Search

The unique capabilities of the atomic force microscope (AFM), including super‐resolution imaging, piconewton force‐sensitivity, nanomanipulation and ability to work under physiological conditions, have offered exciting avenues for cellular and molecular biology research. AFM imaging has helped unravel the fine architectures of microbial cell envelopes at the nanoscale, and how these are altered by antimicrobial treatment. Nanomechanical measurements have shed new light on the elasticity, tensile strength and turgor pressure of single cells. Single‐molecule and single‐cell force spectroscopy experiments have revealed the forces and dynamics of receptor‐ligand interactions, the nanoscale distribution of receptors on the cell surface and the elasticity and adhesiveness of bacterial pili. Importantly, recent force spectroscopy studies have demonstrated that extremely stable bonds are formed between bacterial adhesins and their cognate ligands, originating from a catch bond behaviour allowing the pathogen to reinforce adhesion under shear or tensile stress. Here, we survey how the versatility of AFM has enabled addressing crucial questions in microbiology, with emphasis on bacterial pathogens. TAKE AWAYS: AFM topographic imaging unravels the ultrastructure of bacterial envelopes.Nanomechanical mapping shows what makes cell envelopes stiff and resistant to drugs.Force spectroscopy characterises the molecular forces in pathogen adhesion.Stretching pili reveals a wealth of mechanical and adhesive responses. [ABSTRACT FROM AUTHOR]

Listeria monocytogenes causes listeriosis, a systemic infection which manifests as bacteremia, often complicated by meningoencephalitis in immunocompromised individuals and the elderly, and fetal‐placental infection in pregnant women. It has emerged over the past decades as a major foodborne pathogen, responsible for numerous outbreaks in Western countries, and more recently in Africa. L. monocytogenes' pathogenic properties have been studied in detail, thanks to concomitant advances in biological sciences, in particular molecular biology, cell biology and immunology. L. monocytogenes has also been instrumental to basic advances in life sciences. L. monocytogenes therefore stands both a tool to understand biology and a model in infection biology. This review briefly summarises the clinical and some of the pathophysiological features of listeriosis. In the context of this special issue, it highlights some of the major discoveries made by Pascale Cossart in the fields of molecular and cellular microbiology since the mid‐eighties regarding the identification and characterisation of multiple bacterial and host factors critical to L. monocytogenes pathogenicity. It also briefly summarises some of the key findings from our laboratory on this topic over the past years. [ABSTRACT FROM AUTHOR]

Pathogenic mycobacteria survive in phagocytic host cells primarily as a result of their ability to prevent fusion of their vacuole with lysosomes, thereby avoiding a bactericidal environment. The molecular mechanisms to establish and maintain this replication compartment are not well understood. By combining molecular and microscopical approaches we show here that after phagocytosis the actin nucleation-promoting factor WASH associates and generates F-actin on the mycobacterial vacuole. Disruption of WASH or depolymerization of F-actin leads to the accumulation of the proton-pumping V- ATPase around the mycobacterial vacuole, its acidification and reduces the viability of intracellular mycobacteria. This effect is observed for M . marinum in the model phagocyte D ictyostelium but also for M . marinum and M . tuberculosis in mammalian phagocytes. This demonstrates an evolutionarily conserved mechanism by which pathogenic mycobacteria subvert the actin-polymerization activity of WASH to prevent phagosome acidification and maturation, as a prerequisite to generate and maintain a replicative niche. [ABSTRACT FROM AUTHOR]

Infection by HIV starts when the virus attaches to a susceptible cell. For viral replication to continue, the viral envelope must fuse with a cellular membrane, thereby delivering the viral core to the cytoplasm, where the RNA genome is reverse-transcribed. The key players in this entry by fusion are the envelope glycoprotein, on the viral side, and CD4 and a co-receptor, CCR5 or CXCR4, on the cellular side. Here, the interplay of these molecules is reviewed from cell-biological, structural, mechanistic, and modelling-based perspectives. Hypotheses are evaluated regarding the cellular compartment for entry, the transfer of virus through direct cell-to-cell contact, the sequence of molecular events, and the number of molecules involved on each side of the virus-cell divide. An emerging theme is the heterogeneity among the entry mediators on both sides, a diversity that affects the efficacy of entry inhibitors, be they small-molecule ligands, peptides or neutralizing antibodies. These insights inform rational strategies for therapy as well as vaccination. [ABSTRACT FROM AUTHOR]

The type III secretion system (T3SS) is a sophisticated molecular machinery of Gram-negative bacteria used to ‘inject’ (translocate) bacterial proteins (effectors) into eukaryotic cells. For this, the T3SS has to assemble into a multiprotein complex, which is constituted of distinct parts; a basal body spanning the two bacterial membranes connected with a cytoplasmic bulb, an attached needle structure resembling a molecular syringe, and a distal needle tip structure that re-organizes into a ‘translocon’, which is a protein complex that inserts into the host cellular membrane. Upon engaging with eukaryotic cells, the T3SSs perform ‘single-step’ translocation of bacterial effector proteins across three membranes (two bacterial and one eukaryotic). Since the formulation of the major concepts of the T3SS about 15 years ago, imaging has been a major ingredient for elucidating the T3SS structure and function. Direct observation of molecular events in the context of cells will remain a key feature for better understanding of T3SS structure, regulation and function. In this review we describe how light and electron microscopy have been used to shed light on the processes of maturation and activity of the T3SS. Furthermore, we highlight recent imaging innovations with the potential to provide better insight into the T3SS structure and function. [ABSTRACT FROM AUTHOR]

