Search

Autoimmune hemolytic anemia is a heterogeneous disease with respect to the type of the antibody involved and the absence or presence of an underlying condition. Treatment decisions should be based on careful diagnostic evaluation. Primary warm antibody autoimmune hemolytic anemias respond well to steroids, but most patients remain steroid-dependent, and many require second-line treatment. Currently, splenectomy can be regarded as the most effective and best-evaluated second-line therapy, but there are still only limited data on long-term efficacy and adverse effects. The monoclonal anti-CD20 antibody rituximab is another second-line therapy with documented short-term efficacy, but there is limited information on long-term efficacy and side effects. The efficacy of immunosuppressants is poorly evaluated. Primary cold antibody autoimmune hemolytic anemias respond well to rituximab but are resistant to steroids and splenectomy. The most common causes of secondary autoimmune hemolytic anemias are malignancies, immune diseases, or drugs. They may be treated in a way similar to primary autoimmune hemolytic anemias, by immunosuppressants or by treatment of the underlying disease.

Diagnosis and management of immune thrombocytopenic purpura (ITP) remain largely dependent on clinical expertise and observations more than on evidence derived from clinical trials of high scientific quality. One major obstacle to the implementation of such studies and in producing reliable meta-analyses of existing data is a lack of consensus on standardized critical definitions, outcome criteria, and terminology. Moreover, the demand for comparative clinical trials has dramatically increased since the introduction of new classes of therapeutic agents, such as thrombopoietin receptor agonists, and innovative treatment modalities, such as anti-CD 20 antibodies. To overcome the present heterogeneity, an International Working Group of recognized expert clinicians convened a 2-day structured meeting (the Vicenza Consensus Conference) to define standard terminology and definitions for primary ITP and its different phases and criteria for the grading of severity, and clinically meaningful outcomes and response. These consensus criteria and definitions could be used by investigational clinical trials or cohort studies. Adoption of these recommendations would serve to improve communication among investigators, to enhance comparability among clinical trials, to facilitate meta-analyses and development of therapeutic guidelines, and to provide a standardized framework for regulatory agencies.

Early allogeneic hematopoietic stem cell transplantation (HSCT) has been proposed as primary treatment modality for patients with chronic myeloid leukemia (CML). This concept has been challenged by transplantation mortality and improved drug therapy. In a randomized study, primary HSCT and best available drug treatment (IFN based) were compared in newly diagnosed chronic phase CML patients. Assignment to treatment strategy was by genetic randomization according to availability of a matched related donor. Evaluation followed the intention-to-treat principle. Six hundred and twenty one patients with chronic phase CML were stratified for eligibility for HSCT. Three hundred and fifty four patients (62% male; median age, 40 years; range, 11-59 years) were eligible and randomized. One hundred and thirty five patients (38%) had a matched related donor, of whom 123 (91%) received a transplant within a median of 10 months (range, 2-106 months) from diagnosis. Two hundred and nineteen patients (62%) had no related donor and received best available drug treatment. With an observation time up to 11.2 years (median, 8.9 years), survival was superior for patients with drug treatment (P = .049), superiority being most pronounced in low-risk patients (P = .032). The general recommendation of HSCT as first-line treatment option in chronic phase CML can no longer be maintained. It should be replaced by a trial with modern drug treatment first.

