Search

We describe a sensitive immunological procedure for the detection of specific proteins in total cell extracts and for the comparison of antigenically related polypeptides. Proteins are fractionated in polyacrylamide gels and transferred electrophoretically to diazophenylthioether paper, to which they bind covalently. Specific proteins are identified by incubation with specific antibody and ⊃125 -labeled protein A from Staphylococcus aureus, followed by autoradiography. High-resolution separation of proteins prior to transfer is achieved by polyacrylamide gradient gel electrophoresis in the presence of sodium dodecyl sulfate or by nonequilibrium pH gradient electrophoresis, followed by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. Further information can be obtained by limited enzymatic proteolysis of the proteins in the gel following polyacryllamide gel electrophoresis in the presence of sodium dodecyl sulfate and analysis of the cleavage products by gel electrophoresis at right angles to the first gel. We show the application of this technique to the detection and comparison in extracts from infected cells of proteins related immunologically to the simian virus 40 capsid proteins VP1 and VP3. [ABSTRACT FROM AUTHOR]

Introduces the research papers to be published in the "European Journal of Biochemistry," succeeding the May 15, 1985. "Primer-independent abortive initiation by wheat-germ RNA polymerase B," by H. Mosig et al; "Protein structure and gene organization of mouse lactate dehydrogenase-A isozyme," S.S.-L. Li et al; "A model for intracellular complexation between gene-5 protein and bacteriophage fd DNA," by G.D. Bayer et al.

Presents research articles on biochemistry to be published in the "European Journal of Biochemistry." "Secondary and Tertiary Structure Characteristic of Megasphaera elsdenii Flavodoxin in the Reduced State as Determined by Two-Dimensional 1H NMR," by C. P. M. van Mierlo, F. M¨ller, and J. Vervoort; "Presence and Characterization of Glycolipid Sulfotransferase in Human Cancer Serum," by S. Gasa, M. -T. Casl, A. Makita, N. Sakakibara, T. Koyanagi, and T. Atsuta; "Interaction of Hemin With Placental Glutathione Transferase," by A. M. Caccuri; A. Aceto, F. Piemonte, C. di Ilio, N. Rosato, and G. Federici.

Lists articles about biochemistry. "Modulation of the interaction between the two halves of troponin C by the other troponin subunits," by C.-L.A. Wang and J. Gergely; "Sequence determinants of cytosolic N-terminal protein processing," by C. Flinta, B. Persson, H. Jornvall and G. von Heijne; "Effect of benzoate on the metabolism of fructose 2,6-biphosphate in yeast," by J. Francois, E. van Schaftingen and H.-G. Hers; "Isolation and properties of porcine cholesterol acyltransferase," G. Knipping; Others.

The article presents information on various research papers which will be published in the forthcoming issue of the "European Journal of Biochemistry". Some of the papers discusses are "Enzymatic Synthesis of Neolactotetraosylceramide by the N-Acctyllactosamine Synthase of Human Serum". "Rate of Transplantation and Kinetics of Processing of Newly Synthesized Molecules of Two Major Outer-Membrane Proteins, the OmpA and OmpF Proteins of Escherichia Coli," by the researchers I. Crowlesmith and K. Gamon.

The article presents a list of forthcoming research papers including "Kinetic Studies of Proton Transfer in the Microenvironment of a Binding Site," by M. Gutman, D. Huppert and E. Nachliel," "The Substrate Binding Site of Aldehyde Reductase From Pig Liver: Stereochemical Investigations Using NADP-2-Oxodiacid Adducts As Probe," by G. Branlant and "Membranes of Protein Bodies: I. Isolation from Cotyledons of Germinating Cucumber Seeds" by U. A. K. Kara and H. Kindl.

Presents a list of research papers to be published in the upcoming issues of the "European Journal of Biochemistry." "Extraction and Translation of Collagen mRNA From Fetal Calf Skin," by R. Kaufman, A. Belayew, B. Nusgens, and C. M. Lapie&rgrave;e; "Messenger RNA For Ribosomal Proteins in Xenopus laevis Oocytes," by P. Pierandrei-Amaldi and E. Beccari; "Purification and Characterization of Esterase 2B of the House Mouse, Mus musculus," by U. Lexow, A. Ronai, and O. von Deimling.

Lists the titles of papers that will be published in future issues of the "European Journal of Biochemistry." "Regulation of the ontogeny of rat liver metallothionein mRNA by zinc," by G.K. Andrews et al; "Processing of a plant vacuolar protein precursor in vitro," by T. Hattori et al "Structural studies of the putatitve O-specific polysaccharide of Serratia marcescens 09," by D. Oxley and S.G. Wilkinson.

Lists articles about biochemistry. "Impact of altered protein structures on the intracellular traffic of a mutated vasopressin precursor from Brattleboro rats," by H. Schmale et al; "Direct electron transfer of redox proteins at the bare classy carbon electrode," by W.R. Hagen; "Molecular cloning of preproacrosin and analysis of its expression pattern in spermatogenesis," by I.M. Adham; "Reduced temperature does not prevent transport of lysosomal integral membrane proteins from endoplasmic reticulum and through the Golgi system to lysosomes," by P.G. Morales; Others.

Offers information on articles for publication in future issues of the "European Journal of Biochemistry". Synthesis of two proteins in chloroplasts and messenger RNA; Types of acids from Mycobacterium thamnopheos; Use of the inhibition of enzymatic antioxidant systems in order to evaluate their physiological importance.

Presents several articles to be published in the "European Journal of Biochemistry." "Modification of Ribosomal Proteins in Sea Urchin Eggs Following Fertilization," by K. Takeshima and E. Nakano; "A Phosphotyrosyl-Protein Phosphatase Activity Associated With Acid Phosphatase From Human Prostate Gland," by H.-C. Li, J. Chernoff, L. B. Chen and A. Kirschonbaum; "Molecular Characterization of the Gene Coding for Major Outer Membrane Protein OmpA from Enterobacter Aerogenes," by G. Braun and S. T. Cole; "Nidogen: A New, Self-Aggregating Basement Membrane Protein," by R. Timpl, M. Dziadek, S. Fujiwara, H. Nowack and G. Wick; Others.

