Search

Summary: The bile sait export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns. Three novel nonsynonymous variations, 361C>A (Gln121Lys), 667C>T (Arg223Cys), and 1460G>T (Arg487Leu), were found as heterozygotes and at 0.004 allele frequencies. These data provide fundamental and useful information for genotyping ABCB11 in the Japanese and probably other Asian populations.

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.

Summary: Thirty­nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included –8166G > A, –8110A > G, –7947G > A, –7789 T > C, –5595G > A, –3803–3783delTCGGGGAGGTGGCAGTGGGCG, –3548G > C, –3414G > A, –1355 T > C, –34C > G, IVS1 + 141G > A, IVS1 + 260C > T, IVS1– 82C > T, 177C > G, IVS3–6C > T, 564C > T, IVS8 + 44 T > C, IVS8 + 90 T > C, IVS8 + 97 T > C, IVS8 + 131C > T, IVS8 + 169G > A, 933 T > C, 954C > T, IVS11–52G > C, IVS11–46G > A, 1288G > A, 1641C > G, 1703_1704delGT, 1812C > T, and 1861C > T. The frequencies were 0.051 for IVS8 + 169G > A, 0.012 for –7947G > A, 0.006 for IVS1 + 141G > A and 1703_1704delGT, 0.004 for –8166G > A, –8110A > G, –3548G > C, –1355 T > C, –34C > G, IVS8 + 44 T > C, and 1812C > T, and 0.002 for the other 19 variations. Among them, 177C > G and 1288G > A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences. MAFs of 79A>C (Lys27Gln) were 0.153 in Koreans and 0.327 in Caucasian-Americans, 0.204 in Japanese, 0.155 in Chinese-Americans and 0.087 in African-Americans. MAFs of 208G>A (Ala70Thr) were 0.005 in Koreans and 0.022 in Japanese and the minor allele was not detected in Chinese-Americans, Caucasian-Americans or African-Americans. Thus possibly, MAF of 208G>A in Japanese is likely to be somewhat higher than in Koreans and Chinese-Americans. These data would provide fundamental and useful information for pharmacogenetic studies on cytidine deaminase-catalyzing drugs.

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.