A common overlapping site on the N-terminal IgV-like domain of human carcinoembryonic antigen (CEA)-related cell adhesion molecules (CEACAMs) is targeted by several important human respiratory pathogens. These include Neisseria meningitidis (Nm) and Haemophilus influenzae (Hi) that can cause disseminated or persistent localized infections. To define the precise structural features that determine the binding of distinct pathogens with CEACAMs, we have undertaken molecular modelling and mutation of the receptor molecules at previously implicated key target residues required for bacterial binding. These include Ser-32, Tyr-34, Val-39, Gln-44 and Gln-89, in addition to Ile-91, the primary docking site for the pathogens. Most, but not all, of these residues located adjacent to each other in a previous N-domain model of human CEACAM1, which was based on REI, CD2 and CD4. In the current studies, we have refined this model based on the mouse CEACAM1 crystal structure, and observe that all of the above residues form an exposed continuous binding region on the N-domain. Examination of the model also suggested that substitution of two of these residues 34 and 89 could affect the accessibility of Ile-91 for ligand binding. By introducing selected mutations at the positions 91, 34 and 89, we confirmed the primary importance of Ile-91 in all bacterial binding to CEACAM1 despite the inter- and intraspecies structural differences between the bacterial CEACAM-binding ligands. The studies further indicated that the efficiency of binding was significantly enhanced for specific strains by mutations such as Y34F and Q89N, which also altered the hierarchy of Nm versus Hi strain binding. These studies imply that distinct polymorphisms in human epithelial CEACAMs have the potential to decrease or increase the risk of infection by the receptor-targeting pathogens. [ABSTRACT FROM AUTHOR]

Adherence of intestinal pathogens, including Escherichia coli O157:H7, to human intestinal epithelial cells is a key step in pathogenesis. Probiotic bacteria, including Lactobacillus helveticus R0052 inhibit the adhesion of E. coli O157:H7 to epithelial cells, a process which may be related to specific components of the bacterial surface. Surface-layer proteins (Slps) are located in a paracrystalline layer outside the bacterial cell wall and are thought to play a role in tissue adherence. However, the ability of S-layer protein extract derived from probiotic bacteria to block adherence of enteric pathogens has not been investigated. Human epithelial (HEp-2 and T84) cells were treated with S-layer protein extract alone, infected with E. coli O157:H7, or pretreated with S-layer protein extract prior to infection to determine their importance in the inhibition of pathogen adherence. The effects of S-layer protein extracts were characterized by phase-contrast and immunofluorescence microscopy and measurement of the transepithelial electrical resistance of polarized monolayers. Pre-treatment of host epithelial cells with S-layer protein extracts prior to E. coli O157:H7 infection decreased pathogen adherence and attaching-effacing lesions in addition to preserving the barrier function of monolayers. These in vitro studies indicate that a non-viable constituent derived from a probiotic strain may prove effective in interrupting the infectious process of an intestinal pathogen. [ABSTRACT FROM AUTHOR]

Earlier studies have established two unusual features in the cell division cycle of Entamoeba histolytica. First, microtubules form a radial assembly instead of a bipolar mitotic spindle, and second, the genome content of E. histolytica cells varied from 1× to 6× or more. In this study, Eh Klp5 was identified as a divergent member of the BimC kinesin family that is known to regulate formation and stabilization of the mitotic spindle in other eukaryotes. In contrast to earlier studies, we show here that bipolar microtubular spindles were formed in E. histolytica but were visible only in 8–12% of the cells after treatment with taxol. The number of bipolar spindles was significantly increased in Eh Klp5 stable transformants (20–25%) whereas Eh Klp5 double-stranded RNA (dsRNA) transformants did not show any spindles (< 1%). The genome content of Eh Klp5 stable transformants was regulated between 1× and 2× unlike control cells. Binucleated cells accumulated in Eh Klp5 dsRNA transformants and after inhibition of Eh Klp5 with small molecule inhibitors in control cells, suggesting that cytokinesis was delayed in the absence of Eh Klp5. Taken together, our results indicate that Eh Klp5 regulates microtubular assembly, genome content and cell division in E. histolytica. Additionally, Eh Klp5 showed alterations in its drug-binding site compared with its human homologue, Hs Eg5 and this was reflected in its reduced sensitivity to Eg5 inhibitors – monastrol and HR22C16 analogues. [ABSTRACT FROM AUTHOR]

T-cell stimulating protein A (TspA) is an immunogenic, T-cell and B-cell stimulating protein of Neisseria meningitidis. Sequence similarity between TspA and FimV, a Pseudomonas aeruginosa protein involved in twitching motility, suggested a link between TspA and type IV pili (Tfp). To determine the role of TspA an isogenic deletion mutant was created. Loss of TspA did not affect twitching motility or piliation indicating that there are functional differences between TspA and FimV. Mutation of tspA led to a significant reduction in adhesion of meningococci to meningothelial and HEp-2 cells, which was not due to a lack of transcription of adjacent genes or pilC1. Other Tfp-mediated phenotypes (i.e. auto-aggregation and transformation competence) were not altered. Our results indicate that the role of TspA in adhesion is unlikely to be directly linked to the function of Tfp. TspA was expressed by all N. meningitidis and Neisseria polysaccharea strains examined but not by Neisseria gonorrhoeae or Neisseria lactamica, although sequences with homology to tspA were present in their genomes. In summary, TspA is a highly conserved antigen that is required for optimal adhesion of meningococci to human cells. [ABSTRACT FROM AUTHOR]

Aspergillus fumigatus is a fungal pathogen causing severe infections in immunocompromised patients. For clearance of inhaled conidia, an efficient response of the innate immune system is required. Macrophages represent the first line of defence and ingest and kill conidia. C-type lectins represent a family of receptors, which recognize pathogen-specific carbohydrates. One of them is β1–3 glucan, a major component of the fungal cell wall. Here we provide evidence that β1–3 glucan plays an important role for the elimination of A. fumigatus conidia. Laminarin, a soluble β1–3 glucan and antibodies to dectin-1, a well known β1–3 glucan receptor, significantly inhibited conidial phagocytosis. On resting conidia low amounts of surface accessible β1–3 glucan were detected, whereas high amounts were found on small spores that appear early during germination and infection as well as on resting conidia of a pksP mutant strain. Swollen conidia also display larger quantities of β1–3 glucan, although in an irregular spotted pattern. Resting pksP mutant conidia and swollen wild-type conidia are phagocytosed with high efficiency thereby confirming the relevance of β1–3 glucans for conidial phagocytosis. Additionally we found that TLR2 and the adaptor protein MyD88 are required for efficient conidial phagocytosis, suggesting a link between the TLR2-mediated recognition of A. fumigatus and the phagocytic response. [ABSTRACT FROM AUTHOR]