A new approach of predicting structural classes of protein domain sequences is presented in this paper. Besides the amino acid composition, the composition of several dipeptides, tripeptides, tetrapeptides, pentapeptides and hexapeptides are taken into account based on the stepwise discriminant analysis. The result of jackknife test shows that this new approach can lead to higher predictive sensitivity and specificity for reduced sequence similarity datasets. Considering the dataset PDB40-B constructed by Brenner and colleagues, 75.2% protein domain sequences are correctly assigned in the jackknife test for the four structural classes: all-α, all-β, α/β and α + β, which is improved by 19.4% in jackknife test and 25.5% in resubstitution test, in contrast with the component-coupled algorithm using amino acid composition alone (AAC approach) for the same dataset. In the cross-validation test with dataset PDB40-J constructed by Park and colleagues, more than 80% predictive accuracy is obtained. Furthermore, for the dataset constructed by Chou and Maggiona, the accuracy of 100% and 99.7% can be easily achieved, respectively, in the resubstitution test and in the jackknife test merely taking the composition of dipeptides into account. Therefore, this new method provides an effective tool to extract valuable information from protein sequences, which can be used for the systematic analysis of small or medium size protein sequences. The computer programs used in this paper are available on request. [ABSTRACT FROM AUTHOR]

Protein kinase C (PKC) isoenzymes are involved in diverse cellular functions, including differentiation, growth control, tumor promotion, and cell death. In recent years, evidence has began to emerge suggesting a role for PKC in cell cycle control. A paper published recently, demonstrating a functional link between PKC and cell cycle control in yeast (Marini, N. J., Meldrum, E., Buehrer, B., Hubberstey, A. V., Stone, D. E., Traynor-Kaplan A. & Reed, S. I. (1996) EMBO ,J. 15, 3040—3052), strengthens this data. Thus, the existence of cell-cycle-regulated pathways involving PKC in both yeast and mammals indicate that PKC may be a conserved regulator of cell cycle events that links signal transduction pathways and the cell-cycle machinery. In this paper, we will review current data on the cell cycle components that are targets for PKC regulation. PKC enzymes appear to operate as regulators of the cell cycle at two sites, during GI progression and G2/M transition, In GI, the overall effect of PKC activation is inhibition of the cell cycle at mid to late Gl. This cell cycle inhibition correlates with a blockage in the normal phosphorylation of the tumor suppressor retinoblastoma Rb protein, presumably through an indirect mechanism. The reduced activity of the cyclin-dependent kinase, Cdk2, appears to be the major effect of PKC activation in various cell systems. This may also underlie the inhibition of Rb phosphorylation exhibited by PKC activation. Several mechanisms were described in different studies on the regulation of Cdk2 activity by PKC; reduced Cdk-activating kinase activity, diminished expression of the Cdk2 partners cyclins E or A, and the increased expression of the cyclin-dependent inhibitors, p21WAFIand p27KIPI, which are capable of binding to cyclin/Cdk2 complexes. PKC enzymes were also shown to play a role in G2/M transition. Among the suggested mechanisms is suppression of Cdc2 activity. However, most of the published data strongly implicate PKC in lamin B phosphorylation and nuclear envelope disassembly. [ABSTRACT FROM AUTHOR]

The covalent structures of the four highly homologous Fc-binding regions in protein A, regions D, A, B, and C, have been studied by enzymic fragmentations of previously isolated fragments originating from these regions and subsequent isolation of the generated peptides by ion-exchange chromatography, molecular-sieve chromatography, high-voltage paper electrophoresis and paper chromatography. The complete sequence of region B was elucidated by combining the results of Edman degradations on isolated fragment B peptides with the previously reported N-terminal sequence of the same fragment. Furthermore, Edman degradations of fragment D, A and C peptides differing from the region B sequence provided the structures of subregions not identical to corresponding subregions within region B. Thus, it is possible to propose a highly probable covalent structure for the N-terminal 27 000-molecular-weight portion of protein A responsible for the IgG-Fc-binding activities. However, it was not possible to assign the activities to specific structures within the regions. The sequence data indicate that not only mutual homology between the four regions exists, but also internal homologies within the regions. Furthermore, the data strongly supports the hypothesis of a stepwise gene fusion procedure being involved in the evolution of the protein. [ABSTRACT FROM AUTHOR]

As shown in the preceding paper [Ito, M., Ikegami, Y., Tai, T. & Yamagata, T. (1993) Eur. J. Biochem. 218, 637–643], endoglycoceramidase (EGCase: EC,3,3,1,123) was found to hydrolyze the cell-surface glycosphingolipids (GSLs) of erythrocytes without any damage to other cell membrane components. This paper represent the kinetics of EGCase action toward cell-surface GSLs of erythrocytes. Without activator or detergents, cell-surface GSLs were found to be hydrolyzed by EGCase II very slowly at pH 7.0. The initial reaction velocity of EGCase II under this condition was 0.038 pmol⋅min ¹ ⋅ mU ¹ for horse erythrocyte cell-surface GM3 and 0.032 pmol ⋅ min ¹ ⋅ mU ⋅ for guinea pig erythrocyte cell-surface Gg3Cer. The addition of activator protein (60 μM), which stimulates EGCase II in the absence of detergents, increased the initial reaction velocity of the enzyme 616-fold for cell-surface GM3 and 468-fold for Gg3Cer, while no increased hemolysis was observed with the addition of activator. However, even in the presence of the activator, the cell-surface GSLs were very resistant to hydrolysis by EGCase II compared to GSL vesicles (or micelles) under same conditions. In contrast to the activator, Triton X-100 (0.4%, mass/vol.) not only stimulated the enzyme activity but also solubilized erythrocyte GSLs into detergent micelles, inducing further increment of the enzyme activity but also solubilized erythrocyte GSLs into detergent micelles, inducing further increment of the enzyme reaction velocity. The apparent Km and Vmax values of EGCase II were calculated from the Lineweaver­Burk plot as 47 μM and 35 pmol min ¹ mU ¹ for horse erythrocyte cell-surface GM3 and 44 μM and 27 pmol ⋅ min ¹ ⋅ mU ¹ for guinea pig erythrocyte cell-surface Gg3Cer, at pH 7.0 in the presence of activator at a concentration of 60 μM. [ABSTRACT FROM AUTHOR]