Recent data suggest that mast cells (MCs) in patients with systemic mastocytosis or mast cell leukemia express a CD2-reactive antigen. To explore the biochemical nature and function of this antigen, primary MCs as well as the MC line HMC-1 derived from a patient with mast cell leukemia were examined. Northern blot experiments revealed expression of CD2 messenger RNA in HMC-1, whereas primary nonneoplastic MCs did not express transcripts for CD2. In cell surface staining experiments, bone marrow (BM) MCs in systemic mastocytosis (n = 12) as well as HMC-1 cells (30%-80%) were found to express the T11-1 and T11-2 (but not T11-3) epitopes of CD2. By contrast, BM MCs in myelodysplastic syndromes and nonhematologic disorders (bronchiogenic carcinoma, foreskin phimosis, uterine myeomata ) were consistently CD2−. All MC species analyzed including HMC-1 were found to express LFA-3 (CD58), the natural ligand of CD2. To study the functional role of CD2 on neoplastic MCs, CD2+ and CD2− HMC-1 cells were separated by cell sorting. CD2+ HMC-1 cells were found to form spontaneous aggregates and rosettes with sheep erythrocytes in excess over CD2−cells, and a T11-1 antibody inhibited both the aggregation and rosette formation. Moreover, exposure of CD2+ HMC-1 cells to T11-1 or T11-2 antibody was followed by expression of T11-3. In addition, stimulation of neoplastic MCs through T11-3 and a second CD2 epitope resulted in histamine release. These data show that neoplastic MCs express functionally active CD2. It is hypothesized that expression of CD2 is associated with pathologic accumulation and function of MCs in systemic mastocytosis.

To determine the safety, biologic, and clinical benefits of pegylated recombinant human megakaryocyte growth and development factor (PEG-rHuMGDF; Amgen, Thousand Oaks, CA) after myelosuppressive chemotherapy in acute myeloid leukemia (AML),108 adult patients with de novo AML were randomized to receive either PEG-rHuMGDF (2.5 mu g/kg/d or 5 mu g/kg/d) for up to 21 doses (group A), a single dose of 2.5 mu g/kg PEG-rHuMGDF, 7 daily doses of 2.5 mu g/kg PEG-rHuMGDF (group B), or placebo. The greatest biologic activity was seen in group A with a median peak platelet count of 1,084 x 10(9)/L, occurring at a median 9 days after the last dose of study drug, compared with 517 x 10(9)/L and 396 x 10(9)/L in group B and placebo group, respectively. Thrombocytosis (platelets >1,000 x 10(9)/L) was seen at rates of 52%, 8%, and 9% in groups A, B, and placebo, respectively, but were not associated with any adverse event. There was no effect on median time to transfusion independent platelet recovery (greater than or equal to 20 x 10(9)/L). The median time to neutrophil recovery (greater than or equal to 500/mu L) and red blood cell transfusion requirements were similar in all groups, and there was no apparent stimulation of leukemia. PEG-rHuMGDF was biologically active and well tolerated. Further investigation of dose and scheduling is required, specifically earlier dosing before and during chemotherapy. (C) 1999 by The American Society of Hematology.

In polycythemia vera (PV) erythroid colonies that grow in vitro in the absence of exogenous erythropoietin (EPO) arise from the abnormal clone that is responsible for overproduction of red blood cells. Although the mechanism of autonomous formation of burst-forming units-erythroid (BFU-E) is not fully understood, a spontaneous release of growth regulatory molecules by PV cells and/or by accessory cells is likely to be involved. Because of its cytokine synthesis inhibiting action, interleukin-10 (IL-10) could be a potentially useful molecule to modulate abnormal erythropoiesis in PV. We studied the effect of recombinant human IL-10 on the EPO-independent growth of erythroid bursts derived from peripheral blood mononuclear cells (PBMNCs) of patients with PV. IL-10 showed a profound, dose-dependent, and specific inhibitory effect on autonomous BFU-E formation. Ten nanograms per milliliter of IL-10 significantly suppressed spontaneous growth of erythroid colonies in methylcellulose in five of five PV patients tested with a mean inhibition by 81% (range, 72-94). To elucidate the possible mechanism of the inhibitory action of IL-10 we further studied the effect of anticytokine antibodies on autonomous BFU-E growth and the ability of exogenous cytokines to restore IL-10–induced suppression of erythroid colony growth. Among a panel of growth regulatory factors tested (granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-3, granulocyte colony-stimulating factor, stem cell factor, and insulin-like growth factor-1) GM-CSF was the only molecule for which both an inhibition of spontaneous BFU-E formation by its respective antibody as well as a significant restimulation of erythroid colonies in IL-10-treated cultures by exogenous addition was found. Moreover, inhibition of GM-CSF production by IL-10 was shown in PV PBMNCs at the mRNA level. Our data indicate that autonomous BFU-E growth in PV can be profoundly inhibited by IL-10 and that this inhibitory effect seems to be at least in part secondary to suppression of endogenous GM-CSF production. © 1998 by The American Society of Hematology.

