array identified two genomic regions for leaf rust resistance; one on chromosome 6BS for Geromtel_3 and Tunsyr_2 and the other on chromosome 7BL for Amria and Byblos. Polymorphic SNPs identified within these regions were converted to kompetitive allele-specific PCR (KASP) assays and used to genotype the RIL populations. KASP markers usw215 and usw218 were the closest to the resistance genes in Geromtel_3 and Tunsyr_2, while usw260 was closely linked to the resistance genes in Amria and Byblos. DNA sequences associated with these SNP markers were anchored to the wild emmer wheat (WEW) reference sequence, which identified several candidate resistance genes. The molecular markers reported herein will be useful to effectively pyramid these resistance genes with other previously marked genes into adapted, elite durum wheat genotypes.
- Published
- 2018
35. Leucine metabolism regulatesTRI6expression and affects deoxynivalenol production and virulence inFusarium graminearum
- Author
-
Rajagopal Subramaniam, Thérèse Ouellet, Swara Narayanan, Hélène Rocheleau, Manisha Joshi, Linda J. Harris, Li Wang, and Sean Walkowiak
- Subjects
Gene expression profiling ,Metabolic pathway ,Biochemistry ,Trichothecene ,Gene cluster ,Transcriptional regulation ,Regulator ,food and beverages ,Virulence ,Biology ,Leucine ,Molecular Biology ,Microbiology - Abstract
TRI6 is a positive regulator of the trichothecene gene cluster and the production of trichothecene mycotoxins [deoxynivalenol (DON)] and acetylated forms such as 15-Acetyl-DON) in the cereal pathogen Fusarium graminearum. As a global transcriptional regulator, TRI6 expression is modulated by nitrogen-limiting conditions, sources of nitrogen and carbon, pH and light. However, the mechanism by which these diverse environmental factors affect TRI6 expression remains underexplored. In our effort to understand how nutrients affect TRI6 regulation, comparative digital expression profiling was performed with a wild-type F. graminearum and a Δtri6 mutant strain, grown in nutrient-rich conditions. Analysis showed that TRI6 negatively regulates genes of the branched-chain amino acid (BCAA) metabolic pathway. Feeding studies with deletion mutants of MCC, encoding methylcrotonyl-CoA-carboxylase, one of the key enzymes of leucine metabolism, showed that addition of leucine specifically down-regulated TRI6 expression and reduced 15-ADON accumulation. Constitutive expression of TRI6 in the Δmcc mutant strain restored 15-ADON production. A combination of cellophane breach assays and pathogenicity experiments on wheat demonstrated that disrupting the leucine metabolic pathway significantly reduced disease. These findings suggest a complex interaction between one of the primary metabolic pathways with a global regulator of mycotoxin biosynthesis and virulence in F. graminearum.
- Published
- 2015
36. A nitrogen-responsive gene affects virulence inFusarium graminearum
- Author
-
Rajagopal Subramaniam and Sean Walkowiak
- Subjects
Fusarium ,biology ,Toxin ,Virulence ,Plant Science ,biology.organism_classification ,medicine.disease_cause ,Microbiology ,Glutamine ,chemistry.chemical_compound ,chemistry ,Biosynthesis ,Gene expression ,medicine ,Mycotoxin ,Agronomy and Crop Science ,Gene - Abstract
Emerging models indicate that nitrogen availability is an important environmental cue for the induction of virulence in pathogenic fungi. This study explored gene expression patterns of the nitrogen-responsive gene FGSG_03881 and its role in virulence and toxin production in Fusarium graminearum. Using transcriptional fusion pFGSG_03881::GFP, we showed that FGSG_03881 exhibits differential expression profiles in 22 different nitrogen compounds. Since the growth patterns of the fungus also change under these conditions, a mathematical equation was derived to normalize the growth with the expression of FGSG_03881. We determined that expression of FGSG_03881 increased in the non-preferred sources of nitrogen, and decreased in the preferred nitrogen sources like glutamine. Additionally, we determined that this gene is neither linked to the biosynthesis of the mycotoxin DON nor regulated by the global regulator Tri6. Disruption of FGSG_03881 also resulted in increased infection and disease symptoms on ...