This paper is a further study of ion binding to protein surfaces and builds on the studies of the binding of [Crk(CN)6]3- and [Fe(edta)(H2O)]- previously reported [Williams et al. (1982) FEBS Lett. 15, 293-299; Eley et al. (1982) Eur. J. Biochem. 124, 295-303]. In the present paper the binding of polyaminocarboxylate complexes of gadolinium have been studied. Eight ion-binding sites have been identified on the surface of cytochrome c. These exhibit different binding specificities which, in some cases, are not fully understood. However it is clear that simple outer-sphere interactions are not the sole determining factor for the association of metal ion complexes with proteins. The NMR paramagnetic difference spectrum method has been shown to be good at locating binding sites and revealing qualitative differences in their relative affinities for a range of complex types. However the use of relaxation probes is not a good method for the quantitative determination of binding constants; for this, isostructural shift probes must be sought. [ABSTRACT FROM AUTHOR]

Arginine is a versatile additive to prevent protein aggregation. This paper shows that arginine ethylester (ArgEE) prevents heat-induced inactivation and aggregation of hen egg lysozyme more effectively than arginine or guanidine. The addition of ArgEE decreased the melting temperature of lysozyme. This data could be interpreted in terms of ArgEE binding to unfolded lysozyme, possibly through the ethylated carboxyl group, which leads to effective prevention of intermolecular interaction among aggregation-prone molecules. The data suggest that ArgEE could be used as an additive to prevent inactivation and aggregation of heat-labile proteins. [ABSTRACT FROM AUTHOR]

We have used the circular dichroism and infrared spectra of a specially designed 50 protein database [Oberg, K.A., Ruysschaert, J.M. & Goormaghtigh, E. (2003) Protein Sci. 12, 2015–2031] in order to optimize the accuracy of spectroscopic protein secondary structure determination using multivariate statistical analysis methods. The results demonstrate that when the proteins are carefully selected for the diversity in their structure, no smaller subset of the database contains the necessary information to describe the entire set. One conclusion of the paper is therefore that large protein databases, observing stringent selection criteria, are necessary for the prediction of unknown proteins. A second important conclusion is that only the comparison of analyses run on circular dichroism and infrared spectra independently is able to identify failed solutions in the absence of known structure. Interestingly, it was also found in the course of this study that the amide II band has high information content and could be used alone for secondary structure prediction in place of amide I. [ABSTRACT FROM AUTHOR]

Mitochondrial fatty acid oxidation deficiencies are due to genetic defects in enzymes of fatty acid β-oxidation and transport proteins. Genetic defects have been identified in most of the genes where nearly all types of sequence variations (mutation types) have been associated with disease. In this paper, we will discuss the effects of the various types of sequence variations encountered and review current knowledge regarding the genotype–phenotype relationship, especially in patients with acyl-CoA dehydrogenase deficiencies where sufficient material exists for a meaningful discussion. Because mis-sense sequence variations are prevalent in these diseases, we will discuss the implications of these types of sequence variations on the processing and folding of mis-sense variant proteins. As the prevalent mis-sense variant K304E MCAD protein has been studied intensively, the investigations on biogenesis, stability and kinetic properties for this variant enzyme will be discussed in detail and used as a paradigm for the study of other mis-sense variant proteins. We conclude that the total effect of mis-sense sequence variations may comprise an invariable – sequence variation specific – effect on the catalytic parameters and a conditional effect, which is dependent on cellular, physiological and genetic factors other than the sequence variation itself. [ABSTRACT FROM AUTHOR]

This paper reports the isolation and characterization of the regulatory moiety of the multicomponent enzyme phenol hydroxylase from Acinetobacter radioresistens S13 grown on phenol as the only carbon and energy source. The whole enzyme comprises an oxygenase moiety (PHO), a reductase moiety (PHR) and a regulatory moiety (PHI). PHR contains one FAD and one iron-sulfur cluster, whose function is electron transfer from NADH to the dinuclear iron centre of the oxygenase. PHI is required for catalysis of the conversion of phenol to catechol in vitro , but is not required for PHR activity towards alternative electron acceptors such as cytochrome c and Nitro Blue Tetrazolium. The molecular mass of PHI was determined to be 10 kDa by SDS/PAGE, 8.8 kDa by MALDI-TOF spectrometry and 18 kDa by gel-permeation. This finding suggests that the protein in its native state is a homodimer. The isoelectric point is 4.1. PHI does not contain any redox cofactor and does not bind ANS, a fluorescent probe for hydrophobic sites. The N-terminal sequence is similar to those of the regulatory proteins of phenol hydroxylase from A. calcoaceticus and Pseudomonas CF 600. In the reconstituted system, optimal reaction rate was achieved when the stoichiometry of the components was 2 PHR monomers: 1 PHI dimer: 1 PHO (αβγ) dimer. PHI interacts specifically with PHR, promoting the enhancement of FAD fluorescence emission. This signal is diagnostic of a conformational change of PHR that might result in a better alignment with respect to PHO. [ABSTRACT FROM AUTHOR]

In the accompanying paper [Adams, H., Scotti, P.A., de Cock, H., Luirink, J. & Tommassen, J. (2002) Eur. J. Biochem. 269 , 5564–5571], we showed that the precursor of outer-membrane protein PhoE of Escherichia coli with a Gly to Leu substitution at position -10 in the signal sequence (G-10L) is targeted to the SecYEG translocon via the signal-recognition particle (SRP) route, instead of via the SecB pathway. Here, we studied the fate of the mutant precursor in a prlA4 mutant strain. prlA mutations, located in the secY gene, have been isolated as suppressors that restore the export of precursors with defective signal sequences. Remarkably, the G-10L mutant precursor, which is normally exported in a wild-type strain, accumulated strongly in a prlA4 mutant strain. In vitro cross-linking experiments revealed that the precursor is correctly targeted to the prlA4 mutant translocon. However, translocation across the cytoplasmic membrane was defective, as appeared from proteinase K-accessibility experiments in pulse-labeled cells. Furthermore, the mutant precursor was found to accumulate when expressed in a secY40 mutant, which is defective in the insertion of integral-membrane proteins but not in protein translocation. Together, these data suggest that SecB and SRP substrates are differently processed at the SecYEG translocon. [ABSTRACT FROM AUTHOR]

In this paper we address the problem of extracting features relevant for predicting protein–protein interaction sites from the three-dimensional structures of protein complexes. Our approach is based on information about evolutionary conservation and surface disposition. We implement a neural network based system, which uses a cross validation procedure and allows the correct detection of 73% of the residues involved in protein interactions in a selected database comprising 226 heterodimers. Our analysis confirms that the chemico-physical properties of interacting surfaces are difficult to distinguish from those of the whole protein surface. However neural networks trained with a reduced representation of the interacting patch and sequence profile are sufficient to generalize over the different features of the contact patches and to predict whether a residue in the protein surface is or is not in contact. By using a blind test, we report the prediction of the surface interacting sites of three structural components of the Dnak molecular chaperone system, and find close agreement with previously published experimental results. We propose that the predictor can significantly complement results from structural and functional proteomics. [ABSTRACT FROM AUTHOR]

