Search

APMAP is single transmembrane arylesterase which plays a cardinal role in adipogenesis. In this experiment, three tissue and blood samples of Rex rabbits at 3 growing periods were selected. The expression levels of APMAP gene in different tissues were detected by real-time fluorescence quantitative PCR and the content of APMAP in the blood was detected by Elisa. The results showed that fat deposition, the expression of APMAP in muscle and the content of APMAP in the blood increased rapidly during the growth of Rex rabbits. The correlation analysis showed that the correlation coefficient between APMAP content in the blood and the expression level of APMAP gene in longissimus lumborum muscle was 0.75(p < 0.05); the correlation coefficients between APMAP content in the blood and intramuscular fat and 24-hour pH were 0.90 (p < 0.01) and 0.75 (p < 0.05), respectively. According to the analysis results, we inferred APMAP content in the blood in Rex rabbits may influence meat quality and the meat quality of high APMAP content in the blood in Rex rabbits is better. These results revealed APMAP content in the blood may be one of the important signs for meat quality traits of molecular markers. [ABSTRACT FROM AUTHOR]

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2–4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development. [ABSTRACT FROM AUTHOR]

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding. [ABSTRACT FROM AUTHOR]

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics. [ABSTRACT FROM AUTHOR]

Tong sheep is a kind of famous fat-tailed sheep in China, which no longer meets market demands because of the large amount of fat deposition in tail. Fat mass and obesity associated (FTO) gene regulates fatty acid transport and fat metabolism to affect obesity and is also reported to regulate phenotypic traits in healthy animals. To identify the insertion/deletion (InDel) variations of the FTO gene and evaluate their effects on fat-tail measurements and growth traits, 166 healthy individuals from Tong sheep were identified and analyzed. Herein, 10 novel InDel polymorphisms were founded in the Tong sheep FTO gene, which displayed intermediate polymorphism (0.25 < PIC < 0.5) and were in Hardy–Weinberg equilibrium (p >.05). Correlation analysis of 78 Tong sheep phenotypic traits data and InDel polymorphisms showed that eight InDel loci were significantly associated with partial growth traits (p <.05), four InDel loci were significantly correlated with fat-tail measurements (p <.05). In particular, individuals with genotype DD showed better phenotypic traits than individuals with other genotypes at male sheep InDel 5 and InDel 8 loci, which had small tail-fat dimensions while having good growth traits. These results confirmed potential usefulness of FTO gene in marker-assisted selection programs of Tong sheep breeding. [ABSTRACT FROM AUTHOR]

TGF-β signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-β signaling pathway. LTBP1 binds to TGF-β, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-β pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-β signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding. [ABSTRACT FROM AUTHOR]

Pleomorphic adenoma gene 1 (PLAG1) encodes a developmentally regulated zinc finger protein, locating in growth-related QTNs. The mRNA expression of this gene was investigated in different tissues and from two different developmental periods, whilst to explore the functions of PLAG1 in growth traits of cattle. The results showed that PLAG1 was expressed in all examined tissues. However, PLAG1 expression levels in all examined tissues were significantly different between the 5-month fetus and 36-month adult cattle. Our juvenile results indicated PLAG1 is primarily expressed in embryonic tissues of Chinese cattle. Furthermore, two variations were identified. Association analysis revealed that the two variations were associated with growth traits (p < 0.05 or p < 0.01). These new findings provide a comprehensive overview of the critical roles of PLAG1 in growth traits modulation and can be highlighted as candidate molecular markers in cattle breeding. [ABSTRACT FROM AUTHOR]

In China, Tong sheep (TS) and Lanzhou fat-tailed sheep (LFTS) are two closely relative endanger breeds for low meat production and low fecundity, finding some marker-assisted selected (MAS) is our first priority for improving their growth traits. For this purpose, Hu sheep (HS) and small-tailed Han sheep (STHS) were compared with two endangered breeds (TS and LFTS). Paired-liked homeodomain transcription factor 2 (PITX2) gene was the important member of PITX family, which could adjust animal growth through hypothalamic-pituitary-adrenal axis. During the past years, insertion/deletion (indel) has become increasingly popular in application as MAS. In this study, two novel indel loci were identified, and five significant differences, including chest width, hip width, chest depth, chest circumference, and body height, were found between different breeds. Interestingly, there was no DD genotype and smaller number of ID genotye. All the ID genotypes were significantly greater than II genotype, which was to say the allele of “D” was dominant variation and its frequency was lower, which demonstrated that it has huge space for selection. Briefly, the two indel were potential and useful DNA markers for selecting excellent individuals in relation to growth traits in sheep. [ABSTRACT FROM AUTHOR]