3,251 results
Search Results
2. When figures and data contradict text: MiR346 is apparently reduced in breast cancer tissue, contrary to claims by a paper's author.
- Author
-
Lahiri DK, Maloney B, and Sambamurti K
- Subjects
- Breast Neoplasms pathology, Cell Proliferation genetics, Female, Gene Expression Regulation, Neoplastic, Humans, MicroRNAs genetics, Neoplasm Invasiveness genetics, Breast Neoplasms genetics, MicroRNAs biosynthesis
- Abstract
A recent article in Gene highlighted potential function of miR-346 in human breast cancer (Yang et al., 2017). We request an explanation or correction of the report. In its current state, the text will certainly create confusion in the field and lead to incorrect assumptions. The authors made several critical errors. The abstract stated "we found that the expression of miR-346 was higher in breast cancer tissues than in their paired corresponding non-cancerous tissues" and the main text and legend for Fig. 1A stated "miR-346 expression was significantly higher in breast cancer tissues than in their paired corresponding non-cancerous tissues (Fig. 1A, Yang et al., 2017)" and "miR-346 was upregulated in breast cancer tissues and cell lines. (A)", respectively. It was also stated that "SRCIN1 expression levels were significantly down-regulated in breast cancer compared to the adjacent normal tissues (Fig. 5B, Yang et al., 2017)". The problem with these statements is that they contradict the actual data presented in the paper! This misrepresentation of the effects of miR-346 in breast cancer could prove harmful by sidetracking future research. Further, clinical trials may be incorrectly directed towards lowering miR-346 without a complete and fair assessment of the internal contradictions in the data. Inaccurately-presented data impede progress of biomedical research, deplete scientific resources and compromise public trust., (Copyright © 2017 Elsevier B.V. All rights reserved.)
- Published
- 2017
- Full Text
- View/download PDF
3. A novel rapid hybridization technique: paper chromatography hybridization assay (PACHA).
- Author
-
Reinhartz A, Alajem S, Samson A, and Herzberg M
- Subjects
- Base Sequence, Cells, Cultured, DNA, Viral analysis, Humans, Kinetics, Molecular Sequence Data, Papillomaviridae isolation & purification, Polymerase Chain Reaction, Tumor Cells, Cultured, Chromatography, Paper methods, DNA analysis, Nucleic Acid Hybridization methods
- Abstract
A new DNA hybridization technique, based on chromatographic migration of DNA on a nitrocellulose strip passing through an immobilized probe area, is described. The new paper chromatography hybridization assay (PACHA) is faster and simpler to use than the conventional dot hybridization assay. In this assay, an aliquot of biotinylated, PCR-amplified target DNA is applied to one end of a nitrocellulose strip. The DNA migrates to the opposite end of the strip by capillary forces and hybridizes to a specific DNA probe immobilized in a reaction zone (RZ), located in the middle of the strip. Unhybridized DNA migrates away from the RZ. The biotinylated hybrid is visualized by a color reaction employing a streptavidin-alkaline phosphatase (SA-AP) conjugate and a specific chromogenic substrate. The new PACHA technique allows for detection of as little as 1-5 pg of specific human papilloma virus 16 (HPV16) DNA in 25 min of hybridization. In this system, the hybridization efficiency is controlled by the flow velocity of the hybridization solution (HS) and by the volume of the amplified labeled DNA migrating across the immobilized probe. Glycerol (30%) or polyvinyl pyrrolidone (PVP) (1%) reduces the flow rate by a factor of 2.5-3 and increases the sensitivity of the assay by a factor of 5.2 for glycerol and 2.6 for PVP. This novel method ensures efficient hybridization to multiple probes and appears to be superior to currently available solid-phase hybridization techniques.
- Published
- 1993
- Full Text
- View/download PDF
4. A novel rapid hybridization technique: paper chromatography hybridization assay (PACHA)
- Author
-
Aline Samson, Avraham Reinhartz, Max Herzberg, and Sara Alajem
- Subjects
Chromatography, Paper ,Molecular Sequence Data ,Biology ,Polymerase Chain Reaction ,law.invention ,chemistry.chemical_compound ,law ,Tumor Cells, Cultured ,Genetics ,Humans ,Papillomaviridae ,Cells, Cultured ,Polymerase chain reaction ,Base Sequence ,Chromogenic ,Hybridization probe ,DNA–DNA hybridization ,Nucleic Acid Hybridization ,DNA ,General Medicine ,Molecular biology ,Kinetics ,Paper chromatography ,chemistry ,Biotinylation ,DNA, Viral ,Nitrocellulose - Abstract
A new DNA hybridization technique, based on chromatographic migration of DNA on a nitrocellulose strip passing through an immobilized probe area, is described. The new paper chromatography hybridization assay (PACHA) is faster and simpler to use than the conventional dot hybridization assay. In this assay, an aliquot of biotinylated, PCR-amplified target DNA is applied to one end of a nitrocellulose strip. The DNA migrates to the opposite end of the strip by capillary forces and hybridizes to a specific DNA probe immobilized in a reaction zone (RZ), located in the middle of the strip. Unhybridized DNA migrates away from the RZ. The biotinylated hybrid is visualized by a color reaction employing a streptavidin-alkaline phosphatase (SA-AP) conjugate and a specific chromogenic substrate. The new PACHA technique allows for detection of as little as 1-5 pg of specific human papilloma virus 16 (HPV16) DNA in 25 min of hybridization. In this system, the hybridization efficiency is controlled by the flow velocity of the hybridization solution (HS) and by the volume of the amplified labeled DNA migrating across the immobilized probe. Glycerol (30%) or polyvinyl pyrrolidone (PVP) (1%) reduces the flow rate by a factor of 2.5-3 and increases the sensitivity of the assay by a factor of 5.2 for glycerol and 2.6 for PVP. This novel method ensures efficient hybridization to multiple probes and appears to be superior to currently available solid-phase hybridization techniques.