The D1 protein constitutes one of the reaction center subunits of photosystem II and turns over rapidly due to photooxidative damage. Here, we studied the degradation of a truncated D1 protein. A plasmid with a precise deletion in the reading frame of the psbA gene encoding D1 was introduced into the chloroplast of Chlamydomonas reinhardtii. A homoplasmic mutant containing the desired gene was able to synthesize the truncated form of the polypeptide, but could not accumulate significant levels of it. As a consequence, other central photosystem II subunits did not assemble within the thylakoid membrane. In vivo pulse–chase experiments showed that the abnormal D1 protein is rapidly degraded in the light. Degradation was delayed in the light in the presence of an uncoupler, or when cells were incubated in the dark. Pulse–chase experiments performed in vitro indicate that an ATP and metal-dependent protease is responsible for the breakdown process. The paper describes the first in vivo and in vitro functional test for ATP-dependent degradation of a defect polypeptide in chloroplasts. The possible involvement of proteases similar to those removing abnormal proteins in prokaryotic organisms is discussed on the basis of proteases recently identified in chloroplasts. [ABSTRACT FROM AUTHOR]

Features the new semi-dry electrophoretic transfer system PhastTransfer from Pharmacia LKB Biotechnology AB. Usability of the system; Operational function; Contact information.

This paper presents the first purification of the mitochondrial branched‐chain amino acid aminotransferase (BCATm) from sheep placenta. It is a homodimer with an apparent subunit molecular mass of 41 kDa. The enzyme differs from those of the rat and human as it appears to form at least one intermolecular disulfide bond. The sheep BCATm cDNA (1.4 kb) encodes a mature polypeptide of 366 amino acids with a calculated molecular mass of 41 329 Da and a partial mitochondrial targeting sequence of seven amino acids. The sheep BCATm sequence shares higher identity with other mammalian BCATm isoenzymes (82–85%) than with the cytosolic isoenzymes (60%). By Northern blot analysis, a message of 1.7 kb was detected in sheep placenta and skeletal muscle. Measurements of BCAT activity, mRNA and BCATm protein in sheep placenta and skeletal muscle revealed that BCATm is the sole BCAT isoenzyme expressed in placenta, whereas it contributes 57 and 71% of the BCAT activity in tensor fascia latae and masseter muscles from weaned lambs respectively. Skeletal muscle, the main site of branched‐chain amino acid transamination, exhibits significantly lower BCAT activity in sheep than in rat. Our results suggest that the low BCATm mRNA level probably accounts for the low BCAT activity in sheep skeletal muscle, and that the metabolic scheme for branched‐chain amino acid catabolism is specific to each species. [ABSTRACT FROM AUTHOR]

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that : (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions. [ABSTRACT FROM AUTHOR]

Trypanosoma brucei contains an ATP-dependent phosphofructokinase (PFK), located in its glycosomes, which are peroxisome-like organelles sequestering the majority of its glycolytic enzymes. In this paper, we report the cloning and sequencing of the single-copy gene encoding this enzyme. Its amino-acid sequence is more similar to pyrophosphate (PPi)-dependent PFKs than to other ATP-dependent PFKs. a phylogenetic analysis suggests that the enzyme must have been derived from a PPi-dependent ancestral PFK, which changed its phospho-donor specificity during evolution. The enzyme is no longer capable of using PPi as phospho substrate, nor can it catalyze the reverse reaction as PPi-PFKs generally can. Moreover, the presence of a high pyrophosphatase activity in the cell renders it unlikely that PPi can function as free-energy source in present-day trypanosomes. It remains to be determined which mutations were responsible for the chage in phospho-substrate specificity of the trypanosomatid PFK. As a result of its particular evolutionary hitory, the T. brucei PFK shows many structural differences, even at the active site, when compared with other ATP-dependent PFKs. These differences offer great potential for the structure-based design of trypanocidal drugs. [ABSTRACT FROM AUTHOR]

Degradation of protein antigens by cellular proteases is a crucial step in the initiation of a T-cell-mediated immune response. But still little is known about the enzymes responsible for the processing of antigens, including their specificity. In this paper, we show that the combination of automated N-terminal sequencing with a newly developed method for C-terminal sequencing of peptide pools generated by the aspartic proteases cathepsins D and E is a fast and/easy method to obtain detailed information of the substrate specificity of these endopeptidases. Using a 15-residue synthetic peptide library and a native protein as substrates, we confirm and extend the knowledge about the cleavage motif of cathepsin E where positions P1 and P1′ of the substrate must be occupied exclusively by hydrophobic amino acids with aromatic or aliphatic side chains. However, Val and Ile residues are not allowed m position P1. Position P2" accepts a broad range of amino acids, including charged and polar ones. Additional requirements concerning the substrate positions P3′ and P4′ were also defined by pool sequencing. Furthermore. pool sequencing analysis of melittin digests with the aspartic proteases cathepsin D and E provided evidence that both enzymes share the same cleavage motif, identical to the one derived from the peptide library, and the native protein. Therefore, pool sequencing analysis is a valuable and fast tool to determine the substrate specificity of any endopeptidase. [ABSTRACT FROM AUTHOR]