Burkholderia pseudomallei is a facultative intracellular pathogen and the causative agent of melioidosis, a spectrum of potentially fatal diseases endemic in Northern Australia and South-East Asia. We demonstrate that B. pseudomallei rapidly modifies infected macrophage-like cells in a manner analagous to osteoclastogenesis. These alterations include multinucleation and the expression by infected cells of mRNA for factors required for osteoclastogenesis: the chemokines monocyte chemotactic protein 1 (MCP-1), macrophage inflammatory protein 1 gamma (MIP-1γ), ‘regulated on activation normal T cell expressed and secreted’ (RANTES) and the transcription factor ‘nuclear factor of activated T-cells cytoplasmic 1’ (NFATc1). An increase in expression of these factors was also observed after infection with Burkholderia thailandensis. Expression of genes for the osteoclast markers calcitonin receptor (CTR), cathepsin K (CTSK) and tartrate-resistant acid phosphatase (TRAP) was also increased by B. pseudomallei-infected, but not by B. thailandensis-infected cells. The expression by B. pseudomallei-infected cells of these chemokine and osteoclast marker genes was remarkably similar to cells treated with RANKL, a stimulator of osteoclastogenesis. Analysis of dentine resorption by B. pseudomallei-induced osteoclast-like cells revealed that demineralization may occur but that authentic excavation does not take place under the tested conditions. Furthermore, we identified and characterized lfpA (for actonase amily rotein A) in B. pseudomallei, which shares significant sequence similarity with the eukaryotic protein ‘regucalcin’, also known as ‘senescence marker protein-30’ (SMP-30). LfpA orthologues are widespread in prokaryotes and are well conserved, but are phylogenetically distinct from eukaryotic regucalcin orthologues. We demonstrate that lfpA mRNA expression is dramatically increased in association with macrophage-like cells. Mutation of lfpA significantly reduced expression of the tested host genes, relative to the response to wild-type B. pseudomallei. We also show that lfpA is required for optimal virulence in vivo. [ABSTRACT FROM AUTHOR]

Bacillus anthracis is a sporulating Gram-positive bacterium that causes the disease anthrax. The highly stable spore is the infectious form of the bacterium that first interacts with the prospective host, and thus the interaction between the host and spore is vital to the development of disease. We focused our study on the response of murine splenocytes to the B. anthracis spore by using paraformaldehyde-inactivated spores (FIS), a treatment that prevents germination and production of products associated with vegetative bacilli. We found that murine splenocytes produce IL-12 and IFN-γ in response to FIS. The IL-12 was secreted by CD11b cells, which functioned to induce the production of IFN-γ by CD49b (DX5) NK cells. The production of these cytokines by splenocytes was not dependent on TLR2, TLR4, TLR9, Nod1, or Nod2; however, it was dependent on the signalling adapter protein MyD88. Unlike splenocytes, Nod1- and Nod2-transfected HEK cells were activated by FIS. Both IL-12 and IFN-γ secretion were inhibited by treatment with B. anthracis lethal toxin. These observations suggest that the innate immune system recognizes spores with a MyD88-dependent receptor (or receptors) and responds by secreting inflammatory cytokines, which may ultimately aid in resisting infection. [ABSTRACT FROM AUTHOR]

Previous studies suggested Plasmodium sporozoites infect hepatocytes after passing through Kupffer cells, but proof has been elusive. Here we present new information strengthening that hypothesis. We used homozygous op/op mice known to have few Kupffer cells because they lack macrophage colony stimulating factor 1 required for macrophage maturation due to a deactivating point mutation in the osteopetrosis gene. We found these mice to have 77% fewer Kupffer cells and to exhibit reduced clearance of colloidal carbon particles compared with heterozygous phenotypically normal littermates. Using a novel quantitative reverse transcription polymerase chain reaction assay for P. yoelii 18S rRNA, we found liver infection of op/op mice to be decreased by 84% compared with controls. However, using another way of limiting Kupffer cells, treatment with liposome-encapsulated clodronate, infection of normal mice was enhanced seven- to 15-fold. This was explained by electron microscopy showing temporary gaps in the sinusoidal cell layer caused by this treatment. Thus, Kupffer cell deficiency in op/op mice decreases sporozoite infection by reducing the number of portals to the liver parenchyma, whereas clodronate increases sporozoite infection by opening portals and providing direct access to hepatocytes. Together these data provide strong support for the hypothesis that Kupffer cells are the portal for sporozoites to hepatocytes and critical for the onset of a malaria infection. [ABSTRACT FROM AUTHOR]

By combining intravital multiphoton microscopy and bacterial genetics we have developed a technique enabling real-time imaging of bacterial proliferation and tissue responses in a live animal. Spatial and temporal control of the infection process was achieved by microinjecting GFP+-expressing uropathogenic Escherichia coli (UPEC) into tubules of exteriorized kidneys in live rats. GFP+ was introduced in the clinical UPEC strain CFT073 as a single-copy chromosomal gene fusion. Within hours, bacterial colonization was accompanied by marked ischaemic effects, perivascular leakage, loss of tubular integrity and localized recruitment of immune cells. The pathophysiology was altered in response to an isogenic bacterial strain lacking the exotoxin haemolysin, revealing the subtle and temporal roles of bacterial virulence factors in vivo. Microdissection and RNA extraction of the injected nephron allowed molecular analysis of prokaryotic and eukaryotic gene expression. The techniques described here can be applied to study the integrated cell communication evoked by a variety of bacterial pathogens, assisting in the design of strategies to combat bacterial infections. [ABSTRACT FROM AUTHOR]