- Published
- 2014
37. Characterization of NADPH oxidase genesNoxAandNoxBinFusarium graminearum
- Author
-
Sean Walkowiak, Manisha Joshi, Christopher D. Mogg, Li Wang, and Rajagopal Subramaniam
- Subjects
Enzyme complex ,NADPH oxidase ,biology ,Superoxide ,Protein subunit ,Mutant ,Virulence ,Plant Science ,chemistry.chemical_compound ,Biochemistry ,chemistry ,hemic and lymphatic diseases ,biology.protein ,Agronomy and Crop Science ,Gene ,Mycelium - Abstract
The multicomponent NADPH oxidase enzyme complex (Nox) converts molecular oxygen in a stepwise reduction to superoxides leading to the production of H2O2. This study characterized the role of the catalytic subunit (gp91phox) of Nox, NoxA and NoxB in F. graminearum. Targeted deletion of the genes NoxA and NoxB show that they differentially regulate the production of superoxides during mycelial development. The nitro blue tetrazolium staining method revealed that both the single noxA mutant and the double noxA/B mutant strains are restricted in the production of superoxides. This limitation, however, did not affect their ability to synthesize 15-ADON in culture. Deletion analyses also revealed that NoxA, but not NoxB, is involved in perithecia development and ascospore production. An in-vitro based cellophane breach assay indicated that both NoxA and NoxB contribute to virulence. The pathogenicity tests performed on a susceptible variety of wheat, ‘Roblin’, confirmed that these two genes act synergis...
- Published
- 2014
38. Leucine metabolism regulates TRI6 expression and affects deoxynivalenol production and virulence in Fusarium graminearum
- Author
-
Rajagopal, Subramaniam, Swara, Narayanan, Sean, Walkowiak, Li, Wang, Manisha, Joshi, Hélène, Rocheleau, Thérèse, Ouellet, and Linda J, Harris
- Subjects
Fungal Proteins ,Carbon-Carbon Ligases ,Fusarium ,Genotype ,Leucine ,Gene Expression Regulation, Fungal ,Multigene Family ,Mutation ,Trichothecenes ,Amino Acids, Branched-Chain ,Metabolic Networks and Pathways ,Triticum ,Transcription Factors - Abstract
TRI6 is a positive regulator of the trichothecene gene cluster and the production of trichothecene mycotoxins [deoxynivalenol (DON)] and acetylated forms such as 15-Acetyl-DON) in the cereal pathogen Fusarium graminearum. As a global transcriptional regulator, TRI6 expression is modulated by nitrogen-limiting conditions, sources of nitrogen and carbon, pH and light. However, the mechanism by which these diverse environmental factors affect TRI6 expression remains underexplored. In our effort to understand how nutrients affect TRI6 regulation, comparative digital expression profiling was performed with a wild-type F. graminearum and a Δtri6 mutant strain, grown in nutrient-rich conditions. Analysis showed that TRI6 negatively regulates genes of the branched-chain amino acid (BCAA) metabolic pathway. Feeding studies with deletion mutants of MCC, encoding methylcrotonyl-CoA-carboxylase, one of the key enzymes of leucine metabolism, showed that addition of leucine specifically down-regulated TRI6 expression and reduced 15-ADON accumulation. Constitutive expression of TRI6 in the Δmcc mutant strain restored 15-ADON production. A combination of cellophane breach assays and pathogenicity experiments on wheat demonstrated that disrupting the leucine metabolic pathway significantly reduced disease. These findings suggest a complex interaction between one of the primary metabolic pathways with a global regulator of mycotoxin biosynthesis and virulence in F. graminearum.