2-Methoxy-5-(2′,3′,4′-trimethoxy)-2,4,6-cycloheptatrien-1-one (MTC) is a colchicine analogue that lacks the B ring, 2-Methoxy-5-(2′,4′-dimethoxyphenyl)-2,4,6-cycloheptatrien 1 one (MD) is an A-ring analogue of MTC, in which one methoxy group is replaced by a hydrogen atom. This paper describes the kinetic features of MDC binding to tubulin, and compares its behaviour with MTC to analyse the effect of the A-ring modification on the recognition process by tubulin. Binding is accompanied by a strong enhancement of MDC fluorescence and quenching of protein fluorescence. The kinetic and thermodynamic parameters were obtained from fluorescence stopped-flow measurements. The kinetics are described by a single exponential, indicating that this drug does not discriminate between the different tubulin isotypes. The observed pseudo-first-order rate constant of the fluorescence increase upon binding increases in a non-linear way, indicating that this ligand binds with a similar overall mechanism as colchicine and MTC, consisting of a fast initial binding of low affinity followed by a slower isomerisation step leading to full affinity. The K, and k2 values for MDC at 25°C were 540±65 M-1 and 70±6s-1, respectively. From the temperature dependence, a reaction enthalpy change (ΔH1o) of the initial binding of 49–11 kJ/mol-1 and an activation energy for the .second step of 28±9 kJ/mol-1 were calculated. Displacement experiments of bound MIX? by MTC allowed the determination of a rate constant of reverse isomerisation of 0.60±0.07 s" at 25°(? and the activation energy of 81–6 kJ/mol-1. The overall binding constant was (6.3 ± 0.2) × 104M-1 at 25°C. Combination of these results with the "kinetic parameters for association gives a full characterisation of the enthalpy pathway for the binding of MDC. The pathway of MDC is shown to differ considerably from that of MTC binding. Since its structural difference is located in ring A. this result indicates the use of ring A in the first step. The kinetics of the binding of MDC in the presence of some A-ring colchicine analogues (podophyllotoxin, 3′,4′,5′-trimethoxyacetophenone and N-acetylmescaline) and a C-ring analogue (tropolone methyl ether) suggest that the A and C rings are involved in the binding of MDC. [ABSTRACT FROM AUTHOR]

We have previously isolated a form of protein phosphatase-1 (PP1M) from avian smooth muscle myofibrils that is composed of the catalytic subunit of PP1 (PP1C) bound to an M-complex consisting of 110-kDa (M110) and 21-kDa (M21) subunits. The interaction of PP1C with an N-terminal region of the M110 subunit enhances the dephosphorylation of myosin and suppresses the dephosphorylation of other substrates [Alessi, D. R., MacDougall, L. K., Sola, M. M., Ikebe, M. & Cohen, P. (1992) Eur. J. Biochem. 210, 1023–1035; Chen, Y. H., Chen, M. X., Alessi, D. R., Campbell, D. G., Shanahan, C., Cohen, P. & Cohen, P. T. W. (1994) FEBS Lett. 356, 51–56; Johnson, D. F., Moorhead, G., Caudwell, F. B., Cohen, P., Chen, Y. H., Chen, M. X. & Cohen, P. T. W. (1996) Eur. J. Biochem. 239, 317–325]. In this paper, we establish that PP1M accounts for nearly all the myosin phosphatase activity in myofibrils, that the M110 and M21 subunits are present at similar concentrations in the myofibritlar fraction, and that these subunits are entirely bound to PP1. We demonstrate that the M21 subunit does not interact with PP1C, but with the C-terminal 72 residues of the M110 m subunit, a region which is 43 % identical to residues 87–161 of the M21 subunit. A fragment of the M21 subunit, M21-(M1–L146), which lacks the C-terminal leucine zipper, also bound to the M110 subunit, but two other fragments M21-(M1–E110) and M21-(E110–K186) did not. The M110 and M21 subunits were both found to be myosin-binding proteins. The C-terminal 291 residues of the M110 subunit, but not the C-terminal 72 residues, bound to myosin, but the N-terminal fragments M110-(M1—E309) and M110-(M1—S477) did not. Thus, the region of the M110 subunit that stimulates the dephosphorylation of myosin by PP1C is distinct from the region that targets PP1M to myosin. Remarkably, each myosin dimer was capable of binding about 20 tool M21 subunit and many of the M21-binding sites were located in the myosin rod domain. The potential significance of this observation is discussed. [ABSTRACT FROM AUTHOR]

The α2macroglobulin-receptor-associated protein (RAP) binds to the α2macroglobulin receptor/low-density lipoprotein receptor-related protein (α2MR/LRP), a multi-functional cell surface receptor known to bind and internalize several macromolecular ligands. RAP has been shown to inhibit binding of all known α2MR/LRP ligands. Mutational studies have implicated distinct parts of RAP as specifically in- volved in inhibition of binding of a multitude of ligands. In the present paper we provide experimental evidence allowing assignment of elements of triplicate internal sequence similarity in RAP, noted previously [Warshawsky, L., Bu, C. & Schwartz, A. L. (1995) Sites within the 39-kDa protein important for regulating ligand binding to the low-density lipoprotein receptor-related protein, Biochemistry 34, 3404-3415], to three structural domains, 1, 2 and 3, comprising residues 18-112, 113-218 and 219-323 of RAP, respectively. Structural analysis by 1H-NMR spectroscopy shows that domains 1 and 2 as separate domains have similar secondary structures, consisting almost exclusively of α-helices, whereas domain 3 as a separate domain appears only to he marginally stable. Ligand competition titration of recombinant RAP domains 1, 2 and 3 and double domains 1+2 and 2+3 against 125I-RAP and 125I-α2M* (methylamine-activated α22M) for binding to α2MR/LRP demonstrated (a) that functional integrity in single domains is largely preserved, and (b) that important determinants for the inhibition of test ligands reside in the C-terminal regions of domains 1 and 3. [ABSTRACT FROM AUTHOR]

In this paper, a small-angle neutron scattering study of γII-crystallins near their isoelectric point is presented. The experiments were carried out using protein concentrations of 5.7-85.7 mg/ml at temperatures in the range 11-60°C. The experimental data were analyzed using an ellipsoidal model for intraparticle correlations and the mean spherical approximation for interparticle correlations. Our studies revealed that γII-crystallins have a thick hydration layer, which is possibly due to the special arrangement of polar and ionic groups on their surface. The temperature scan shows that, as a result of relatively strong attractive forces, clusters of two, three, or higher oligomers are present below 20°C. Our results suggest that protein clusters, with a distinctive hydration layer, form a protein-rich phase that separates from a protein-lean phase as the temperature is decreased below some threshold value. [ABSTRACT FROM AUTHOR]

This paper reports the biochemical characterization of the flavoprotein L-aspartate oxidase from Escherichia coli. Modification of a previously published procedure allowed overexpression of the holoenzyme in an unproteolysed form. L-Aspartate oxidase is a monomer of 60 kDa containing 1 mol of non-covalently bound FAD/mol protein. A polarographic and two spectrophotometric coupled assays have been set up to monitor the enzymatic activity continuously. L-Aspartate oxidase was subjected to product inhibition since iminoaspartate, which results from the oxidation of L-aspartate, binds to the enzyme with a dissociation constant (Kd) equal to 1.4 μM. The enzyme binds FAD by a simple second-order process with Kd 0.67 μM. Site-directed mutagenesis of the residues E43, G44, S45, F47 and Y48 located in the putative binding site of the isoallossazinic portion of FAD reduces the affinity for the coenzyme. [ABSTRACT FROM AUTHOR]