Yersinia enterocolitica (Ye) targets mouse dendritic cells (DCs) and inhibits their ability to trigger T cell activation. Here we have investigated whether Ye might interfere with antigen presentation in DCs. Infection of DCs with the Ye wild-type strain reduced OVA uptake by DCs as demonstrated by flow cytometry and confocal laser scan microscopy. In contrast, DCs infected with Yersinia outer protein P (YopP)-deficient mutant strain rapidly internalized OVA. Furthermore, transfection of DCs with YopP, but not with a cysteine protease deficient YopP-C172A mutant, reduced uptake of OVA. This finding suggests that YopP, a virulence factor of Ye, inhibits OVA uptake by DCs. By the use of MAPK inhibitors we provide evidence that YopP mediates reduction of OVA uptake by its ability to block MAPK signalling pathways in host cells. Using transferrin (Tf) as specific marker for clathrin-mediated endocytosis (CME) and lucifer yellow (LY) as specific marker for macropinocytosis (MP) we could show that YopP inhibits CME, whereas other Yops inhibit MP. In keeping with these data, activation and proliferation of OVA-specific T cells was reduced when DCs were treated with MAPK inhibitors. Together, our data demonstrate that (i) MAPK play an important role in antigen uptake by CME in DCs, and (ii) that YopP inhibits thispathway of antigen uptake in DCs, which might contribute to evasion of adaptive immunity. [ABSTRACT FROM AUTHOR]

Guinea pigs are highly susceptible to Legionella pneumophila infection and therefore have been the preferred animal model for studies of legionellosis. In this study guinea pig infections revealed that the Legionella virulence factor Mip (macrophage infectivity potentiator) contributes to the bacterial dissemination within the lung tissue and the spread of Legionella to the spleen. Histopathology of infected animals, binding assays with components of the extracellular matrix (ECM), bacterial transmigration experiments across an artificial lung epithelium barrier, inhibitor studies and ECM degradation assays were used to elucidate the underlying mechanism of the in vivo observation. The Mip protein, which belongs to the enzyme family of FK506-binding proteins (FKBP), was shown to bind to the ECM protein collagen (type I, II, III, IV, V, VI). Transwell assays with L. pneumophila and recombinant Escherichia coli HB101 strains revealed that Mip enables these bacteria to transmigrate across a barrier of NCI-H292 lung epithelial cells and ECM (NCI-H292/ECM barrier). Mip-specific monoclonal antibodies and the immunosuppressants rapamycin and FK506, which inhibit the peptidyl prolyl cis/trans isomerase (PPIase) activity of Mip, were able to inhibit this transmigration. By using protease inhibitors we found that the penetration of the NCI-H292/ECM barrier additionally requires a serine protease activity. Degradation assays with 35S-labelled ECM proteins supported the finding of a concerted action of Mip and a serine protease. The described synergism between the activity of the collagen binding Mip protein and the serine protease activity represents an entirely new mechanism for bacterial penetration of the lung epithelial barrier and has implications for other prokaryotic and eukaryotic pathogens. [ABSTRACT FROM AUTHOR]

After attaching to human intestinal epithelial cells, enteropathogenic Escherichia coli (EPEC) induces the formation of an actin-rich pedestal-like structure. The signalling pathway leading to pedestal formation is initiated by the bacterial protein Tir, which is inserted into the host cell plasma membrane. The domain exposed on the cell surface binds to another bacterial protein, intimin, while one of the cytoplasmic domains binds the adaptor protein Nck. This leads to recruitment of other cytoskeletal proteins including neural Wiskott–Aldrich syndrome protein (N-WASP) and Arp2/3, resulting in focused actin polymerization at the site of bacterial attachment. In this study we investigated the role of the large GTPase dynamin 2 (Dyn2) in pedestal formation. We found that in HeLa cells, both endogenous and overexpressed Dyn2 were recruited to sites of EPEC attachment. Recruitment of endogenous Dyn2 required the presence of Tir, Nck and N-WASP but was independent of cortactin and Arp2/3. Knock-down of Dyn2 expression by RNA interference reduced actin polymerization and pedestal formation. Overexpression of dominant-negative mutants of Dyn2 also reduced pedestal formation and prevented recruitment of N-WASP, Arp3 and cortactin, but not Nck. Together, our results indicate that Dyn2 is an integral component of the signalling cascade leading to actin polymerization in EPEC pedestals. [ABSTRACT FROM AUTHOR]

Malaria is an infectious disease that causes serious morbidity and mortality worldwide. The disease is associated with a variety of clinical syndromes ranging from asymptomatic to lethal infections involving anaemia, organ failure, pulmonary and cerebral disease. The molecular and cellular factors responsible for the differences in disease severity are poorly understood but parasite-specific immune responses are thought to play a critical role in pathogenesis. Dendritic cells have an essential role in linking innate and adaptive immune responses and here we review their role in the context of malaria. [ABSTRACT FROM AUTHOR]

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′-protruded cohesive ends and cohesive sequence is ′GCCGGCCCCTTTCCGCGTTA′ (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′-end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′-end of tRNALys gene of host bacteria genome is hot spot of the integration. [ABSTRACT FROM AUTHOR]

Dendritic cells (DCs) act not only as sentinels for detection of, but also as target cells for viruses, and this can be important for viral transport and spread. All subsets of DCs are equipped with a battery of receptors recognizing virus-associated molecular signatures, and recognition of those launches a maturation programme that results in substantial alterations of morphology, motility and the DCs' interactive properties with the extracellular matrix and scanning T cells. In addition to being sensed, viruses are internalized into DCs and, for the major proportion, processed into peptides that are subsequently presented by major histocompatibility complex (MHC) molecules. Transmission of virus to T cells can occur after completion of their replication cycle if the intracellular milieu of the DC permits that. Alternatively, viruses can remain protected from degradation following entrapment by pattern recognition receptors in intracellular compartments, also referred to as virosomes, which translocate towards the DC/T cell interface. Most likely, transfer of virus to T cells occurs in these junctions, referred to as infectious synapses. In addition to promoting DC maturation, many viruses are able to downmodulate DC development and functions in order to evade immune recognition or to induce a generalized immunosuppression. [ABSTRACT FROM AUTHOR]

Toxoplasma gondii, as many intracellular parasites, is separated from the cytosol of its host cell by a parasitophorous vacuole membrane (PVM). This vacuole forms during host cell invasion and parasite apical organelles named rhoptries discharge proteins that associate with its membrane during this process. We report here the characterization of the rhoptry protein ROP5, which is a new member of the ROP2 family. Contrasting with what is known for other ROP2 family proteins, ROP5 is not processed during trafficking to rhoptries. We show here that ROP5 is secreted during invasion and associates with the PVM. Using differential permeabilization of infected cells, we have shown that ROP5 exposes its C-terminus towards the host cell cytoplasm, which corresponds to a reverse topology compared with ROP2 and ROP4. Taken together with recent modelling data suggesting that the C-terminal hydrophobic domain hitherto described as transmembrane may correspond to a hydrophobic helix buried in the catalytic domain of kinase-related proteins, these findings call for a reappraisal of the current view of ROP2 family proteins association with the PVM. [ABSTRACT FROM AUTHOR]