- Published
- 1993
5. When figures and data contradict text: MiR346 is apparently reduced in breast cancer tissue, contrary to claims by a paper's author
- Author
-
Bryan Maloney, Kumar Sambamurti, and Debomoy K. Lahiri
- Subjects
0301 basic medicine ,Normal tissue ,Cancer ,Breast Neoplasms ,General Medicine ,Biology ,medicine.disease ,Bioinformatics ,Gene Expression Regulation, Neoplastic ,MicroRNAs ,03 medical and health sciences ,030104 developmental biology ,Breast cancer ,Expression (architecture) ,Misrepresentation ,Genetics ,medicine ,Humans ,Female ,Neoplasm Invasiveness ,medicine.symptom ,Social psychology ,Human breast ,Cell Proliferation ,Confusion - Abstract
A recent article in Gene highlighted potential function of miR-346 in human breast cancer (Yang et al., 2017). We request an explanation or correction of the report. In its current state, the text will certainly create confusion in the field and lead to incorrect assumptions. The authors made several critical errors. The abstract stated "we found that the expression of miR-346 was higher in breast cancer tissues than in their paired corresponding non-cancerous tissues" and the main text and legend for Fig. 1A stated "miR-346 expression was significantly higher in breast cancer tissues than in their paired corresponding non-cancerous tissues (Fig. 1A, Yang et al., 2017)" and "miR-346 was upregulated in breast cancer tissues and cell lines. (A)", respectively. It was also stated that "SRCIN1 expression levels were significantly down-regulated in breast cancer compared to the adjacent normal tissues (Fig. 5B, Yang et al., 2017)". The problem with these statements is that they contradict the actual data presented in the paper! This misrepresentation of the effects of miR-346 in breast cancer could prove harmful by sidetracking future research. Further, clinical trials may be incorrectly directed towards lowering miR-346 without a complete and fair assessment of the internal contradictions in the data. Inaccurately-presented data impede progress of biomedical research, deplete scientific resources and compromise public trust.
- Published
- 2017
6. Determination of the lysosomal hydrolase activity in blood collected on filter paper, an alternative to screen high risk populations.
- Author
-
Castilhos, Cristina D., Mezzalira, Jamila, Goldim, Mariana P.S., Daitx, Vanessa V., Garcia, Cristina da S., Andrade, Carla V., Breier, Ana C., Cé, Jaqueline, Mello, Alexandre S., and Coelho, Janice C.
- Subjects
- *
ENZYMES , *BLOOD sampling , *ANGIOKERATOMA corporis diffusum , *GLYCOGEN storage disease type II , *MUCOPOLYSACCHARIDOSIS , *FIBROBLASTS , *DIAGNOSIS - Abstract
Abstract: This study aimed to determine the enzymatic activity in dried blood samples collected on filter paper (DBS) for the diagnosis of the following diseases: Fabry, Pompe, Mucopolysaccharidosis type I (MPS I) and Mucopolysaccharosis type VI (MPS VI). DBS was used for high risk patientscreening, according to clinical suspicion. Plasma, leukocytes and cultured fibroblasts were used to confirm the diagnosis when necessary. Among the 529 DBS samples sent to the laboratory, 164 had abnormal results. Confirmatory materials of 73 individuals were rerouted. The frequency of diagnosis for lysosomal storage disorders was 5.9%. DBS is an alternative screening technique used in high risk populations, which should lead to earlier diagnosis for lysosomal storage disorders (LSDs), help patients get treatment sooner and improve the outcome of the disease. [Copyright &y& Elsevier]
- Published
- 2014
- Full Text
- View/download PDF
7. Two ras genes in Dictyostelium minutum show high sequence homology, but different developmental regulation from Dictyostelium discoideum rasD and rasG genes1The sequence reported in this paper has been deposited in the GenBank data base (accession No. X89037).1
- Author
-
Pauline Schaap, Rolf Kooistra, and Saskia van Es
- Subjects
Genetics ,Regulation of gene expression ,Fungal protein ,biology ,Sequence analysis ,Transcription (biology) ,General Medicine ,biology.organism_classification ,Gene ,Dictyostelium ,Dictyostelium discoideum ,Homology (biology) - Abstract
The social amoeba Dictyostelium discoideum expresses five ras genes at different stages of development. One of them, DdrasD is expressed during postaggregative development and transcription is induced by extracellular cAMP. A homologue of DdrasD, the DdrasG gene, is expressed exclusively during vegetative growth. We cloned two ras homologues Dmras1 and Dmras2 from the primitive species D. minutum, which show high homology to DdrasD and DdrasG and less homology to the other Ddras genes. In contrast to the DdrasD and DdrasG genes, both the Dmras1 and Dmras2 genes are expressed during the entire course of development. The expression levels are low during growth, increase at the onset of starvation and do not decrease until fruiting bodies have formed. Expression of neither Dmras1 or Dmras2 is regulated by cAMP. So even though the high degree of homology between the ras genes of different species suggests conservation of function, this function is apparently not associated with a specific developmental stage.