The 110-kD lung resistance protein (LRP) is overexpressed in P-glycoprotein–negative multidrug-resistant cell lines and most likely involved in the multidrug resistance (MDR) of these cell lines. To determine the clinical significance of LRP, we have studied LRP expression of leukemic blasts and its association with clinical outcome in patients with de novo acute myeloid leukemia (AML). LRP expression of leukemic blasts obtained from peripheral blood or bone marrow of previously untreated patients (n = 86) was determined by immunocytochemistry by means of monoclonal antibody LRP-56. LRP expression at diagnosis was detected in 31 (36%) patients. LRP expression was independent of age and sex of the patients, French-American-British subtype, cytogenetic abnormalities, and lactate dehydrogenase levels, but correlated with white blood cell count (P = .01). Eighty-two patients received standard induction chemotherapy that included cytarabine and MDR drugs (daunorubicin in most patients, additional etoposide in the majority of patients). The complete remission rate of induction chemotherapy was 72% (95% confidence interval [CI] = 61% to 82%) for the total study population. The complete remission rate was 81% (95% CI = 67% to 91%) for patients without LRP expression but only 55% (95% CI = 36% to 74%) for patients with LRP expression (P = .01). Overall survival and disease-free survival were estimated according to Kaplan-Meier in 82 and 59 patients, respectively. Overall survival was significantly longer in patients without LRP expression than in patients with LRP expression. At a median follow-up of 16 months, median overall survival was 17 months (95% CI = 12 to 38 months) for LRP-negative patients but only 8 months (95% CI = 4 to 12 months) for -positive patients (P = .006). Disease-free survival was 9 months (95% CI = 7 to 11 months) for LRP-negative patients and 6 months (95% CI = 5 to 8 months) for -positive patients (P = .078). Outcome was best in patients lacking both LRP and P-glycoprotein expression. In conclusion, LRP predicts for poor outcome and thus theLRP gene appears to be another clinically relevant drug resistance gene in AML.

The safety and efficacy of filgrastim as an adjunct to acute myeloid leukemia (AML) induction and consolidation therapy was assessed in this prospective double-blind, randomized, placebo-controlled, multicenter trial. A total of 521 consecutive de novo AML patients aged 16 or more years were randomized to receive filgrastim (5 μg/kg/d subcutaneously) or placebo after standard induction as well as consolidation chemotherapy. Blinded study drug was given from 24 hours after chemotherapy until the absolute neutrophil count was ≥1.0 × 109/L for 3 consecutive days. The overall complete remission rate was 68%. After a median follow-up of 24 months (range 5 to 40) the median disease-free survival was 10 months (95% confidence interval [CI], 8.7 to 10.8) and the median overall survival was 13 months (95%CI, 12.2 to 14.6). These did not differ between treatment groups. Patients receiving filgrastim experienced neutrophil recovery 5 days earlier after induction 1 than those receiving placebo (P < .0001). This was accompanied by reductions in the duration of fever (7 v 8.5 days; P = .009), parenteral antibiotic use (15 v 18.5 days; P = .0001), and hospitalization (20 v 25 days; P = .0001). Similar reductions were seen after induction 2 and the consolidation courses. There was a significant reduction in the number of patients requiring systemic antifungal therapy in the filgrastim group during induction treatment (34% v 43%; P = .04). In conclusion, filgrastim is safe in that it had no negative impact on the prognosis of the AML patients. In addition, it effectively reduced the duration of neutropenia, leading to significant clinical benefits by reducing the duration of fever; requirement for parenteral anti-infectives, specifically amphotericin B; and the duration of hospitalization.