Pseudomonas aeruginosa causes life-threatening infections in compromised and cystic fibrosis patients. Pathogenesis stems from a number of virulence factors, including four type III translocated cytotoxins: ExoS, ExoT, ExoY and ExoU. ExoS is a bifunctional toxin: the N terminus (amino acids 96–219) encodes a Rho TPase ctivating rotein (GAP) domain. The C terminus (amino acids 234–453) encodes a 14-3-3-dependent ADP-ribosyltransferase domain which transfers ADP-ribose from NAD onto substrates such as the Ras GTPases and vimentin. Ezrin/radixin/moesin (ERM) proteins have recently been identified as high-affinity substrates for ADP-ribosylation by ExoS. Expression of ExoS in HeLa cells led to a loss of phosphorylation of ERM proteins that was dependent upon the expression of ADP-ribosyltransferase activity. MALDI-MS and site-directed mutagenesis studies determined that ExoS ADP-ribosylated moesin at three C-terminal arginines (Arg553, Arg560 and Arg563), which cluster Thr558, the site of phosphorylation by protein kinase C and Rho kinase. ADP-ribosylated-moesin was a poor target for phosphorylation by protein kinase C and Rho kinase, which showed that ADP-ribosylation directly inhibited ERM phosphorylation. Expression of dominant active-moesin inhibited cell rounding elicited by ExoS, indicating that moesin is a physiological target in cultured cells. This is the first demonstration that a bacterial toxin inhibits the phosphorylation of a mammalian protein through ADP-ribosylation. These data explain how the expression of the ADP-ribosylation of ExoS modifies the actin cytoskeleton and indicate that ExoS possesses redundant enzymatic activities to depolymerize the actin cytoskeleton. [ABSTRACT FROM AUTHOR]

Strains of the Burkholderia cepacia complex (Bcc) are opportunistic bacteria that can cause life-threatening infections in patients with cystic fibrosis and chronic granulomatous disease. Previous work has shown that Bcc isolates can persist in membrane-bound vacuoles within amoeba and macrophages without bacterial replication, but the detailed mechanism of bacterial persistence is unknown. In this study, we have investigated the survival of the Burkholderia cenocepacia strain J2315 within RAW264.7 murine macrophages. Strain J2315 is a prototypic isolate of the widespread and transmissible ET12 clone. Unlike heat-inactivated bacteria, which reach lysosomes shortly after internalization, vacuoles containing live B. cenocepacia J2315 accumulate the late endosome/lysosome marker LAMP-1 and start fusing with lysosomal compartments only after 6 h post internalization. Using fluorescent fluid-phase probes, we also demonstrated that B. cenocepacia-containing vacuoles continued to interact with newly formed endosomes, and maintained a luminal pH of 6.4 ± 0.12. In contrast, vacuoles containing heat-inactivated bacteria had an average pH of 4.8 ± 0.03 and rapidly merged with lysosomes. Additional experiments using concanamycin A, a specific inhibitor of the vacuolar H+-ATPase, revealed that vacuoles containing live bacteria did not exclude the H+-ATPase. This mode of bacterial survival did not require type III secretion, as no differences were found between wild type and a type III secretion mutant strain. Collectively, our results suggest that intracellular B. cenocepacia cause a delay in the maturation of the phagosome, which may contribute to facilitate bacterial escape from the microbicidal activities of the host cell. [ABSTRACT FROM AUTHOR]

Erwinia Virulence Factor (Evf) has been identified in Erwinia carotovora carotovora 15 ( Ecc15) as a virulence factor that promotes colonization of the Drosophila larval gut and provokes the triggering of a systemic immune response. Here we have analysed how Evf promotes persistence and colonization of bacteria inside the larval gut. Erwinia evf mutants do not persist in immune-deficient Drosophila, indicating that Evf does not act by counteracting immunity. The results indicated that Evf is not a toxin because various Gram-negative bacteria expressing evf can persist without affecting viability of Drosophila larvae. Evf did not appear to be a factor antagonizing a host-specific reaction because in vitro assays failed to reveal detoxifying enzymatic activities against various compounds thought to contribute to the hostile environment of the gut. These findings were corroborated by the observation that Evf is not required for survival in midgut organ cultures. By contrast, bacteria expressing evf allow persistence in trans of bacteria lacking evf indicating that Evf promotes the accumulation of Gram-negative bacteria in the anterior midgut by affecting gut physiology. [ABSTRACT FROM AUTHOR]

Streptococcus gordonii is a commensal bacterium that colonizes the hard and soft tissues present in the human mouth and nasopharynx. The cell wall-anchored polypeptides SspA and SspB expressed by S. gordonii mediate a wide range of interactions with host proteins and other bacteria. In this article we have determined the role of SspA and SspB proteins, which are members of the streptococcal antigen I/II (AgI/II) adhesin family, in S. gordonii adherence and internalization by epithelial cells. Wild-type S. gordonii DL1 expressing AgI/II polypeptides attached to and was internalized by HEp-2 cells, whereas an isogenic AgI/II– mutant was reduced in adherence and was not internalized. Association of S. gordonii DL1 with HEp-2 cells triggered protein tyrosine phosphorylation but no significant actin rearrangement. By contrast, Streptococcus pyogenes A40 showed 50-fold higher levels of internalization and this was associated with actin polymerization and interleukin-8 upregulation. Adherence and internalization of S. gordonii by HEp-2 cells involved β1 integrin recognition but was not fibronectin-dependent. Recombinant SspA and SspB polypeptides bound to purified human α5β1 integrin through sequences present within the NAV (N-terminal) region of AgI/II polypeptide. AgI/II polypeptides blocked interactions of S. gordonii and S. pyogenes with HEp-2 cells, and S. gordonii DL1 cells expressing AgI/II proteins inhibited adherence and internalization of S. pyogenes by HEp-2 cells. Conversely, S. gordonii AgI/II– mutant cells did not inhibit internalization of S. pyogenes. The results suggest that AgI/II proteins not only promote integrin-mediated internalization of oral commensal streptococci by host cells, but also potentially influence susceptibility of host tissues to more pathogenic bacteria. [ABSTRACT FROM AUTHOR]