- Published
- 2015
39. High density mapping and haplotype analysis of the major stem-solidness locus SSt1 in durum and common wheat
- Author
-
Robert J. Graf, Yuefeng Ruan, Assaf Distelfeld, Curtis J. Pozniak, Sean Walkowiak, John M. Clarke, Ron Knox, P. R. MacLachlan, Brian L. Beres, Richard D. Cuthbert, Andrew G. Sharpe, Aron T. Cory, Fran R. Clarke, Kirby T. Nilsen, Krystalee Wiebe, and Amidou N’Diaye
- Subjects
0106 biological sciences ,0301 basic medicine ,Heredity ,Quantitative Trait Loci ,Population ,lcsh:Medicine ,Locus (genetics) ,Biology ,Quantitative trait locus ,Research and Analysis Methods ,Genes, Plant ,01 natural sciences ,Chromosomes ,03 medical and health sciences ,Species Specificity ,Gene mapping ,Genetic linkage ,Genetics ,Grasses ,Common wheat ,Molecular Biology Techniques ,Linkage Mapping ,lcsh:Science ,education ,Molecular Biology ,Triticum ,education.field_of_study ,Multidisciplinary ,Chromosome Biology ,Gene Mapping ,lcsh:R ,Haplotype ,Organisms ,Biology and Life Sciences ,Chromosome Mapping ,food and beverages ,Chromosome ,Cell Biology ,Plants ,Genetic Mapping ,030104 developmental biology ,Common Wheat ,Haplotypes ,Genetic Loci ,Wheat ,lcsh:Q ,Research Article ,010606 plant biology & botany - Abstract
Breeding for solid-stemmed durum (Triticum turgidum L. var durum) and common wheat (Triticum aestivum L.) cultivars is one strategy to minimize yield losses caused by the wheat stem sawfly (Cephus cinctus Norton). Major stem-solidness QTL have been localized to the long arm of chromosome 3B in both wheat species, but it is unclear if these QTL span a common genetic interval. In this study, we have improved the resolution of the QTL on chromosome 3B in a durum (Kofa/W9262-260D3) and common wheat (Lillian/Vesper) mapping population. Coincident QTL (LOD = 94-127, R2 = 78-92%) were localized near the telomere of chromosome 3BL in both mapping populations, which we designate SSt1. We further examined the SSt1 interval by using available consensus maps for durum and common wheat and compared genetic to physical intervals by anchoring markers to the current version of the wild emmer wheat (WEW) reference sequence. These results suggest that the SSt1 interval spans a physical distance of 1.6 Mb in WEW (positions 833.4-835.0 Mb). In addition, minor QTL were identified on chromosomes 2A, 2D, 4A, and 5A that were found to synergistically enhance expression of SSt1 to increase stem-solidness. These results suggest that developing new wheat cultivars with improved stem-solidness is possible by combining SSt1 with favorable alleles at minor loci within both wheat species.
- Published
- 2017
40. The genome of the generalist plant pathogen Fusarium avenaceum is enriched with genes involved in redox, signaling and secondary metabolism
- Author
-
Erik Lysøe, Linda J Harris, Sean Walkowiak, Rajagopal Subramaniam, Hege H Divon, Even S Riiser, Carlos Llorens, Toni Gabaldón, H Corby Kistler, Wilfried Jonkers, Anna-Karin Kolseth, Kristian F Nielsen, Ulf Thrane, and Rasmus J N Frandsen
- Subjects
Science ,Genes, Fungal ,Molecular Sequence Data ,Secondary Metabolism ,Hordeum ,Genomics ,Fusarium ,Species Specificity ,Metabolome ,Medicine ,Transcriptome ,Oxidation-Reduction ,Triticum ,Signal Transduction - Abstract
Fusarium avenaceum is a fungus commonly isolated from soil and associated with a wide range of host plants. We present here three genome sequences of F. avenaceum, one isolated from barley in Finland and two from spring and winter wheat in Canada. The sizes of the three genomes range from 41.6-43.1 MB, with 13217-13445 predicted protein-coding genes. Whole-genome analysis showed that the three genomes are highly syntenic, and share>95% gene orthologs. Comparative analysis to other sequenced Fusaria shows that F. avenaceum has a very large potential for producing secondary metabolites, with between 75 and 80 key enzymes belonging to the polyketide, non-ribosomal peptide, terpene, alkaloid and indole-diterpene synthase classes. In addition to known metabolites from F. avenaceum, fuscofusarin and JM-47 were detected for the first time in this species. Many protein families are expanded in F. avenaceum, such as transcription factors, and proteins involved in redox reactions and signal transduction, suggesting evolutionary adaptation to a diverse and cosmopolitan ecology. We found that 20% of all predicted proteins were considered to be secreted, supporting a life in the extracellular space during interaction with plant hosts.