- Published
- 1997
8. Efficient transfer of highly resolved small DNA fragments from polyacrylamide gels to DBM paper.
- Author
-
Levy A, Frei E, and Noll M
- Subjects
- Electrophoresis, Polyacrylamide Gel, Methods, Methylcellulose analogs & derivatives, Molecular Weight, Nucleic Acid Denaturation, Paper, DNA, Nucleic Acid Hybridization
- Abstract
A procedure is described that combines high resolution of small DNA molecules (10 to 250 bases) with high transfer efficiency from polyacrylamide gels to diazobenzyloxymethyl (DBM) paper. The DNA fragments are separated electrophoretically in denaturing or nondenaturing step gels. These consist of a short gel of relatively high polyacrylamide concentration (8%) above a long gel of relatively low polyacrylamide concentration (4%). Step gels permit a high resolution of small DNA fragments in gels of sufficiently low polyacrylamide concentration from which efficient transfer to DBM paper is feasible. The combination of the step gel with a short treatment of the gel before transfer ensures a high transfer efficiency. As much as 30% and 50% of the DNA applied to nondenaturing and denaturing gels, respectively, are bound covalently to the DBM-paper. Optimal conditions for hybridization to DBM-linked DNA molecules of 30 to 250 base length are described.
- Published
- 1980
- Full Text
- View/download PDF
9. Genome and RNA: Expression and Functions. Papers presented at a symposium in Puentarenas, Costa Rica, 26 February-2 March 2005.
- Subjects
- Animals, Humans, Gene Expression, Genome, RNA
- Published
- 2006
- Full Text
- View/download PDF
10. Cloning and expression of deoxyribonuclease II 1 [1] The nucleotide sequence of chicken DNase II reported in this paper is available from GenBank, accession number DQ272298. from chicken
- Author
-
MacLea, Kyle S. and Cheng, Hans H.
- Subjects
- *
ENDONUCLEASES , *DEOXYRIBONUCLEASES , *MAMMALS , *ORNITHOLOGY , *CHICKENS , *AMINO acids - Abstract
Abstract: Acid endonucleases of the deoxyribonuclease II (DNase II, EC 3.1.22.1) family have been implicated in the degradation of DNA from apoptotic cell corpses formed in the process of normal mammalian development. Although a predicted DNase II has been detected in the chicken through expressed sequence tag (EST) analysis, to date no homolog of these important enzymes has been identified in vivo in any avian species. Here we report the cloning and expression of DNase II from the chicken, Gallus gallus. When expressed, the 363 amino acid glycoprotein is observed to be approximately 45 kDa in size and to exhibit DNA hydrolytic activity at pH 5 consistent with DNase II in other species. Furthermore, chicken DNase II sequence is compared with an identified partial sequence from the zebra finch, Taeniopygia guttata, as well as the previously identified homologs found in the fowlpox and canarypox viruses and the previously cloned mammalian DNases II. Through analysis of its amino acid sequence, comparative gene structure, and conserved synteny, chicken DNase II appears to represent a member of the DNase IIβ subfamily and the apparent lack of a DNase IIα homolog in the chicken has important evolutionary implications for the study of this gene family. [Copyright &y& Elsevier]
- Published
- 2006
- Full Text
- View/download PDF
11. Papers presented at the workshop "Comparative Developmental Biology". Naples, Italy. April 17-23, 2001.
- Subjects
- Animals, Humans, Embryology methods
- Published
- 2002
12. Mitochondria: evolution, genomics, homeostasis and pathology. Papers presented at an international meeting. May 12-20, 2001. Selva di Fasano (BR Italy).
- Subjects
- Animals, DNA, Mitochondrial genetics, Evolution, Molecular, Homeostasis, Humans, Mitochondria genetics, Mitochondria physiology
- Published
- 2002
13. Papers presented at the Chulabhorn Research Institute Conference on Biotechnology Research and Applications for Sustainable Development (BRASD). Bangkok, Thailand, 7-10 August 1995.
- Subjects
- Animals, Humans, Biotechnology
- Published
- 1996
14. Papers presented at the COGENE Symposium. From the Double Helix to the Human Genome: 40 Years of Molecular Genetics. Paris, France. 21-23 April 1993.
- Subjects
- Animals, Humans, Genome, Human Genome Project, Molecular Biology
- Published
- 1993
- Full Text
- View/download PDF
15. Two ras genes in Dictyostelium minutum show high sequence homology, but different developmental regulation from Dictyostelium discoideum rasD and rasG genes1The sequence reported in this paper has been deposited in the GenBank data base (accession No. X89037).1
- Author
-
van Es, Saskia, primary, Kooistra, Rolf A, additional, and Schaap, Pauline, additional
- Published
- 1997
- Full Text
- View/download PDF
16. Papers presented at the eighth international symposium on biology of actinomycetes
- Published
- 1992
- Full Text
- View/download PDF
17. Efficient transfer of highly resolved small DNA fragments from polyacrylamide gels to DBM paper
- Author
-
Erich Frei, Abraham Levy, and Markus Noll
- Subjects
Paper ,Chromatography ,Resolution (mass spectrometry) ,Polyacrylamide ,dBm ,Nucleic Acid Hybridization ,General Medicine ,DNA ,Biology ,Methylcellulose ,Nucleic Acid Denaturation ,Molecular biology ,Molecular Weight ,Diazobenzyloxymethyl ,chemistry.chemical_compound ,Transfer efficiency ,chemistry ,Covalent bond ,Genetics ,Methods ,Molecule ,Electrophoresis, Polyacrylamide Gel - Abstract
A procedure is described that combines high resolution of small DNA molecules (10 to 250 bases) with high transfer efficiency from polyacrylamide gels to diazobenzyloxymethyl (DBM) paper. The DNA fragments are separated electrophoretically in denaturing or nondenaturing step gels. These consist of a short gel of relatively high polyacrylamide concentration (8%) above a long gel of relatively low polyacrylamide concentration (4%). Step gels permit a high resolution of small DNA fragments in gels of sufficiently low polyacrylamide concentration from which efficient transfer to DBM paper is feasible. The combination of the step gel with a short treatment of the gel before transfer ensures a high transfer efficiency. As much as 30% and 50% of the DNA applied to nondenaturing and denaturing gels, respectively, are bound covalently to the DBM-paper. Optimal conditions for hybridization to DBM-linked DNA molecules of 30 to 250 base length are described.