Previous reports have shown that cells infected with promastigotes of some Leishmania species are resistant to the induction of apoptosis. This would suggest that either parasites elaborate factors that block signalling from apoptosis inducers or that parasites engage endogenous host signalling pathways that block apoptosis. To investigate the latter scenario, we determined whether Leishmania infection results in the activation of signalling pathways that have been shown to mediate resistance to apoptosis in other infection models. First, we showed that infection with the promastigote form of Leishmania major, Leishmania pifanoi and Leishmania amazonensis activates signalling through p38 mitogen-activated protein kinase (MAPK), NFκB and PI3K/Akt. Then we found that inhibition of signalling through the PI3K/Akt pathway with LY294002 and Akt IV inhibitor reversed resistance of infected bone marrow-derived macrophages and RAW 264.7 macrophages to potent inducers of apoptosis. Moreover, reduction of Akt levels with small interfering RNAs to Akt resulted in the inability of infected macrophages to resist apoptosis. Further evidence of the role of PI3K/Akt signalling in the promotion of cell survival by infected cells was obtained with the finding that Bad, which is a substrate of Akt, becomes phosphorylated during the course of infection. In contrast to the observations with PI3K/Akt signalling, inhibition of p38 MAPK signalling with SB202190 or NFκB signalling with wedelolactone had limited effect on parasite-induced resistance to apoptosis. We conclude that Leishmania promastigotes engage PI3K/Akt signalling, which confers to the infected cell, the capacity to resist death from activators of apoptosis. [ABSTRACT FROM AUTHOR]

Adhesion to brain microvascular endothelial cells, which constitute the blood–brain barrier is considered important in Escherichia coli K1 bacterial penetration into the central nervous system. Type 1 fimbriae are known to mediate bacterial interactions with human brain microvascular endothelial cells (HBMEC). Here, we demonstrate that type 1 fimbriae, specifically FimH adhesin is not only an adhesive organelle that provides bacteria with a foothold on brain endothelial cells but also triggers signalling events that promote E. coli K1 invasion in HBMEC. This is shown by our demonstrations that exogenous FimH increases cytosolic-free-calcium levels as well as activates RhoA. Using purified recombinant mannose-recognition domain of FimH, we identified a glycosylphosphatidylinositol-anchored receptor, CD48, as a putative HBMEC receptor for FimH. Furthermore, E. coli K1 binding to and invasion of HBMEC were blocked by CD48 antibody. Taken together, these findings indicate that FimH induces host cell signalling cascades that are involved in E. coli K1 invasion of HBMEC and CD48 is a putative HBMEC receptor for FimH. [ABSTRACT FROM AUTHOR]

Neisseria meningitidis (Nm) is a human specific opportunistic pathogen that occasionally penetrates mucosal barriers via the action of adhesins and invasins and evades host immune mechanisms during further dissemination via capsule expression. From in vitro studies, the primary adhesion of capsulate bacteria is believed to be mediated by polymeric pili, followed by invasion via outer membrane adhesins such as Opa proteins. As the latter requires the surface capsule to be down-modulated, invading bacteria would be serum sensitive and thus avirulent. However, there is recent evidence that capsulate bacteria may interact via Opa proteins when host cells express high levels of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), their target receptors. Such a situation may arise following increased circulation of inflammatory cytokines that upregulate certain adhesion molecules on host cells. In this study, using a tetracycline controlled expression system, we have developed cell lines with inducible CEACAM expression to mimic post-inflammation state of target tissues and analysed the interplay between the three surface components capsule, pili and Opa proteins in cellular interactions. With two distinct cell lines, not only the level but also the rate of adhesion of capsulate Opa-expressing Nm increased concurrently with CEACAM density. Moreover, when threshold levels of receptor were reached, cellular invasion ensued in an Opa-dependent manner. In studies with cell lines intrinsically expressing pilus receptors, notable synergism in cellular interactions between pili and Opa of several meningococcal strains was observed and was independent of capsule type. A number of internalized bacteria were shown to express capsule and when directly isolated from host cells, these bacteria were as serum resistant as the inoculated phenotype. Furthermore, we observed that agents that block Opa–CEACAM binding substantially reduced cellular invasion, while maintaining a low level of cellular adhesion. These studies highlight some of the factors that may determine increased host susceptibility to infection by serum resistant phenotypes; and demonstrate the potential of selective inhibition of key interactions in preventing target tissue penetration while maintaining a level of colonization. [ABSTRACT FROM AUTHOR]

Attaching and effacing (A/E) pathogens such as enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) cause serious global health problems. These bacteria colonize the gastrointestinal system, attach to intestinal epithelial cells, efface (collapse) infected cell microvilli and cause overt diarrhoea that may ultimately result in death of the host. Although pathogenically induced diarrhoea is a significant global health issue, the molecular mechanisms that underlie this disease remain largely unknown. A natural murine infection model, employing the A/E pathogen Citrobacter rodentium, has been helpful in studying the diseases in vivo. C. rodentium colonize the colon at high levels, attach to colonocytes, efface microvilli and cause hyperplasia and inflammation in infected mice. As the disease progresses, the mice develop a diarrhoea-like phenotype. Aquaporin (AQP) water channels have been proposed to play a role in the normal dehydration of faecal contents. Here we examine whether C. rodentium infection may alter AQP localization in colonocytes. We demonstrate that during infection, AQP2 and AQP3 are mislocalized from their normal location along cell membranes to the cell cytoplasm. The change in localization of these proteins correlates with the diarrhoea-like phenotype present in infected mice. Mice that recover from the infection at 28–35 days post inoculum regain their normal membrane AQP localization. The altered localization of AQPs is partially dependent on the bacterial type III effector proteins EspF and EspG. We conclude that altered AQP localization may be a contributing factor to diarrhoea during bacterial infection. [ABSTRACT FROM AUTHOR]