- Published
- 2014
41. The genome of the generalist plant pathogen Fusarium avenaceum is enriched with genes involved in redox, signaling and secondary metabolism
- Author
-
Erik, Lysøe, Linda J, Harris, Sean, Walkowiak, Rajagopal, Subramaniam, Hege H, Divon, Even S, Riiser, Carlos, Llorens, Toni, Gabaldón, H Corby, Kistler, Wilfried, Jonkers, Anna-Karin, Kolseth, Kristian F, Nielsen, Ulf, Thrane, and Rasmus J N, Frandsen
- Subjects
Genes, Fungal ,Molecular Sequence Data ,Plant Pathogens ,Secondary Metabolism ,Biology and Life Sciences ,Hordeum ,Genomics ,Cell Biology ,Plant Science ,Plant Pathology ,Biochemistry ,Oxidative Stress ,Metabolism ,Fusarium ,Species Specificity ,Metabolome ,Genetics ,Fungal Genomes ,Fungal Genetics ,Transcriptome ,Oxidation-Reduction ,Triticum ,Fungal Genomics ,Signal Transduction ,Research Article - Abstract
Fusarium avenaceum is a fungus commonly isolated from soil and associated with a wide range of host plants. We present here three genome sequences of F. avenaceum, one isolated from barley in Finland and two from spring and winter wheat in Canada. The sizes of the three genomes range from 41.6–43.1 MB, with 13217–13445 predicted protein-coding genes. Whole-genome analysis showed that the three genomes are highly syntenic, and share>95% gene orthologs. Comparative analysis to other sequenced Fusaria shows that F. avenaceum has a very large potential for producing secondary metabolites, with between 75 and 80 key enzymes belonging to the polyketide, non-ribosomal peptide, terpene, alkaloid and indole-diterpene synthase classes. In addition to known metabolites from F. avenaceum, fuscofusarin and JM-47 were detected for the first time in this species. Many protein families are expanded in F. avenaceum, such as transcription factors, and proteins involved in redox reactions and signal transduction, suggesting evolutionary adaptation to a diverse and cosmopolitan ecology. We found that 20% of all predicted proteins were considered to be secreted, supporting a life in the extracellular space during interaction with plant hosts.
- Published
- 2014
42. Comparative secretome analysis of Fusarium graminearum and two of its non-pathogenic mutants upon deoxynivalenol induction in vitro
- Author
-
Rajagopal Subramaniam, Sean Walkowiak, Christof Rampitsch, and Jacqueline Day
- Subjects
Fusarium ,Proteomics ,biology ,Proteome ,Mutant ,food and beverages ,Virulence ,biology.organism_classification ,Biochemistry ,Microbiology ,Fungal Proteins ,Gibberella zeae ,Secretory protein ,Phenotype ,Protein purification ,Trichothecenes ,Molecular Biology ,Pathogen ,Function (biology) ,Sequence Deletion - Abstract
To understand early events in plant-pathogen interactions, it is necessary to explore the pathogen secretome to identify secreted proteins that help orchestrate pathology. The secretome can be obtained from pathogens grown in vitro, and then characterized using standard proteomic approaches based on protein extraction and subsequent identification of tryptic peptides by LC-MS. A subset of the secretome is composed of proteins whose presence is required to initiate infection and their removal from the secretome would result in pathogens with reduced or no virulence. We present here comparative secretome from Fusarium graminearum. This filamentous fungus causes Fusarium head blight on wheat, a serious cereal disease found in many cereal-growing regions. Affected grain is contaminated with mycotoxins and cannot be used for food or feed. We used label-free quantitative MS to compare the secretomes of wild-type with two nonpathogenic deletion mutants of F. graminearum, Δtri6, and Δtri10. These mutations in mycotoxin-regulating transcription factors revealed a subset of 29 proteins whose relative abundance was affected in their secretomes, as measured by spectral counting. Proteins that decreased in abundance are potential candidate virulence factors and these included cell wall-degrading enzymes, metabolic enzymes, pathogenesis-related proteins, and proteins of unknown function.