- Published
- 1980
18. Optimized conditions for solid-phase sequencing: simultaneous chemical cleavage of a series of long DNA fragments immobilized on CCS anion-exchange paper
- Author
-
André Rosenthal, Hans-Dieter Hunger, and Rudolf Jung
- Subjects
Anions ,Hot Temperature ,Chemical Phenomena ,Biology ,Nucleic Acid Denaturation ,law.invention ,Matrix (chemical analysis) ,chemistry.chemical_compound ,law ,Methods ,Genetics ,Chemical decomposition ,Ethanol precipitation ,Chromatography ,Base Sequence ,Ion exchange ,Elution ,Microchemistry ,DNA ,General Medicine ,Chemistry ,Pyrimidines ,Solubility ,chemistry ,Biochemistry ,Recombinant DNA ,Piperidine - Abstract
A solid-phase method for simultaneous sequencing of ten or more long DNA fragments has been developed, using as support the cellulose matrix for chemical sequencing (CCS), anion-exchange paper [Rosenthal et al., Nucl. Acids Res. 13 (1985) 1173-1184]. We optimized several of the seven steps which include: (i) immobilization; (ii) washing; (iii) modification; (iv) washing; (v) sorting of the paper segments; (vi) piperidine reaction and chemical elution, and (vii) lyophilization. During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low. DNA fragments ranging in length from several hundred bp up to 6 kb can be effectively chemically eluted from CCS paper during the piperidine reaction with an efficiency of more than 90%. Because no DNA salt elution and ethanol precipitation steps are necessary the method is rapid, convenient and allows complete automation.
- Published
- 1986
19. Papers presented at the New England Biolabs Workshop on Biological DNA Modification. Gloucester, MA (U.S.A.), 20-23 May 1988.
- Subjects
- Animals, Humans, Methylation, DNA metabolism, DNA Modification Methylases
- Published
- 1988
20. Papers presented at the EMBO/INSERM Workshop on Regulation of Gene Expression by RNA Structure and Anti-messengers. Les Arcs, Savoie (France), 28 February-4 March 1988.
- Subjects
- Animals, Humans, RNA, Complementary, Gene Expression Regulation, Protein Biosynthesis, RNA genetics, RNA, Messenger genetics, Transcription, Genetic
- Published
- 1988
21. Optimized conditions for solid-phase sequencing: simultaneous chemical cleavage of a series of long DNA fragments immobilized on CCS anion-exchange paper.
- Author
-
Rosenthal A, Jung R, and Hunger HD
- Subjects
- Anions, Base Sequence, Chemical Phenomena, Chemistry, Hot Temperature, Methods, Microchemistry methods, Nucleic Acid Denaturation, Pyrimidines, Solubility, DNA analysis
- Abstract
A solid-phase method for simultaneous sequencing of ten or more long DNA fragments has been developed, using as support the cellulose matrix for chemical sequencing (CCS), anion-exchange paper [Rosenthal et al., Nucl. Acids Res. 13 (1985) 1173-1184]. We optimized several of the seven steps which include: (i) immobilization; (ii) washing; (iii) modification; (iv) washing; (v) sorting of the paper segments; (vi) piperidine reaction and chemical elution, and (vii) lyophilization. During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low. DNA fragments ranging in length from several hundred bp up to 6 kb can be effectively chemically eluted from CCS paper during the piperidine reaction with an efficiency of more than 90%. Because no DNA salt elution and ethanol precipitation steps are necessary the method is rapid, convenient and allows complete automation.
- Published
- 1986
- Full Text
- View/download PDF
22. Papers presented at the New England Biolabs Workshop on Biological DNA Modification. Gloucester, MA (U.S.A.), 20-23 May 1988
- Subjects
Animals ,Humans ,DNA ,DNA Modification Methylases ,Methylation - Published
- 1988
23. Papers presented at the EMBO/INSERM Workshop on Regulation of Gene Expression by RNA Structure and Anti-messengers. Les Arcs, Savoie (France), 28 February-4 March 1988
- Subjects
Gene Expression Regulation ,Transcription, Genetic ,Protein Biosynthesis ,Animals ,Humans ,RNA ,RNA, Messenger ,RNA, Complementary - Published
- 1988
24. Recognition of plausible therapeutic agents to combat COVID-19: An omics data based combined approach
- Author
-
Md. Tabassum Hossain Emon, Mohammad Uzzal Hossain, Md. Golam Mosaib, Zeshan Mahmud Chowdhury, Chaman Ara Keya, Arittra Bhattacharjee, Muntahi Mourin, Md. Salimullah, and Keshob Chandra Das
- Subjects
Gene Expression Regulation, Viral ,0301 basic medicine ,Coronavirus M Proteins ,viruses ,In silico ,Computational biology ,Biology ,Genome sequencing ,medicine.disease_cause ,Antiviral Agents ,Genome ,DNA sequencing ,Conserved sequence ,03 medical and health sciences ,0302 clinical medicine ,Chimeric vaccine ,medicine ,Genetics ,Humans ,Gene silencing ,Computer Simulation ,Prospective Studies ,Gene ,Conserved Sequence ,Small molecule drugs ,Coronavirus ,Whole genome sequencing ,Whole Genome Sequencing ,SARS-CoV-2 ,Sequence Analysis, RNA ,Gene Expression Profiling ,fungi ,COVID-19 ,Computational Biology ,General Medicine ,Middle Aged ,RNA-Dependent RNA Polymerase ,COVID-19 Drug Treatment ,siRNAs ,030104 developmental biology ,Drug Design ,030220 oncology & carcinogenesis ,Spike Glycoprotein, Coronavirus ,Female ,Interferons ,Research Paper - Abstract
Highlights • RNA-dependent RNA polymerase (RdRp), Spike (S) and glycoprotein (M) were selected. • Both S and M were chosen for the development of a chimeric vaccine. • siRNAs were also designed for S and M gene silencing. • Six new drug candidates were suggested that might inhibit the activity of RdRp., Coronavirus disease-2019 (COVID-19), caused by Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2), has become an immense threat to global public health. In this study, we performed complete genome sequencing of a SARS-CoV-2 isolate. More than 67,000 genome sequences were further inspected from Global Initiative on Sharing All Influenza Data (GISAID). Using several in silico techniques, we proposed prospective therapeutics against this virus. Through meticulous analysis, several conserved and therapeutically suitable regions of SARS-CoV-2 such as RNA-dependent RNA polymerase (RdRp), Spike (S) and Membrane glycoprotein (M) coding genes were selected. Both S and M were chosen for the development of a chimeric vaccine that can generate memory B and T cells. siRNAs were also designed for S and M gene silencing. Moreover, six new drug candidates were suggested that might inhibit the activity of RdRp. Since SARS-CoV-2 and SARS-CoV-1 have 82.30% sequence identity, a Gene Expression Omnibus (GEO) dataset of Severe Acute Respiratory Syndrome (SARS) patients were analyzed. In this analysis, 13 immunoregulatory genes were found that can be used to develop type 1 interferon (IFN) based therapy. The proposed vaccine, siRNAs, drugs and IFN based analysis of this study will accelerate the development of new treatments.