Mycoplasma have been shown to be involved in the alteration of several eukaryotic cell functions, such as cytokine production, gene expression and more. We have previously reported that infection of human myelomonocytic U937 cell line with live Mycoplasma fermentans ( M. fermentans) inhibited tumour necrosis factor (TNF-alpha)-induced apoptosis. Mycoplasmal membrane lipoproteins are considered to be the most potent initiators of inflammatory reactions in mycoplasmal infections. The aim of this study was to clarify whether the inhibitory effect on TNFα-induced apoptosis is exerted by M. fermentans lipoproteins (LPMf). A significant reduction in TNFα-induced apoptosis was demonstrated by stimulation of U937 cells with M. fermentans total proteins, LPMf or MALP-2 ( M. fermentans synthetic lipopeptide), but not with M. fermentans hydrophilic protein preparation (AqMf). To investigate the mechanism of M. fermentans antiapoptotic effect, the reduction of mitochondrial transmembrane potential (ΔΨm) was measured. M. fermentans total proteins LPMf and MALP-2, but not AqMf, inhibited the reduction of ΔΨm. In addition, M. fermentans total proteins LPMf and MALP-2, but not AqMf, downregulated the formation of active caspase-8. NF-κB was transactivated in cells treated with M. fermentans lipoproteins, and was essential for host cell survival, but not for the inhibition of TNFα-induced apoptosis by LPMf. Our results suggest that the inhibitory effect exerted by M. fermentans on TNFα-induced apoptosis in U937 cells is due to the membrane lipoproteins of these bacteria. [ABSTRACT FROM AUTHOR]

To screen for an effective antiviral compound which acts as a membrane fluidity modulator, dichotomous effects on human immunodeficiency virus type 1 (HIV-1) infection due to different treatments of several glycolipids and lipids were examined. Continuous treatment of infected cells with 40 μg ml−1 fattiviracin FV-8, a neutral glycolipid isolated from Streptomycetes, inhibited HIV-1 infection by 96%, whereas pretreatment with 400 μg ml−1 enhanced infectivity 4.7-fold. The glycolipid showed similar effects as glycyrrhizin; it inhibited infection by broad enveloped viruses, blocked cell–cell fusion, reduced the infectivity of treated virions and enhanced susceptibility to viral infection and cell–cell fusion of cells pretreated with high doses of the compound. Suppression and enhancement was correlated with decreased and increased fluidity of plasma membrane of the fattiviracin FV-8-treated cells. Restricted movement of membrane molecules might impede the formation of a wide fusion pore, and therefore be critical to the entry of viruses. Thus, this can be applied as a new strategy to inhibit viral infections. [ABSTRACT FROM AUTHOR]

Afa/Dr diffusely adhering Escherichia coli (DAEC) strains are responsible for urinary tract and intestinal infections. Both in intestine and kidney, the epithelial cells forming epithelium are sealed by junctional domains. We provide evidence that the ecreted utotransporter oxin, Sat, belonging to the subfamily of serine protease autotransporters of Enterobacteriaceae (SPATEs), acts as a virulence factor in Afa/Dr DAEC by promoting lesions in the tight junctions (TJs) of polarized epithelial Caco-2/TC7 cells. Southern blot analysis reveals that the prototype strains of the subclass-1 and subclass-2 typical Afa/Dr DAEC strains, hybridize with a sat probe. Using the wild-type IH11128 strain, the recombinant E. coli AAEC185 strain that expresses Sat, the recombinant E. coli that expresses both Dr adhesin and Sat, we report that Sat in monolayers of cultured enterocyte-like Caco-2/TC7 cells, induces rearrangements of the TJs-associated proteins ZO-1, ZO-3 and occludin, and increases the formation of domes as the result of an increase in the paracellular permeability without affecting the transepithelial electrical resistance of the cell monolayers. Moreover, we observe that Sat-induced disassembly of TJs-associated proteins is dependent on the serine protease motif. Finally, an analysis of the prevalence of the sat gene in three collections of Afa/Dr DAEC strains collected from the stools of children with and without diarrhoea, and from the urine of patients with urinary tract infection (UTI) shows that: (i) the sat gene is highly prevalent in UTI-associated Afa/Dr DAEC strains (88% positive), (ii) the sat gene is generally absent from Afa/Dr DAEC strains collected from the stools of children without diarrhoea (16% positive); whereas (iii) it is present in about half of the strains collected from the stools of children with diarrhoea (46% positive). [ABSTRACT FROM AUTHOR]

For Chlamydia, an intracellular pathogen of humans, host cell invasion is obligatory for survival, growth and pathogenesis. At the molecular level, little is known about the binding and entry of Chlamydia into the mammalian host cell. Chlamydia are genetically intractable therefore experimental approaches targeting the host are often necessary. CHO6 is a mutagenized cell line resistant to attachment and infection by Chlamydia. In this study, CHO6 was shown using proteomic methods to have a defect in processing of the leader sequence for protein disulfide isomerase (PDI). Complementation by expression of full-length PDI restored C. trachomatis binding and infectivity in the CHO6 mutant cell line. The cell line was also resistant to diphtheria toxin and required complemented cell-surface PDI for toxin entry. These data demonstrate that native PDI at the cell surface is required for effective chlamydial attachment and infectivity. [ABSTRACT FROM AUTHOR]

We investigated the role of listeriolysin O (LLO) and the bacterial phospholipases PI-PLC and PC-PLC in cell-to-cell spread of Listeria monocytogenes. We showed that LLO is essential for cell-to-cell spread in primary murine macrophages. Electron micrographs revealed that in the absence of continued LLO expression, bacteria remain trapped in secondary spreading vacuoles having either a double or single membrane. In bacteria lacking PI-PLC and PC-PLC, cessation of LLO expression after initiation of infection resulted in a significant increase in the proportion of bacteria trapped in double-membrane compartments. We propose that the bacterial phospholipases are involved in the dissolution of the inner membrane of the spreading vacuole, yet are not sufficient for disruption of the outer membrane. As a consequence, we identified LLO as a key factor in the disruption of the outer membrane. This model is consistent with the observation that LLO is dispensable for cell-to-cell spread from human macrophages into a cell type in which LLO is not required for vacuolar escape. These data suggest that during human infection, spreading of L. monocytogenes to distant organs is likely to occur even in the absence of LLO expression, and that the bacterial phospholipases may be sufficient to mediate continued cell-to-cell spread. [ABSTRACT FROM AUTHOR]