- Published
- 2012
43. Tri6 Is a Global Transcription Regulator in the Phytopathogen Fusarium graminearum
- Author
-
David S. Guttman, Linda J. Harris, Anne Johnston, Li-Li Wang, Rajagopal Subramaniam, Sean Walkowiak, Winnie Leung, Yunchen Gong, and Charles G. Nasmith
- Subjects
lcsh:Immunologic diseases. Allergy ,Transcription, Genetic ,Genes, Fungal ,Immunology ,Biology ,Biochemistry ,Microbiology ,Fungal Proteins ,Fusarium ,Gene Expression Regulation, Fungal ,Virology ,Gene expression ,Gene cluster ,Genetics ,Transcriptional regulation ,lcsh:QH301-705.5 ,Molecular Biology ,Transcription factor ,Gene ,Plant Diseases ,Regulation of gene expression ,Gene expression profiling ,Metabolism ,lcsh:Biology (General) ,Multigene Family ,Parasitology ,lcsh:RC581-607 ,Chromatin immunoprecipitation ,Research Article ,Transcription Factors - Abstract
In F. graminearum, the transcriptional regulator Tri6 is encoded within the trichothecene gene cluster and regulates genes involved in the biosynthesis of the secondary metabolite deoxynivalenol (DON). The Tri6 protein with its Cys2His2 zinc-finger may also conform to the class of global transcription regulators. This class of global transcriptional regulators mediate various environmental cues and generally responds to the demands of cellular metabolism. To address this issue directly, we sought to find gene targets of Tri6 in F. graminearum grown in optimal nutrient conditions. Chromatin immunoprecipitation followed by Illumina sequencing (ChIP-Seq) revealed that in addition to identifying six genes within the trichothecene gene cluster, Tri1, Tri3, Tri6, Tri7, Tri12 and Tri14, the ChIP-Seq also identified 192 additional targets potentially regulated by Tri6. Functional classification revealed that, among the annotated genes, ∼40% are associated with cellular metabolism and transport and the rest of the target genes fall into the category of signal transduction and gene expression regulation. ChIP-Seq data also revealed Tri6 has the highest affinity toward its own promoter, suggesting that this gene could be subject to self-regulation. Electro mobility shift assays (EMSA) performed on the promoter of Tri6 with purified Tri6 protein identified a minimum binding motif of GTGA repeats as a consensus sequence. Finally, expression profiling of F. graminearum grown under nitrogen-limiting conditions revealed that 49 out of 198 target genes are differentially regulated by Tri6. The identification of potential new targets together with deciphering novel binding sites for Tri6, casts new light into the role of this transcriptional regulator in the overall growth and development of F. graminearum., Author Summary Our knowledge of mechanisms involved in the activation and biosynthesis of DON comes largely from in vitro culture studies. Cumulated knowledge suggests that the physiological status of the fungus and the availability of nutrients are the main determining factors for DON production. Integration of various environmental cues to coordinate expression of secondary metabolic genes is thought to be mediated by a combination of global and pathway-specific transcription factors. While the global transcriptional factors respond to broad range of environmental cues such as the availability of carbon and nitrogen, the pathway-specific transcriptional factors regulate genes within a gene cluster. In F. graminearum, the transcriptional regulator Tri6 is encoded within the trichothecene gene cluster and regulates genes involved in the synthesis and transport of DON. In this report, we utilized ChIP-Seq to demonstrate that Tri6 can potentially bind to promoters and regulate genes not involved in the synthesis of DON and furthermore, many of these non-trichothecene genes are involved in various aspects of cellular metabolism, including transport and energy. Expression profiling revealed that many of the target genes are differentially regulated by Tri6, thus validating our hypothesis that Tri6 is a global regulator involved in cellular metabolism.
- Published
- 2011
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.