Search

Superconductivity becomes more interesting when it encounters dimensional constraint or topology, because it is of importance for exploring exotic quantum phenomena or developing superconducting electronics. Here we report the coexistence of naturally formed surface superconducting state and three-dimensional topological Dirac state in single crystals of BaMg$_2$Bi$_2$. The electronic structure obtained from the first-principles calculations demonstrates that BaMg$_2$Bi$_2$ is an ideal Dirac material, in which the Dirac point is very close to the Fermi level and no other energy band crosses the Fermi level. Superconductivity up to 4.77 K can be observed under ambient pressure in the measurements of resistivity. The angle dependent magnetoresistance reveals the two-dimensional characteristic of superconductivity, indicating that superconductivity occurs on the surface of the sample and is absent in the bulk state. Our study not only provides BaMg$_2$Bi$_2$ as a suitable platform to study the interplay between superconductivity and topological Dirac state, but also indicates that MgBi-based materials may be a promising system for exploring new superconductors.

Additional file 14: Additional Table 9. Time series trends in accidental poisoning mortality in Xi’an

Additional file 13: Additional Table 8. Time series trends in suicide mortality in Xi’an

Additional file 9: Additional Table 4. Top five Injury deaths among permanent residents in Xi’an, 2005-2020 (1/100000)

Additional file 10: Additional Table 5. Time series trends in motor vehicle traffic accidents mortality in Xi’an

Additional file 16: Additional Table 11. Transport accidents other than motor vehicles mortality prediction in Xi’an

Additional file 6: Additional Table 1. Injury mortality by age group in Xi’an, 2005-2020

Additional file 7: Additional Table 2. Injury mortality by cause in Xi’an city, 2005-2020

Additional file 18: Additional Table 13. Suicide mortality prediction in Xi’an

Additional file 11: Additional Table 6. Time series trends in transport accidents other than motor vehicles mortality in Xi’an

Additional file 12: Additional Table 7. Time series trends in unintentional falls mortality in Xi’an

Additional file 1.

Additional file 17: Additional Table 12. Unintentional falls mortality prediction in Xi’an

Additional file 8: Additional Table 3. Rank of injury among residents of different ages in Xi’an city, 2005-2020

Under the background of Beijing-Tianjin-Hebei coordinated development, wisdom logistics is an important direction in the development of the logistics in Beijing-Tianjin-Hebei region. At present, the development of wisdom logistics in Beijing-Tianjin-Hebei region is faced with many problems, such as unclear policy guidance, lack of public information platform and low degree of specialization. By exploring the driving force, guarantee system and operation mechanism of wisdom logistics development, the technical framework of wisdom logistics development is constructed, and countermeasures are put forward to promote the development of wisdom logistics in Beijing-Tianjin-Hebei urban agglomeration, so as to improve the wisdom logistics development system and promote the development level of regional logistics.

Rationale: The coexistence of Ramsay Hunt syndrome (RHS) and varicella-zoster virus (VZV) encephalitis is rare. A patient who developed RHS after being infected with VZV, along with a pontine lesion, is reported in the present study. Patient concerns: A 41-year-old male patient presented with his mouth askew for 7 days, and dizziness, accompanied by hearing loss for 3 days. Diagnoses: The patient was initially diagnosed with RHS. Brainstem encephalitis was confirmed by lumbar puncture and cerebrospinal fluid. Brain magnetic resonance imaging (MRI) and diffusion-weighted imaging (DWI) revealed how VZV entered the intracranial space along the vestibulocochlear nerve and facial nerve in the acute period. Interventions: Intravenous acyclovir, IV, immunoglobulins (IVIg) and methylprednisolone were administered. Outcomes: The herpes was cleared up and left facial nerve palsy was improved, but hearing loss in the left ear did not improve. Lessons: An MRI was necessary for some VZV infections limited to the cranial nerve, although there was no evidence of brain stem injury. DWI provided evidence, showing how VZV entered the brain in the early stage. This allowed the doctor to judge the necessity of a lumbar puncture.