Because of the recommendation to avoid the concomitant administration of growth factors and chemotherapy, there is only limited information on colony-stimulating factor (CSF ) therapy in acute lymphoblastic leukemia (ALL) induction protocols, in which cytotoxic drugs are administered in divided doses over a prolonged period of time, thus requiring a simultaneous administration of growth factors and chemotherapy. We conducted a prospective, randomized, controlled study to determine the safety and efficacy of granulocyte colony-stimulating factor (G-CSF; filgrastim) as an adjunct to phase I of induction chemotherapy for adult ALL. Patients (n = 53) were randomized to receive no growth factor or G-CSF (5 μg/kg/d subcutaneously) starting on day 2 of chemotherapy consisting of daunorubicin (45 mg/m2) and vincristine (1.5 mg/m2) on days 1, 8, 15, and 22; L-asparaginase (2500 U/m2) on days 1 through 14; and prednisone (60 mg/m2) on days 1 through 28. A total of 25 patients in the G-CSF group and 26 patients in the control arm fulfilled the inclusion criteria of the study. G-CSF markedly ameliorated neutropenia because the median proportion of days with neutropenia less than 1,000/μL was 29% in the G-CSF group as compared with 84% in the control arm (P < .00005). The median time to reach absolute neutrophil counts (ANC) ≥ 1,000/μL was 16 days in G-CSF patients and 26 days in controls (P < .001). More importantly, G-CSF significantly reduced the incidence of febrile neutropenia (12% v 42% in controls, P < .05) and documented infections (40% v 77%, P < .05). No significant differences were found with regard to requirements for red blood cell transfusions and platelet concentrates. A total of 24 of 25 (96%) patients in the G-CSF group and 20 of 25 (80%) evaluable control patients had complete remission after phase I of induction therapy. We conclude that G-CSF can be safely administered as an adjunct to induction therapy of ALL and is clinically beneficial by ameliorating neutropenia and reducing infectious complications.

Spontaneous growth of myeloid colonies (colony-forming unit–granulocyte-macrophage [CFU-GM]) can be observed in methylcellulose cultures containing peripheral blood mononuclear cells (PB-MNCs) and is supposedly caused by the release of colony-stimulating factors (CSF ) by accessory cells. Because of its cytokine synthesis-inhibiting effects on T lymphocytes and monocytes, interleukin-10 (IL-10) may be a potential candidate for indirect modulation of hematopoiesis. We studied the effect of recombinant human IL-10 (rhIL-10) on spontaneous growth of myeloid colonies derived from human PB-MNCs. A total of 10 ng/mL of IL-10 almost completely inhibited spontaneous CFU-GM proliferation (by 95.1%; P < .001, n = 7) in unseparated PB-MNCs. This effect was dose-dependent and specific, because a neutralizing anti–IL-10 antibody was able to prevent IL-10–induced suppression of CFU-GM growth. Spontaneous CFU-GM growth, which required the presence of both monocytes (CD14+ cells) and T lymphocytes (CD3+ cells), was also greatly suppressed by a neutralizing anti–granulocyte-macrophage CSF (GM-CSF ) antibody but was only slightly or not at all inhibited by antibodies against G-CSF or IL-3. Moreover, IL-10–suppressed colony growth could be completely restored by the addition of exogenous GM-CSF. Using semiquantitative polymerase chain reaction, we were able to show that GM-CSF transcripts that spontaneously increased in PB-MNCs within 48 hours of culture were markedly reduced by the addition of IL-10. Inhibiton of GM-CSF production in PB-MNCs by IL-10 was also confirmed at the protein level by measuring GM-CSF levels in suspension cultures. Our findings suggest that autonomous CFU-GM growth, resulting from an interaction of monocytes and T lymphocytes, is mainly caused by endogenous GM-CSF release and can be profoundly suppressed by the addition of exogenous IL-10. Considering the strong inhibitory action of IL-10 on GM-CSF production and spontaneous cell growth in vitro, this cytokine may be useful in myeloid malignancies in which autocrine and/or paracrine mechanisms involving GM-CSF are likely to play a pathogenetic role.