The last 4 years have seen significant advances in our understanding of the cellular processes that underlie the infection of plants by a range of biotrophic and necrotrophic oomycete pathogens. Given that oomycete and fungal pathogens must overcome the same sets of physical and chemical barriers presented by plants, it is not surprising that many aspects of oomycete infection strategies are similar to those of fungal pathogens. A major difference, however, centres on the role of motile oomycete zoospores in actively moving the pathogen to favourable infection sites. Recent studies have shown that the plant defence response to invading oomycetes is similar to that mounted against fungi, but biochemical differences between oomycete and fungal surface molecules must have implications for plant recognition of and defence against oomycete pathogens. The aim of this short review is to provide a cell biological framework within which emerging data on the molecular basis of oomycete–plant interactions may be placed. [ABSTRACT FROM AUTHOR]

To identify Candida albicans genes whose proteins are necessary for host cell interactions and virulence, a collection of C. albicans insertion mutants was screened for strains with reduced capacity to damage endothelial cells in vitro. This screen identified CKA2. CKA2 and its homologue CKA1 encode the catalytic subunits of the protein kinase CK2. cka2Δ /cka2Δ strains of C. albicans were constructed and found to have significantly reduced capacity to damage both endothelial cells and an oral epithelial cell line in vitro. Although these strains invaded endothelial cells similarly to the wild-type strain, they were defective in oral epithelial cell invasion. They were also hypersusceptible to hydrogen peroxide, but not to high salt or to cell wall damaging agents. A cka1Δ /cka1Δ mutant caused normal damage to both endothelial cells and oral epithelial cells, and it was not hypersusceptible to hydrogen peroxide. However, overexpression of CKA1 in a cka2Δ /cka2Δ strain restored wild-type phenotype. Although the cka2Δ /cka2Δ mutant had normal virulence in the mouse model of haematogenously disseminated candidiasis, it had significantly attenuated virulence in the mouse model of oropharyngeal candidiasis. Therefore, Cka2p governs the interactions of C. albicans with endothelial and oral epithelial cells in vitro and virulence during oropharyngeal candidiasis. [ABSTRACT FROM AUTHOR]

The Dot/Icm type IV secretion system of Legionella pneumophila triggers robust activation of caspase-3 during early and exponential stages of proliferation within human macrophages, but apoptosis is delayed till late stages of infection, which is novel. As caspase-3 is the executioner of the cell, we tested the hypothesis that L. pneumophila triggers anti-apoptotic signalling within the infected human macrophages to halt caspase-3 from dismantling the cells. Here we show that during early and exponential replication, L. pneumophila-infected human monocyte-derived macrophages (hMDMs) exhibit a remarkable resistance to induction of apoptosis, in a Dot/Icm-dependent manner. Microarray analyses and real-time PCR reveal that during exponential intracellular replication, L. pneumophila triggers upregulation of 12 anti-apoptotic genes that are linked to activation of the nuclear transcription factor kappa-B (NF-κB). Our data show that L. pneumophila induces a Dot/Icm-dependent sustained nuclear translocation of the p50 and p65 subunits of NF-κB during exponential intracellular replication. Bacterial entry is essential both for the anti-apoptotic phenotype of infected hMDMs and for nuclear translocation of the p65. Using p65–/– and IKKα–/–β–/– double knockout mouse embryonic fibroblast cell lines, we show that nuclear translocation of NF-κB is required for the resistance of L. pneumophila-infected cells to apoptosis-inducing agents. In addition, the L. pneumophila-induced nuclear translocation of NF-κB requires the activity of IKKα and/or IKKβ. We conclude that although the Dot/Icm secretion system of L. pneumophila elicits an early robust activation of caspase-3 in human macrophages, it triggers a strong anti-apoptotic signalling cascade mediated, at least in part by NF-κB, which renders the cells refractory to external potent apoptotic stimuli. [ABSTRACT FROM AUTHOR]

Pro-inflammatory macrophage apoptosis is pivotal in the aetiology of bacillary dysentery, an acute inflammatory diarrhoea caused by Shigella spp. S. flexneri triggers its uptake by macrophages, escapes the phagosome and kills the host cell by a cytotoxic pathway, which activates and requires caspase-1 [interleukin (IL)-1β-converting enzyme] and releases mature IL-1β. The bacterial type III-secreted translocator/effector protein IpaB triggers cell death and directly binds to caspase-1. Here, we demonstrate that in S. flexneri-infected macrophages, activated caspase-1 is present in the cytoplasm, the nucleus and on vesicular membranes. IpaB partitions with membrane and cytoplasmic fractions and colocalizes with activated caspase-1 on the surface of bacteria, in the macrophage cytoplasm and on vesicular membranes. Macrophages treated with the cholesterol-sequestering compound methyl-β-cyclodextrin (MCD) were depleted from cholesterol within minutes and were impaired for phagocytosis of S. flexneri. Consequently, cytotoxicity as determined by lactate dehydrogenase release was blocked. Interestingly, if MCD was added 15–30 min post infection, cytotoxicity, activation of caspase-1, and apoptosis were inhibited, while phagocytosis of the bacteria, escape from the phagosome and type III secretion of IpaB was not affected. Inhibition of Shigella cytotoxicity by MCD coincided with a reduced association of IpaB to host cell membranes. Contrarily, the activation of caspase-1 and cytotoxicity triggered by the K+/H+ antiport ionophore nigericin or by ATP was not affected or even increased by MCD. These results indicate that cholesterol is specifically required for caspase-1 activation and apoptosis triggered by Shigella after the escape from phagosomes, and suggest that membrane association of IpaB contributes to the activation of caspase-1. [ABSTRACT FROM AUTHOR]