- Published
- 2021
- Full Text
- View/download PDF
25. The potential involvement of JAK-STAT signaling pathway in the COVID-19 infection assisted by ACE2
- Author
-
Saisai Lu, Lixia Zhu, Jing Luo, Jinxia Fang, Xiaobing Wang, Xiaochun Zhu, Mengjiao Yu, Chenlu Li, and Chengwei Zhu
- Subjects
0301 basic medicine ,Th1 cells, helper T cells 1 ,JAK-STAT signaling pathway ,SARS-Cov, Severe Acute Respiratory Syndrome coronaviruses ,viruses ,ACE2 ,Disease ,Biology ,medicine.disease_cause ,GSVA, gene set variation analysis ,Signal-gene GSEA ,03 medical and health sciences ,0302 clinical medicine ,Immune system ,ACE2, Angiotensin-converting enzyme 2 ,GSEA, Gene Set Enrichment Analysis ,ARDS, Acute respiratory distress syndrome ,Gene expression ,medicine ,Genetics ,Humans ,Respiratory system ,skin and connective tissue diseases ,Receptor ,Lung ,Janus Kinases ,Coronavirus ,COVID-19, Coronavirus disease 2019 ,Immune cell ,fungi ,HAEs, human airway epithelial cells ,COVID-19 ,General Medicine ,Treg cells, Foxp3+ regulatory T ,KNN, k-nearest neighboring ,body regions ,HCoV-NL63, human coronavirus NL63 ,STAT Transcription Factors ,030104 developmental biology ,Case-Control Studies ,030220 oncology & carcinogenesis ,Immunology ,Angiotensin-Converting Enzyme 2 ,Signal transduction ,Transcriptome ,hormones, hormone substitutes, and hormone antagonists ,Research Paper ,Signal Transduction - Abstract
Highlights • COVID-19 keeps substantial nucleotide similarity and shares common receptor (ACE2) with SARS-Cov. • ACE2 was overexpressed in both SARS-Cov and SARS-Cov-2 infection and might regulate immunological pathways in COVID-19. • SARS-Cov-2 infection was accompanied by the activation and inhibition of immunological cells. • JAK-STAT signaling pathway participated in COVID-19 infection subsequent the overactivation of ACE2., COVID-19, a novel identified coronavirus disease due to Severe Acute Respiratory Syndrome coronaviruses 2 (SARS-Cov-2) infection, has posed a significant threat to public health worldwide. It has been reported COVID-19 keeps substantial nucleotide similarity and shares common receptor, Angiotensin-converting enzyme 2 (ACE2) with Severe Acute Respiratory Syndrome coronaviruses (SARS-Cov). Here, we investigated the gene expression of ACE2 and identified associated pathways of SARS-Cov as a useful reference for a deepening understanding of COVID-19. The results indicated the ACE2 was overexpressed in human airway epithelial cells (HAEs), especially at 72 h after SARS-Cov infection. We found ACE2 might regulate immune response through immunological activation-associated pathways in the process of in both SARS-Cov and SARS-Cov-2 infection, where the activation of B cells, macrophages, helper T cells 1 (Th1 cells) and the inhibition of Foxp3 + regulatory T (Treg) cells and CD8 + T cells were found to be prominent. Finally, significant correlation between ACE2 and JAK-STAT signaling pathway was identified which indicate that JAK-STAT signaling pathway might involve in the downstream action of the overactivation of ACE2. These findings are expected to gain a further insight into the action mechanism of COVID-19 infection and provide a promising target for designing effective therapeutic strategies.