The translocation t(9;22) in chronic myeloid leukemia (CML) generates a bcr-abl fusion gene that codes for an aberrant chimeric mRNA. Cell lines established from CML patients in blast crisis show higher expression of this aberrant bcr-abl transcript than cells from patients in chronic phase of the disease. This observation provided the stimulus to investigate whether increased expression of the aberrant bcr-abl fusion transcript is critical to the progression of CML from chronic phase to blast crisis. We have monitored the bcr-abl mRNA expression in 25 patients by serial quantitative polymerase chain reaction analyses during a follow-up period of 12 to 156 months after diagnosis, with a median observation time of 28 months. In all patients who have shown disease progression to accelerated phase (n = 4) or blast crisis (n = 7), an increase in bcr-abl mRNA expression was detected up to 16 months before laboratory or clinical parameters showed phenotypic transformation of the malignant clone. To investigate whether the elevated levels of bcr-abl mRNA reflected an increase in the proportion of leukemic cells in the samples analyzed or primarily enhanced transcriptional activity of the bcr-abl fusion gene, we performed quantitative analyses of the bcr-abl gene at the DNA level and of the Ph chromosome at the cytogenetic level and compared these data with steady-state bcr-abl mRNA levels. We show that increased levels of the bcr-abl transcript did not reflect increased proportions of leukemic cells but elevated steady-state levels of the chimeric mRNA in the malignant cells before disease progression. Therefore, our data strongly suggest that an increase of the chimeric mRNA expression in the leukemic cells precedes the phenotypic transformation of the malignant clone.

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.

Basophils and eosinophils share a common differentiation pathway. Factors regulating terminal commitment toward one cell type, however, have so far not been defined. Interleukin-3 (IL-3) is a potent differentiation factor for both human eosinophils and basophils. In the present study, the effects of various recombinant human (rh) growth regulators on IL-3-dependent growth of eosinophils and basophils were studied in a bone marrow (BM) suspension culture system (normal donors, n = 13). We found that type beta transforming growth factors (TGFs) lead to a significant increase in the absolute numbers of basophils in BM cultures grown in the presence of IL-3 (day 14 of culture; IL-3: 133 +/- 20 v IL-3 + TGF-beta 1: 231 +/- 28 x 10(3)/mL [P less than .01]) and to an increase in the total histamine values (IL-3: 72.6 +/- 22.2 v IL-3 + TGF-beta 1: 142.9 +/- 37.3 ng/mL [P less than .015]) compared with rhIL-3 alone. In contrast, type beta TGFs were found to inhibit the IL-3-dependent growth of eosinophils (IL-3: 170.4 +/- 37.2 v IL-3 + TGF-beta 1: 16.7 +/- 5.2 x 10(3)/mL [P less than .01]) and formation of eosinophil cationic protein in the same culture system. The effect of TGF-beta 1 (and TGF-beta 2) on IL-3-dependent differentiation of basophils and eosinophils was dose- and time-dependent (maximum effects observed with 1 to 10 ng/mL of rhTGF-beta 1 or TGF-beta 2) and could be neutralized by an antibody specific for TGF-beta 1. In contrast to the TGFs, interferon-alpha (IFN-alpha) and IFN-gamma were found to downregulate IL-3-dependent formation of both basophils (IL-3: 167 +/- 33 v IL-3 + IFN-alpha: 67 +/- 25 v IL-3 + IFN-gamma: 65 +/- 33 x 10(3)/mL [P less than .01]) and eosinophils (IL-3: 239 +/- 5 v IL-3 + IFN-alpha: 81 +/- 4 v IL-3 + IFN-gamma: 67 +/- 17 x 10(3)/mL [P less than .05]) in our culture system. Type beta TGFs as well as the IFNs failed to directly induce differentiation of human basophils or eosinophils in the absence of other growth factors. Together, these results show that type beta TGFs and IFNs are potent regulators of cytokine-dependent growth and differentiation of human allergic effector cells.