Amphipathic helical repeals arc considered as the structural units of numerous apolipoproteins and have been described as being responsible for the interaction of apolipoproteins with phospholipids in high-density lipoproteins (HDL). Furthermore. apolipoproteins. and especially apolipoprotein Al (apoAl), are involved in various biological functions of these circulating particles in plasma. Studies with synthetic peptides corresponding to domains of the apoAl sequence have however shown that short 39-residue fragments do not interact strongly enough with phospholipids to generate particles that correctly mimic the physicochemical properties of HDL reconstituted with native apoAl [Vanloo, B., Demoor, L., Boutil- Ion. C.. Lins, L.. Baert, J,, Fruchart, J. C.. Tartar. A. & Rosseneu, M. (1995) Association of synthetic peptide fragments of human apolipoprotein A-I with phospholipids. i. Lipid Res. 36. 1686-1696.1. Here we show that synthetic branched multirneric peptides. often used as carriers for the design of synthetic vaccines (multiple-antigen peptides). can be used to mimic the physicochemical properties of apoAl in HDL. This type of molecule is obtained by using a small core matrix of Lys residues bearing radially branched synthetic peptides as dendritic arms. We compared the lipid-binding capacities and the structural properties of a linear peptide corresponding to residues 145--183 of apoAl [apoAl-(145-183)-peptide) with those of two multimeric peptides consisting respectively of three [trimeric apoAl-(145-183)j and four copies [tetrameric apoAl-( 145- 183)] of the selected sequence. branched on a covalent core matrix. This paper provides evidence for the increased abilities of the multimeric peptides to associate with phospholipids compared with the short linear peptides. Moreover, the trimeric apoAl-(145 - 183) peptide was most efficient in mimicking the physicochemical and structural properties of native apoAl in reconstituted HDL. As tools adequate to unravel the structure/function relationship of separate apolipoprotein domains are still missing. these multirneric peptides might constitute an alternative approach to linear peptides which are poor mimetics and to protein mutants which are difficult to produce and only provide information about the total sequence. [ABSTRACT FROM AUTHOR]

Monoamine oxidases (MAO) A and B show a high degree of amino acid similarity. Apart from the NH2-terminus, which contains an ADP-binding consensus sequence, little is known about their structural features or the sequences involved in the binding of substrates. In the present paper, we have studied the structure/function relationships of MAOs by constructing 18 different chimeric forms of MAO, engineered by moving progressively the junction between the NH2-terminus of one MAO form with the COOH-terminus of its isoenzyme. After transient expression in HEK-293 cells, the properties of these chimeric enzymes were investigated using both selective and nonselective substrates and inhibitors. Whereas exchange of the ADP-binding sequence did not modify the catalytic properties of either MAO isoforms, chimeras with increasing length of the NH2-terminus of MAO-A (up to residue 256) showed a marked decrease in affinity towards the MAO-B substrate phenylethylamine and the inhibitor N-(2-aminoethyl)-5-chloro-2-pyridine carboxamide · HCI (lazabemide) when compared to wild-type MAO-B. No major changes were observed in the kcat, values of these chimeras. From the data obtained, two sequences, i.e. 62–103 and 146–220, appeared of particular importance in constituting the binding site of MAO-B. On the other hand, the catalytic properties and specificity of MAO-A appeared to be relatively insensitive to substitution of both the NH2-- (up to position 112) and COOH-termini (from residue 395) of MAO-A with the corresponding MAO-B sequences. However, further modification of the central 283-residue sequence of MAO-A did not appear compatible with enzymic activity. None of the engineered chimeras showed a shift in specificity from one isoform to the other. [ABSTRACT FROM AUTHOR]

The histone variants and high-mobility-group (HMG) proteins of a transcribing fraction of chromatin, described in the preceeding paper of this journal, have been analysed qualitatively and quantitatively by a combination of one-dimensional and two-dimensional gel electrophoresis. The stoichiometry of the four core histones (all variants included) in this fraction is equimolar and is not detectably different from that in the nontranscribing fraction or in total chromatin. The molar ratio of histone Hi to the core histones is markedly lower, by approximately 72%, than that in the nontranscribing fraction. A minor histone variant identified as Ml (an H2A variant) is detected only in the transcribing fraction, while variant 113.1 is found only in the non- transcribing fraction. Proteins A24, HMG1 and HMG2 are essentially absent from the transcribing fraction; HMG14 is found uniquely in this fraction, while HMG17 occurs at a relatively lower level. [ABSTRACT FROM AUTHOR]

Blood-group-specific glycoproteins obtained from ovarian cyst fluids of A1 and A2 persons were degraded with NaOH/NaBH4. The oligosaccharides released were de-N-acetylated with Ba(OH)2 and then hydrolysed with dilute H2SO4. The products were fractionated on columns of ion-exchange resin and the components isolated were re-N-acetylated with 14C-labelled acetic anhydride; further purification was effected by paper chromatography. The following trisaccharides: type 1, GaINAc(αl - 3)Gal(βl - 3)G1cNAc; type 2, Ga1NAc(αl - 3)- Gal(βl -4)GlcNAc; type 3 (reduced), GalNAc(αl - 3)Gal(β1 - 3)GalNAcOH (where Gal is galactose, GalNAc is N-acetylgalactosamine, G1cNAc is N-acetylglucosamine and Ga1NAcOH is N-acetylgalactosaminitol) were isolated and characterised from both the A1 and A2 materials. The type 3 (reduced) trisaccharide has not previously been obtained from human glycoproteins. Chromatographic evidence indicated that the three trie saccharide structures were also present in other A1, A2, A1B and A2B ovarian cyst glycoproteins and in A1 and A2 salivary glycoproteins. These findings are not indicative of structural differences between the A determinants of A1 and A2 glycoproteins. [ABSTRACT FROM AUTHOR]

The brain specific S-100 protein is a mixture of two components S-100a and S-100 b with a subunit composition αβ or β2 respectively. The amino acid sequence of the β subunit has been previously determined. This paper presents the sequence of the α subunit in the S-100a protein. The α subunit consists of 93 amino-acid residues and has a relative molecular mass of 10400. The sequence shows extensive homology (58 %) with that of the β-subunit and shares an apparent calcium binding site in the C-terminal half of the molecule, suggesting a close evolutionary relationship between these subunits. [ABSTRACT FROM AUTHOR]