- Published
- 2021
- Full Text
- View/download PDF
26. Mutational analysis and assessment of its impact on proteins of SARS-CoV-2 genomes from India
- Author
-
Safdar Ali and Rezwanuzzaman Laskar
- Subjects
0301 basic medicine ,2019-20 coronavirus outbreak ,Coronavirus disease 2019 (COVID-19) ,Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) ,India ,Disease ,Genome, Viral ,Biology ,Mega ,medicine.disease_cause ,Genome ,03 medical and health sciences ,Viral Proteins ,0302 clinical medicine ,Sequence Analysis, Protein ,Genetics ,medicine ,Mutational status ,Humans ,Peptide sequence ,Mutation ,SARS-CoV-2 ,COVID-19 ,General Medicine ,Mutational analysis ,030104 developmental biology ,030220 oncology & carcinogenesis ,Research Paper - Abstract
The ongoing global pandemic of SARS-CoV-2 implies a corresponding accumulation of mutations. Herein the mutational status of 611 genomes from India along with their impact on proteins was ascertained. After excluding gaps and ambiguous sequences, a total of 493 variable sites (152 parsimony informative and 341 singleton) were observed. The most prevalent reference nucleotide was C (209) and substituted one was T (293). NSP3 had the highest incidence of 101 sites followed by S protein (74 sites), NSP12b (43 sites) and ORF3a (31 sites). The average number of mutations per sample for males and females was 2.56 and 2.88 respectively suggesting a higher contribution of mutations from females. Non-uniform geographical distribution of mutations implied by Odisha (30 samples, 109 mutations) and Tamil Nadu (31 samples, 40 mutations) suggests that sequences in some regions are mutating faster than others. There were 281 mutations (198 ‘Neutral’ and 83 ‘Disease’) affecting amino acid sequence. NSP13 has a maximum of 14 ‘Disease’ variants followed by S protein and ORF3a with 13 each. Further, constitution of ‘Disease’ mutations in genomes from asymptomatic people was mere 11% but those from deceased patients was over three folds higher at 38% indicating contribution of these mutations to the pathophysiology of the SARS-CoV-2.
- Published
- 2020
27. HA of H1N1 enhanced the expression of ICAM-1 and IL-6 in HUVECs and pathological injury in the lungs in mice
- Author
-
Gui-Fen Pang, Li-Xin Sun, Lin-Ying Yang, Ming-Zhen Zhao, Xiang Guo, Bo Sun, Xing Zhao, Xiao-Fang Sun, and Qing Zhang
- Subjects
ICAM-1 ,HUVEC, Human Umbilical Vein Endothelial Cells ,Hemagglutinin Glycoproteins, Influenza Virus ,Inflammation ,Lung injury ,Biology ,Real-Time Polymerase Chain Reaction ,ICAM-1, Intercellular Adhesion Molecule 1 ,Virus ,Umbilical vein ,Influenza A Virus, H1N1 Subtype ,Viral entry ,Vascular endothelium ,Human Umbilical Vein Endothelial Cells ,Genetics ,medicine ,Humans ,Hemagglutinin ,Lung ,Cells, Cultured ,IL-6 ,Respiratory tract infections ,Interleukin-6 ,General Medicine ,Intercellular Adhesion Molecule-1 ,HE, Hemagglutinin-Esterase ,medicine.anatomical_structure ,Influenza virus H1N1 ,Immunology ,HEF, Hemagglutinin-Esterase-Fusion ,medicine.symptom ,HA, Hemagglutinin ,Research Paper - Abstract
Objective Both COVID-19 and influenza are viral respiratory tract infections and the epidemics of viral respiratory tract infections remain highly prevalent with lethal consequences in susceptible individuals. Expression of ICAM-1 on vascular endothelium recruits leukocytes which initiates inflammation. IL-6 induces ICAM-1. Both ICAM-1 and IL-6 can be enhanced in influenza virus infection and COVID-19 patients. Besides initiation of virus entry host cells, whether HA alone, instead of whole virus, of influenza has the effects on expression of ICAM-1 and IL-6 in vascular endothelium with injury in the lungs, remains to be demonstrated. Methods RT-qPCR and Western blot as well as histopathologic examination were used to examine mRNA and protein of ICAM-1 and IL-6 as well as pathological injury in the lung tissues, respectively. Results After incubation of the Human Umbilical Vein Endothelial Cells (HUVECs) with HA of H1N1 for 24 h, the mRNA and protein of ICAM-1 and IL-6 in HUVECs were increased in group of 5 μg/ml concentration with statistical significance (p
- Published
- 2021
28. No association between the SARS-CoV-2 variants and mortality rates in the Eastern Mediterranean Region
- Author
-
Samer A. Kharroubi, Saad Omais, and Hassan Zaraket
- Subjects
Male ,EMR, Eastern Mediterranean Region ,Virus transmission ,medicine.disease_cause ,Genome ,ORF, open reading frames ,East Mediterranean Region ,Case fatality rate ,Child ,Whole genome ,Clade ,Coronavirus ,Mediterranean Region ,Mortality rate ,Incidence (epidemiology) ,Variants ,RBD, receptor-binding domain ,General Medicine ,Middle Aged ,Child, Preschool ,NSP, non-structural proteins ,Female ,Sample collection ,SPSS, Statistical Package for the Social Sciences ,Research Paper ,Adult ,S, spike ,Adolescent ,Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) ,E, envelope ,Genome, Viral ,Biology ,WHO, World Health Organization ,Young Adult ,UAE, United Arab Emirates ,M, membrane ,Genetics ,medicine ,Humans ,RdRp, RNA-dependent RNA polymerase ,CFR, case fatality rate ,AUB, American University of Beirut ,SARS-CoV-2 ,Infant, Newborn ,COVID-19 ,Infant ,Eastern mediterranean ,Evolutionary biology ,HCoV, human coronavirus ,Mutation ,hACE2, human angiotensin-converting enzyme 2 ,CNRS-L, National Council for Scientific Research of Lebanon ,N, nucleocapsid ,Demography - Abstract
As the novel coronavirus SARS-CoV-2 continues to spread in all countries, there is a growing interest in monitoring and understanding the impact of emerging strains on virus transmission and disease severity. Here, we analyzed SARS-CoV-2 genomic sequences reported in the Eastern Mediterranean Region (EMR) countries, as of 1 January 2021. The majority (∼75%) of these sequences originated from three out of 22 EMR countries, and 65.8% of all sequences belonged to GISAID clades GR, GH, G and GV. A delay ranging between 30-150 days from sample collection to sequence submission was observed across all countries, limiting the utility of such data in informing public health policies. We identified ten common non-synonymous mutations represented among SARS-CoV-2 in the EMR and several country-specific ones. Two substitutions, spike_D614G and NSP12_P323L, were predominantly concurrent in most countries. While the single incidence of NSP12_P323L was positively correlated with higher case fatality rates in EMR, no such association was established for the double (spike_D614G and NSP12_P323L) concurrent variant across the region. Our study identified critical data gaps in EMR highlighting the importance of enhancing surveillance and sequencing capacities in the region.