The in vivo effect of recombinant human interleukin-3 (rhIL-3) on peripheral blood (PB) levels of hematopoietic progenitor cells was studied in nonhuman primates. Subcutaneous administration of 33 micrograms/kg/d of rhIL-3 for 11 to 14 days to rhesus monkeys slightly raised leukocyte counts (twofold) and substantially expanded the pool of circulating stem cells in the second week of treatment. At the end of rhIL-3 administration, PB levels of granulocyte/macrophage colony- forming units (CFU-GM) increased by a mean of 12-fold; burst-forming units-erythroid (BFU-E) by ninefold; CFU-mix, by 12-fold; and CFU- megakaryocyte (Mk), by 13-fold as compared with their respective pretreatment values. Subsequent administration of recombinant human granulocyte/macrophage colony-stimulating factor (rhGM-CSF; 5.5 micrograms/kg/d for 5 days) to rhIL-3-pretreated animals further expanded the PB stem cell compartment leading to maximum levels of CFU- GM that were in average much more increased (63-fold) than CFU-GM levels under rhIL-3 (14-fold) or rhGM-CSF (12-fold) alone. This hitherto unknown effect of rhIL-3 on the pool of circulating progenitors, particularly in synergy with rhGM-CSF, may facilitate harvest of hematopoietic progenitor cells from PB for stem cell transplantation.

There is strong evidence that the incidence of venous thromboembolism (VTE) is increased during pregnancy. However, it is unknown whether and to which extent pregnancy influences the risk for recurrent VTE in women with previous thrombosis. To investigate whether pregnancy temporarily increases the risk for recurrent thrombosis, we retrospectively evaluated the recurrence rate in 109 women who had at least one pregnancy after an episode of VTE by comparing the time period during pregnancy with the nonpregnant period. Forty-three women had a first recurrence during a total observation time of 1014 years. Eight events (73 observation years) occurred during pregnancy, and 35 events (941 observation years) occurred outside pregnancy. Recurrence rates per 100 patient-years were 10.9% during and 3.7% outside pregnancy. Relative risk during pregnancy was 3.5 (95% confidence interval, 1.6-7.8; P = .002). Our data suggest that pregnancy leads to a temporary increase in the risk for recurrent thrombotic events.

Tryptases are serine proteases primarily expressed in mast cells. Normal blood basophils express only trace amounts of the enzyme. However, recent immunohistochemical studies have raised the possibility that neoplastic basophils express significant amounts of tryptase. In this study, tryptase expression was analyzed in normal and neoplastic basophils by immunoelectron microscopy using antitryptase monoclonal antibody G3. Basophils were obtained from patients with chronic myeloid leukemia (CML), idiopathic myelofibrosis (IMF), and myelodysplastic syndrome (MDS), and from healthy donors. Tryptase-immunoreactive material was detected in cytoplasmic granules of basophils in CML, IMF, and MDS. By contrast, normal basophils did not contain significant amounts of tryptase by immunoelectron microscopy. As assessed by reverse transcription-polymerase chain reaction, neoplastic basophils contained messenger RNA (mRNA) for α-tryptase, but no β-tryptase mRNA. In summary, these data provide evidence that neoplastic basophils in CML, IMF, and MDS can express detectable amounts of tryptase. Therefore, tryptase should not be regarded as specific for mast cells when neoplastic myeloid cells are analyzed.

Recent data suggest that mast cells (MC) are involved in the regulation of leukocyte accumulation in inflammatory reactions. In this study, expression of leukocyte-chemotactic peptides (chemokines) in purified human lung MC (n = 16) and a human mast cell line, HMC-1, was analyzed. Northern blotting and reverse transcriptase-polymerase chain reaction (RT-PCR) showed baseline expression of monocyte chemoattractant protein (MCP)-1 mRNA in unstimulated MC. Exposure of MC to recombinant stem cell factor (rhSCF, 100 ng/mL) or anti-IgE (10 μg/mL) was followed by a substantial increase in expression of MCP-1 mRNA. Neither unstimulated nor stem cell factor (SCF )-stimulated lung MC expressed transcripts for interleukin-8 (IL-8), macrophage inflammatory protein-1α (MIP-1α), MIP-1β, or RANTES by Northern blotting. The mast cell line HMC-1, which contains a mutated and intrinsically activated SCF-receptor, was found to express high levels of MCP-1 mRNA in a constitutive manner. Exposure of HMC-1 cells to rhSCF resulted in upregulation of MCP-1 mRNA expression, and de novo expression of MIP-1β mRNA. The SCF-induced upregulation of MCP-1 mRNA in lung MC and HMC-1 was accompanied by an increase in immunologically detectable MCP-1 in cell supernatants (sup) (lung MC [

