Search

Background : Vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) is a potent inducer of new blood vessel growth (angiogenesis) that contributes to the pathology of many angiogenesis-associated disease states such as psoriasis, rheumatoid arthritis and cancer. Few molecular entities capable of binding to VPF/VEGF with high affinity and specificity have been described to date. Results : Nuclease-resistant 2′-amino-2′-deoxypyrimidine nucleotide RNA (2′-aminopyrimidine RNA) ligands that bind to VPF/VEGF with high affinity have been identified by iterative rounds of affinity-selection/amplification from two independent random libraries. The sequence information that confers high affinity binding toVPF/VEGF is contained in a contiguous stretch of 24 nucleotides, 5′- CCCUGAUGGUAGACGCCGGGGUG -3′ (2′-aminopyrimidine nucleotides are designated with italic letters). Of the 14 ribopurines in this minimal ligand, 10 can be substituted with the corresponding 2′-O-methylpurine nucleotides without a reduction in binding affinity to VPF/VEGF. In fact, the 2′ O-methyl substitution at permissive positions leads to a ∼17-fold improvement in the binding affinity to VPF/VEGF The higher affinity results from the reduction in the dissociation rate constant of the 2′-O-methyl-substituted RNA ligand from the protein compared to the unsubstituted ligand. The 2′-O-methyl-substituted minimal ligand, which folds into a bulged hairpin motif, is also more thermally stable than the unsubstituted ligand. Nuclease resistance of the ligand is further improved by the 2′-O-methyl substitutions and the addition of short phosphorothioate caps to the 3′- and 5′-ends. Conclusions : We have used the SELEX (systematic evolution of ligands by exponential enrichment) process in conjunction with post-SELEX modifications to define a highly nuclease-resistant oligonucleotide that binds to VPF/VEGF with high affinity and specificity.