After CNBr cleavage of p-hydroxybenzoate hydroxylase from Pseudornonas fluorescens, five peptides and free homoserine were isolated (see preceding paper in this journal). The amino acid sequences of the three smallest peptides, viz. CB3, CB4 and CB5, were determined by automated Edman degradation and analysis of enzymatic subdigests. These peptides form a continuous stretch of 110 residues from the N terminus: [This equation can not be represent in ASCII.TXT]. [ABSTRACT FROM AUTHOR]

This paper considers how apolipoprotein CII from human plasma lipoproteins and T1 and T2 proteins from egg yolk Iipoproteins stimulate the activity oflipoprotein lipase. These activator proteins stabilized the enzyme much more effectively than a thousandfold higher concentration of albumin did, indicating a direct interaction with the enzyme. The effects of the activators were seen also at 1 M NaCl. Thus, forces other than electrostatic are implicated. Centrifugation experiments showed that 125I-labeled lipase bound equally well to the emulsion droplets in the absence of activator protein as in its presence. This was true even under conditions when the activator caused a severalfold increase in the rate of hydrolysis. Thus, the activator makes enzyme at the interface more effective in hydrolysis. By optimizing the conditions it was possible to obtain almost as high rates of triglyceride hydrolysis in the absence as in the presence of activator. Thus, the main effect of the activator protein is probably not on a rate-limiting chemical step. Under most conditions, the rate of hydrolysis was much below optimal and activator increased it. This was always the case with phosphatidyl-choline/triglyceride emulsions, where the activator enhanced hydrolysis of both lipids. Other experiments showed that the activator enhanced triglyceride hydrolysis in the absence of phospholipids and phospholipid hydrolysis in the absence of triglycerides. It is suggested that interaction with activator orientates the enzyme and/or the lipid substrate for effective hydrolysis at the surface of lipoproteins/model substrates. [ABSTRACT FROM AUTHOR]

We have developed a semi-empirical method to determine the subunit molecular weight of a protein. The method is a minor modification of the Edman degradation and is based on a simple chemical procedure to modify specifically the N-terminal NH2 group. Initially, all NH2 groups, including the ε-NH2 groups of lysine residues and the N-terminal α-NH2 group, are reacted with phenylisothiocyanate and the protein derivative is subjected to one step of the Edman degradation. The newly exposed N terminus is then reacted with radioactively labelled phenylisothiocyanate. A value for the subunit molecular weight can be obtained from an analysis of the incorporated radioactivity and the amount of the protein in the sample. The molecular weight of five different proteins have been determined by this method. Our method is particularly useful for proteins containing lipid or sugar components and also for relatively small peptides. The procedure described in this paper for the specific modification of the N terminus has been found to be a powerful tool for protein sequencing. [ABSTRACT FROM AUTHOR]

The DNA-binding protein HU from Escherichia coil is a heterodimer constituted of two poly- peptide chains termed HU-1 and HU-2, of 90 residues each. Their primary structures were established from structural data obtained from tryptic peptides of each monomer in addition to the structural data provided by the automated Edman degradation of the dimer and by peptides derived from cleavage of the dimer with trypsin, chymotrypsin, V8 staphylococcal protease and dilute acid. The results presented in this paper confirm the amino-terminal and carboxy-terminal sequences of the dimer HU reported previously [Laine et al. (1978) FEBS Lett. 89, 116–120]. The amino acid sequences of proteins HU-1 and HU-2 are identical to those of proteins NS-1 and NS-2 respectively, determined independently by Mende et al. [FEBS Lett. (1978) 96, 395–398]. The amino acid sequences of proteins HU-1 and HU-2 are closely related but differ by 28 residues. These proteins are characterized by their high content of hydrophobic residues represented mostly by alanine. In both proteins, half of the basic residues are scattered along the polypeptide chain and the remainder is found within two short sequences located in the carboxy-terminal part of the molecule. No sequence homology could be established between the proteins HU-1 and HU-2 and any one of the five histones from different eukaryotes. [ABSTRACT FROM AUTHOR]

The methylation of HeLa cell ribosomal proteins has been studied by paper electrophoresis separation of the peptides produced after trypsin digestion of individual ribosomal proteins. Methylation in vivo was detected by 3H labeling of peptides from cells that had been incubated with a mixture of [methyl-3H]methionine plus [35S]methionine, the incorporation of the 3H-labeled amino acid methionine being corrected by the 35S uptake. Each methylated peptide thus represented at least one methylation site (one or more methylated amino acids and their adjacent amino acid sequence). Eleven ribosomal proteins were found to be methylated. As many as five methylation sites were present in one ribosomal protein. In several ribosomal proteins some sites were methylated when ribosome synthesis was suppressed with low levels of actinomycin D, while other sites were not. Therefore, some of the sites in a given protein were apparently methylated in mature ribosomes, while other sites were methylated during ribosome processing. The methyl-group-specific labeling of some sites, but not others, was suppressed by cycloheximide, thus suggesting that the methylation of some sites was dependent on protein synthesis. A cell-free system from cultured HeLa cells is described, which reproduces the methylation pattern of ribosomal proteins in vivo in two ways: methylation was observed both in vivo and in vitro (a) in the same ribosomal proteins; and (b) in the same methylation sites of a given ribosomal protein. In addition, our data in vitro suggest that the methylation of some human ribosomal protein sites may involve a methyl donor other than S-adenosylmethionine. [ABSTRACT FROM AUTHOR]

A neurodepressing hormone has been isolated and purified to homogeneity from aqueous extracts of 2000 eyestalks of the Mexican crayfish Procambarus bouvieri (Ortmann). Purification was achieved by gel filtration on Sephadex G-25 and G-15, and preparative paper electrophoresis at four pH values (1.8, 3.6, 6.0 and 10.0). The recovery of hormone activity was 85% and the specific activity was 4.0 × 104 limes that of the starting material. The hormone is a thermostable peptide of approximately 1200 molecular weight and composed of neutral amino acids. No N-terminal group could be found. From its electrophoretic behavior it is concluded that the C-terminal group is also blocked. [ABSTRACT FROM AUTHOR]

Glycophorin can be incorporated in lipid vesicles without the use of detergents [MacDonald, R. J. and MacDonald, R. C. (1975) J. Biol. Chem. 250, 9206–9214]. In this paper it has been shown that the protein spans the lipid bilayer in these vesicles. In addition it has been shown that the protein is orientated in an asymmetric way with 75–80% of its sugar residues directed to the outside of the vesicles. Freeze-fracturing electron microscopy suggests that the protein is present in a slightly ag- gregated form. Sonication of these recombinants leads to the formation of small glycophorin-containing vesicles, in which almost all sugar residues are directed to the outside. [ABSTRACT FROM AUTHOR]