- Published
- 2021
29. Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19
- Author
-
Sabrina Ferreira de Jesus, João Batista Mendes, Thallyta Maria Vieira, João Felício Rodrigues Neto, Marcos Flávio Silveira Vasconcelos D’Angelo, Laércio Ives Santos, and André Luiz Sena Guimarães
- Subjects
NS, Number Of Sequence ,Gene Expression Regulation, Viral ,Coronavirus disease 2019 (COVID-19) ,E, Envelope ,Disease ,Computational biology ,Biology ,EOF, End of File ,SARS-CoV-2, Severe Acute Respiratory Syndrome Coronavirus ,MERS-CoV, Middle East Respiratory Syndrome ,N, Nucleocapsid ,Dec, Decimal ,Genetics ,miRNAs, microRNAs ,Humans ,Computer Simulation ,RNA, Antisense ,OI, Oral inhalation ,M, Membrane ,Gene ,Sequence (medicine) ,Antisense RNA ,Regulation of gene expression ,SARS-CoV-2 ,NCBI, National Center for Biotechnology ,RNA ,COVID-19 ,Translation (biology) ,General Medicine ,S, Namely peak ,TGS, Transcriptional gene silencing ,mRNA, messenger RNA ,RNAi, RNA interference ,siRNA, Small interfering RNA ,Therapeutic ,Algorithms ,Research Paper ,ORF1ab, ORF1ab polyprotein - Abstract
COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
- Published
- 2021
30. SARS-CoV-2 variants lacking ORF8 occurred in farmed mink and pangolin
- Author
-
Filipe Pereira
- Subjects
COVID-19 ,coronaviruses ,transmissibility ,nonsense mutations ,0301 basic medicine ,China ,Disease reservoir ,Coronaviruses ,Denmark ,Nonsense mutation ,medicine.disease_cause ,Host Specificity ,Virus ,Viral Proteins ,03 medical and health sciences ,0302 clinical medicine ,biology.animal ,Genetics ,medicine ,Animals ,Humans ,Pangolins ,Mink ,Disease Reservoirs ,Mutation ,biology ,Transmissibility ,Nonsense mutations ,SARS-CoV-2 ,Host (biology) ,Pangolin ,General Medicine ,biology.organism_classification ,Phenotype ,030104 developmental biology ,Codon, Nonsense ,030220 oncology & carcinogenesis ,Spike Glycoprotein, Coronavirus ,Research Paper - Abstract
The SARS-CoV-2 Variant of Concern 202012/01 (VOC) is rapidly spreading worldwide owing to its substantial transmission advantage. The variant has changes in critical sites of the spike protein with potential biological significance. Moreover, VOC-202012/01 has a mutation that inactivates the ORF8 protein, whose absence can change the clinical features of the infection. Why VOC-202012/01 is more transmissible remains unclear, but spike mutations and ORF8 inactivation stand out as candidates for research by their known phenotypic effects. Here I show that variants combining relevant spike mutations and the absence of ORF8 occurred in other SARS-CoV-2 or related viruses circulating in other host species. A truncated ORF8 (Q23stop) occurred in a SARS-CoV-2-related virus from a pangolin seized in China in 2017, also with several mutations in critical spike sites. Strikingly, I found that variants without ORF8 (E19stop) and with the N501T spike mutation circulated in farmed mink and humans from Denmark. Although with differences to VOC-202012/01, the identification of these variants highlights the danger of having reservoirs of SARS-CoV-2 and related viruses where more transmissible variants may occur and spill over to humans.