The effect of recombinant human (rh) cytokines, interleukin-1 alpha (IL- 1 alpha), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL- 4), granulocyte/macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), monocyte/macrophage colony stimulating factor (M-CSF), interferon-alpha (IF-alpha), interferon-gamma (IF-gamma), and the tumor necrosis factor-alpha (TNF- alpha) on differentiation and function of metachromatic cells (MCS) was studied. Among all cytokines tested, rh interleukin-3 (rhIL-3) selectively induced a significant formation of MCS (IL-3: 1.1 +/- 0.6 x 10(5) v control: 0.02 +/- 0.15 x 10(5) MCS/mL suspension) and dose dependent increase in formation of intracellular histamine (IL-3, 100 U/mL: 95 +/- 23 ng/mL v control: 1.8 +/- 0.8 ng/mL) in a bone marrow suspension culture system (analyzed on day 14 of culture). Besides MCS, formation of eosinophils was observed in this culture system in the continuous presence of rhIL-3, whereas IL-3 pulse-stimulation for three hours and subsequent exposure to control medium induced growth of MCS but not of eosinophils. By combined immunofluorescence/toluidine blue staining, MCS were found to express a cell surface marker profile that corresponds to the immunological phenotype of peripheral blood basophils (MY-7(CD13)+, VIM12(CD11b)+, VIM2+, MAX1-, MAX24- and YB5B8- ). Furthermore, cultured MCS expressed surface membrane receptors for IgE and could be triggered for nontoxic histamine release by a monoclonal anti-IgE antibody. To evaluate a possible influence of IL-3 on basophil function, studies were extended to freshly obtained blood basophils (healthy volunteers, n = 3). However, like all other cytokines tested, rhIL-3 failed to induce basophil histamine release. Taken together, our studies demonstrate that IL-3 is a differentiation factor for human basophils.

The production of interferons (IFNs), IFN-gamma, tumor necrosis factors (TNFs) and TNF-alpha (TNF-alpha) by peripheral blood mononuclear cells (PBMNCs) of untransfused and transfused, but otherwise untreated patients with severe aplastic anemia (SAA) was determined using bioassays and immunoassays. In untransfused and pretransfused SAA patients, spontaneous and lectin-induced production of these cytokines by PBMNCs was strongly enhanced. Cytokine production in untransfused SAA patients did not differ from that in pretransfused patients. Similar relative frequencies of activated (HLA-DR+) lymphocyte subpopulations present in the PBMNCs demonstrated cytokine overproduction per cells. Cytokine production was studied in three SAA patients before and after blood cell transfusions. Spontaneous and lectin-induced production of these cytokines was abnormally high and unaffected by blood transfusions. In another patient exhibiting abnormal cytokine production, the hematopoietic response to cyclosporin- A in vivo was accompanied by normalization of cytokine production in vitro. We conclude that overproduction of IFN-gamma and TNF-alpha by lectin-stimulated PBMNCs is an intrinsic abnormality of SAA unrelated to blood transfusions. Normalization of production of IFN-gamma and TNF- alpha accompanying a clinical response to cyclosporin-A may cautiously be taken as further evidence suggesting a pathogenetic role of cytokine overproduction in SAA.

Levels of glycosylated hemoglobins (GHb) are significantly (p less than 0.0005) lower in patients with hemolytic anemia (n = 20; mean = 3.9% +/- 0.1% SD GHb of total Hb) compared to patients with nonhemolytic anemia (n = 20; mean = 7.0% +/- 0.7% GHb) and normal controls (n = 30; mean = 6.7% +/- 0.7% GHb). A curvilinear correlation between GHb and red cell survival is demonstrable (n = 20;r2 = 0.88; p less than 0.001). Determination of GHb may be useful as a screening test for hemolytic anemia and for the evaluation of the degree of hemolysis, provided that diabetes mellitus can be excluded.