A parvalbumin-like protein was purified to homogeneity from chicken leg muscle. 40 mg of protein was isolated from 1 kg muscle which is 20% of the amount obtained for parvalbumin isolated from rabbit muscle by a similar procedure. The protein contained 1-2 residues of tyrosine and 1 residue of tryptophan, three arginine residues and a rather small number (4-5) of phenylalanine residues. The differences in the aromatic amino acid content account for the less distinct vibronic structure in the ultraviolet region below 275 nm compared to most other parvalbumins. The protein contained <0.04 residue of γ-carboxyglutamic acid per molecule. However, the molecular weight of 12 000, high content of glutamic acid and aspartic acid, the low content of proline and histidine, and the presence of two calcium atoms per molecule were properties common to parvalbumins. Immunprecipitation experiments in agar using anti-chicken parvalbumin-like protein indicated that an immunologically indistinguishable form of this protein is present in heart, white and red back muscles, breast, stomach, brain, pancreas, small intestine and kidney, but not in spleen, liver and blood. The distribution is therefore as ubiquitous as G-actin or β-actinin. Parvalbumin-like protein was found to accumulate in differentiating primary muscle cell cultures after 120 h. This approximates to the time on which myosin and actin start to accumulate, proteins necessary for myofibril assembly. Experiments to investigate the localization of parvalbumin-like protein, using the indirect immunofluorescence technique showed regular cross-striation patterns within the I band of isolated myofibrils. The results suggest that parvalbumin-like protein may interact with one or more of the protein components of the thin filament thus being involved in the contractile process. This component could be β-actinin which copurified with parvalbumin-like protein through the DEAE-cellulose step (see following paper). [ABSTRACT FROM AUTHOR]

In an accompanying paper we describe a method to purify from very low density lipoproteins of egg yolk, two protein fractions (T1 and T2) with cofactor activity for lipoprotein lipases. When added to media containing (bovine milk) lipoprotein lipase and Intralipid (a lecithin-stabilized emulsion of soy bean triacylglycerols) they caused an immediate, several-fold increase in the rate of lipolysis. It has been considered characteristic for lipoprotein lipases that their activity is strongly suppressed by high concentrations of NaCl. Such inhibition was seen in assay systems with whole serum, lipoproteins, or crude fractions of egg apoproteins as source of cofactor activity. In contrast NaCl caused little or no inhibition in assay systems with no cofactor source added or with T1 or T2 proteins as cofactors, indicating that salt inhibition is not exerted directly on the active site of the enzyme or on its ability to interact productively with cofactor proteins. Addition of some of the other egg apoproteins changed the response to salt of activity stimulated by T1 and T2 proteins so that it became similar to that seen in assay systems with serum or other crude sources of cofactor activity. Thus, these other proteins could inhibit the enzyme activity and this inhibition was strongly potentiated by increasing the salt concentration of the medium. Inhibition at high salt concentration was seen also with hemoglobin and with myoglobin, suggesting that it is a rather nonspecific effect. It occurred immediately on addition of the inhibitory proteins to the medium, it was reversible and was relieved in a competitive manner by increased amounts of lipid substrate or of cofactor proteins. [ABSTRACT FROM AUTHOR]

This paper describes three types of experiments which indicate that the binding sites for elongation factor 1 (EF-1) and elongation factor 2 (EF-2) on ascites cell ribosomes are not identical and perhaps not even overlapping. The experimental evidence presented includes direct competitive binding of labeled elongation factors to ribosomes as well as the influence of pokeweed antiviral protein and Escherichia coli anti-L7/L12 proteins on the binding and function of the two factors. It is further shown that EF-1β from Artemia salina does not function in displacing EF-1 from mouse ascites tumor cell ribosomes. These results also support our recently proposed model that EF-1 remains bound to the ribosome during the peptide chain elongation cycle. [ABSTRACT FROM AUTHOR]

An enzyme is here described in rat liver cytoplasmic extracts which hydrolyzes dinucleoside triphosphates. Compounds of this kind are present in Artemia salina and Daphnia magna extracts and capping the 5′ end of RNAs of diverse origin and nature. Diadenosine, diguanosine and diuridine triphosphates were substrates of the reaction with similar V and Km values (7, 2 and 25 μM respectively). The products of the reaction were the corresponding nucleoside di and monophosphates. Dixanthosine triphosphate was the unique dinucleoside triphosphate tested which was not substrate of the enzyme. None of the following compounds were substrates of the reaction: dinucleoside tetraphosphates (diadenosine, and diguanosine tetraphosphates), dinucleoside diphosphates (diadenosine and diguanosine diphosphates, NAD+, NADP+), nucleoside 5′-phosphates (AMP, ADP, ATP, p4A), bis-p-nitrophenyl phosphate and glucose 6-phosphate. The enzyme requires Mg2+ or Mn2+, is maximally active at a pH value of approximately 7.5, and has a molecular weight of 29 800 as estimated by filtration on Sephadex G-75. AMP, ADP and ATP were competitive inhibitors of the reaction with Ki values in the 100 μM range. Based on its substrate specificity the name of dinucleosidetriphosphatase or dinucleoside-triphosphate nucleotidehydrolase has been adopted for the enzyme through this paper. This enzyme is different from dinucleosidetetraphosphatase (EC 3.6.1.17) and from other enzymes recently described which liberate m7pG or m7GDP from the dinucleoside triphosphate caps of certain RNAs. [ABSTRACT FROM AUTHOR]

Hydrolysis of the Bordetella pertussis endotoxin, extracted from both ‘hase I’ and ‘hase IV’ bacteria, with 4 M HCl for 1 h at 100 °C, released the disaccharide named in the title; it was isolated by paper electrophoresis or by ion-exchange chromatography in about 1% yield (w/w). The structure of the heptose could be rigorously established by chemical degradation; the facts that the glucosaminidic linkage was hydrolysed by an enzyme preparation containing both, α and β-N-acetylglucosaminidase activities, whereas it was resistant to cleavage by pure β-N-acetyl- glucosaminidase strongly support the assumption that the disaccharide contains an α-D-glucosaminide linkage. [ABSTRACT FROM AUTHOR]