ABHD11-AS1 expression in normal ovary and ovarian carcinoma tissues. Table 2. Correlation of ABHD11-AS1 expression with different clinicopathological features of ovarian carcinoma. Table 3. The ABHD11-AS1 sequence was CTCGAGTGAAGACGGAAATGGGCGGGGCTGCGAGCTAGGGCGGGAGAAGGAGCGCGGGGAGGACGTACCTTGTGAGATGCGAGCCGGCCAACAGCTTGCAAGCATGCTCCGCTGGACCCGAGCCTGGAGGCTCCCGCGTGAGGGACTCGGCCCCCACGGCCCTAGCTTCGCGAGGGTGCCTGTCGCACCCAGCAGCAGCAGCGGCGGCCGAGGGGGCGCCGAGCCGAGGCCGCTTCCGCTTTCCTACAGGCTTCTGGACGGGGAGGCAGCCCTCCCGGCCGTCGTCTTTTTGCACGGGCTCTTCGGCAGCAAAACTAACTTCAACTCCATCGCCAAGATCTTGGCCCAGCAGACAGGCCGTGCTGACGGTGGATGCTCGTAACCACGGTGACAGCCCCCACAGCCCAGACATGAGCTACGAGATCATGAGCCAGGACCTGCAGGACCTTCTGCCCCAGCTGGGCCTGGTGCCCTGCGTCGTCGTTGGCCACAGCATGGGAGGAAAGACAGCCATGCTGCTGGCACTACAGAGGGTGAGCCGCCCATGTCTGGGGCCTCCTCCCATTCAGTATATACCCTGAGGGCCCTGCAGGCAACCTGGGACTCACATGATCGTTGGATGACCAAGTTCAGGCTCCAGGAGCCATGCCTGAGACTCCCTATGTCTGCCTAAGACTGGTCCCAGTTCGGTTCTCTCCCACAGCCAGAGCTGGTGGAACGTCTCATTGCTGTAGATATCAGCCCAGTGGAAAGCACAGGTGTCTCCCACTTTGCAACCTATGTGGCAGCCATGAGGGCCATCAACATCGCAGATGAGCTGCCCCGCTCCCGTGCCCGAAAACTGGCGGATGAACAGCTCAGTTCTGTCATCCAGGACATGGCCGTGCGGCAGCACCTGCTCACTAACCTGGTAGAGGTAGACGGGCGCTTCGTGTGGAGGGTGAACTTGGATGCCCTGACCCAGCACCTAGACAAGATCTTGGCTTTCCCACAGAGGCAGGAGTCCTACCTCGGGCCAACACTCTTTCTCCTTGGTGGAAACTCCCAGTTCGTGCATCCCAGCCACCACCCTGAGATTATGCGGCTCTTCCCTCGGGCCCAGATGCAGACGGTGCCGAACGCTGGCCACTGGATCCACGCTGACCGCCCACAGGACTTCATAGCTGCCATCCGAGGCTTCCTGGTCTAAGAGTTGCTGGCAAGAAGATGGCCGGGCGTGGTGGCTCATGCCTGTAATTCCAGCACTTTGGGAGGCTAAGGCGGGAGGATGACTTGAGGCCAGGAGTTGGAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAAAAATTAGCCTGGCGTGGTGGTGCACACCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCACTTGAACCCTGGAGGCAGAGGTTGCAATGAGCCGAGATCACACCACTACACTCCAGCCTAGGCAACAGAGCAAGACTCTGTCTCAAAAAAAACAAAACAAAAAGGAGGCACAAAACCCCAGGCTTCAAGTCTCTGCAGCCTGCTCCACATTTGGGCACAGAAGGACTCAGACAGGCACTGTGTGGGCACGAGGTTTTACAGGGGTGGTCAGACCTCAGGCTTTAATGAATAAAGACACTACTCCCAAAGGTACC. (DOCX 21Â kb)

Being an important optical phenomenon, the linear electro-optic effect has diverse applications in the optical modulation and optical switching. The refractive index ellipsoid theory has been widely used to study the linear electro-optic effect for a long time. Despite of its visualization such a theory has limitations and cannot deal with a lot of cases in which the linear absorption cannot be neglected, or the electric displacement vector has a nonlocal response to electric field, etc. To overcome such shortcomings, in 2001 a wave coupling theory of linear electro-optic effect was developed by She and Lee (She W, Lee W 2001 Opt. Commun. 195 303). And in 2016 we generalized this wave coupling theory to the treatment of nonlocal linear electro-optic effect in which the displacement vector has a nonlocal response to electric field. In this paper, we use this wave-coupling theory to investigate how the linear absorption influences the linear electro-optic effect in a nonlocal medium. Starting from Maxwell's equations and considering the linear absorption and the nonlocality of the susceptibility tensors, we obtain two coupling equations for two orthogonal linear polarized waves and also analytical solutions of the resulting equations, which can be used to describe the nonlocal linear electro-optic effect for a light beam propagating along any direction, with an external direct current electric field applied along an arbitrary direction in a linear absorbent crystal. With such solutions, we study the influences of the linear absorption on the phase, amplitude, shape of the output beam, as well as the half-wave voltage and the extinction ratio of electro-optic modulation. The results show that no matter whether there exists linear absorption, the Rayleigh distance of the Gaussian beam in the crystal will be shortened as a result of the nonlocality of (1). When linear-absorption coefficients 11 and 22 are equal, the linear absorption damps equally the amplitudes of the two polarized output beams with keeping their phases and shapes unchanged. So in the case of 11=22, just as in a lossless medium, the phenomenon that the output beam is no longer a Gaussian beam in an electro-optic amplitude modulation scheme can be considered as a possible signal of the nonlocal response of (2). More interestingly, when 1122, the linear absorption not only reduces the amplitudes of output beams, but also changes their phases and shapes. In such a case one need to measure the nonlocal characteristic length of (2) to judge whether (2) has a nonlocal response. Finally, in the case of 1122, as a result of linear absorption, the extinction ratio is reduced, but the half-wave voltage keeps nearly unchanged in an electro-optic amplitude modulation scheme. Besides the discussion on the influence of the linear absorption, we also make suggestions of how to measure the nonlocal characteristic lengths of (1) and (2) and the absorption coefficients 11 and 22.

By numerical simulation we theoretically study one type of high order coupled photovoltaic spatial solitons that can be realized by using four parallel beams with two different frequency components in photovoltaic crystals whose light-induced refractive index perturbation is positive. The numerical results show that this kind of coupled soliton can be approached by hyperbolic secant beams undersome suitable conditions. The optical steering properties of such a high ordercoupled soliton are investigated. It is shown that such a coupled soliton cannot be realized when the incident beams remarkably deviated from the lateral symmetry.

A new method for description of electro-optic detection for THz radiation, using wave coupling theory of linear electro-optic effect,is presented in this paper. This method is not only useable in all optically isotropic detection crystals,bu t also usable in the situation that the probe beam propagates along the optical axis of uniaxial crystals.Also,the description method can be used for all possib le polarization directions of the probe beam and for arbitrary direction of the electric field of THz radiation.The description does not need complex coordinate transform,and the calculation is very simple.Finally,some conclusions have been drawn.

The new wave coupling theory of linear electrooptic effect is used to study the thermal property of an electrooptic modulator made from biaxial crystal KTP. We find one direction, along which the output intensity of the modulator is not sensitive to temperature within an angle range of azimuth φ. Furthermore, we achieve an optimal design of the modulator by adjusting the length of the crystal and the direction of the external electric field.