- Published
- 2021
31. SARS-CoV-2 infections and COVID-19 mortalities strongly correlate with ACE1 I/D genotype
- Author
-
Kunitada Shimotohno, Nao Nishida, Takashi Gojobori, Naoki Yamamoto, Yasuo Ariumi, Rain Yamamoto, Masashi Mizokami, and Georg Bauer
- Subjects
0301 basic medicine ,bp, base pair ,viruses ,0302 clinical medicine ,Genotype ,Pandemic ,I, insertion ,Prevalence ,Ethnicity ,skin and connective tissue diseases ,COVID-19, coronavirus disease 2019 ,education.field_of_study ,Predictive marker ,virus diseases ,General Medicine ,SNP, single nucleotide polymorphism ,030220 oncology & carcinogenesis ,Ang, angiotensin ,gnomAD, genome aggregation database ,ACE1 II genotype ,Research Paper ,HLA, human leukocyte antigens ,ACE, angiotensin-converting enzyme ,Population ,Biology ,Virus ,RAAS, renin angiotensin aldosterone system ,03 medical and health sciences ,Severity of illness ,ACE1 I/D polymorphism ,Genetics ,medicine ,SARS, severe acute respiratory syndrome ,Mortality ,education ,SNV, single nucleotide variants ,ARDS, acute respiratory distress syndrome ,KPGP, Korean Personal Genome Project ,D, deletion ,SARS-CoV-2 ,fungi ,MERS, Middle East respiratory syndrome ,COVID-19 ,medicine.disease ,FTP, File Transfer Protocol ,Genotype frequency ,respiratory tract diseases ,body regions ,030104 developmental biology ,VQSR, Variant Quality Score Recalibration ,Immunology ,Middle East respiratory syndrome ,TMPRSS2, transmembrane serine protease 2 ,CTSL, cathepsin L1 ,SARS-CoV-2, severe acute respiratory syndrome coronavirus-2 - Abstract
Highlights • COVID-19 infection is characterized by its prominent effect on specific ethnic group. • SARS-CoV-2 cases/mortality were negatively associated with ACE1 II genotype. • The ACE1 II genotype could be a predictive marker of SARS-CoV-2 risk and severity., Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) causes coronavirus disease 2019 (COVID-19). The relentless spread and pathogenicity of the virus have become a global public health emergency. One of the striking features of this pandemic is the pronounced impact on specific regions and ethnic groups. In particular, compared with East Asia, where the virus first emerged, SARS-CoV-2 has caused high rates of morbidity and mortality in Europe. This has not been experienced in past global viral infections, such as influenza, severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) and is unique to SARS-CoV-2. For this reason, we investigated the involvement of genetic factors associated with SARS-CoV-2 infection with a focus on angiotensin-converting enzyme (ACE)-related genes, because ACE2 is a receptor for SARS-CoV-2. We found that the ACE1 II genotype frequency in a population was significantly negatively correlated with the number of SARS-CoV-2 cases. Similarly, the ACE1 II genotype was negatively correlated with the number of deaths due to SARS-CoV-2 infection. These data suggest that the ACE1 II genotype may influence the prevalence and clinical outcome of COVID-19 and serve as a predictive marker for COVID-19 risk and severity.
- Published
- 2020
32. CapsNet-TIS: Predicting translation initiation site based on multi-feature fusion and improved capsule network.
- Author
-
Chen, Yu, Sheng, Guojun, and Wang, Gang
- Subjects
- *
CAPSULE neural networks , *GENETIC translation , *CONVOLUTIONAL neural networks , *GENETIC transcription , *BASIC proteins , *FEATURE extraction - Abstract
• Extracting complex feature information of TIS using multiple encodings. • Capturing hierarchical relationships between features using capsule network. • Improvements are made to the capsule network to enhance performance. • The proposed model improves the prediction performance compared to other models. Genes are the basic units of protein synthesis in organisms, and accurately identifying the translation initiation site (TIS) of genes is crucial for understanding the regulation, transcription, and translation processes of genes. However, the existing models cannot adequately extract the feature information in TIS sequences, and they also inadequately capture the complex hierarchical relationships among features. Therefore, a novel predictor named CapsNet-TIS is proposed in this paper. CapsNet-TIS first fully extracts the TIS sequence information using four encoding methods, including One-hot encoding, physical structure property (PSP) encoding, nucleotide chemical property (NCP) encoding, and nucleotide density (ND) encoding. Next, multi-scale convolutional neural networks are used to perform feature fusion of the encoded features to enhance the comprehensiveness of the feature representation. Finally, the fused features are classified using capsule network as the main network of the classification model to capture the complex hierarchical relationships among the features. Moreover, we improve the capsule network by introducing residual block, channel attention, and BiLSTM to enhance the model's feature extraction and sequence data modeling capabilities. In this paper, the performance of CapsNet-TIS is evaluated using TIS datasets from four species: human, mouse, bovine, and fruit fly, and the effectiveness of each part is demonstrated by performing ablation experiments. By comparing the experimental results with models proposed by other researchers, the results demonstrate the superior performance of CapsNet-TIS. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
33. Advances in the evolution research and genetic breeding of peanut.
- Author
-
Zhang, Hui, Tang, Yueyi, Yue, Yunlai, and Chen, Yong
- Subjects
- *
PEANUT breeding , *CULTIVARS , *PEANUTS , *EDIBLE fats & oils , *GENETIC transformation , *GERMPLASM , *GENE mapping - Abstract
• This paper reviews the research progress of peanut evolution and genetic breeding. • Point out the main problems and challenges of molecular genetic breeding in peanut research. • Clarify the future research directions of peanut. Peanut is an important cash crop used in oil, food and feed in our country. The rapid development of sequencing technology has promoted the research on the related aspects of peanut genetic breeding. This paper reviews the research progress of peanut origin and evolution, genetic breeding, molecular markers and their applications, genomics, QTL mapping and genome selection techniques. The main problems of molecular genetic breeding in peanut research worldwide include: the narrow genetic resources of cultivated species, unstable genetic transformation and unclear molecular mechanism of important agronomic traits. Considering the severe challenges regarding the supply of edible oil, and the main problems in peanut production, the urgent research directions of peanut are put forward: The de novo domestication and the exploitation of excellent genes from wild resources to improve modern cultivars; Integration of multi-omics data to enhance the importance of big data in peanut genetics and breeding; Cloning the important genes related to peanut agronomic traits and analyzing their fine regulation mechanisms; Precision molecular design breeding and using gene editing technology to accurately improve the key traits of peanut. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
34. SARS-CoV-2 and UPS with potentials for therapeutic interventions.
- Author
-
Ferdoush, Jannatul, Abdul Kadir, Rizwaan, Simay Kaplanoglu, Selin, and Osborn, Morgan
- Subjects
- *
SARS-CoV-2 , *PROTEIN stability , *COVID-19 - Abstract
• SARS-CoV-2 significantly impacts the UPS, a key cellular regulatory mechanism. • SARS-CoV-2 encoded proteinsinteract with host UPS, influencing immune signaling and apoptosis. • Stability of ORF3a and ORF8 may or may not be influenced by host proteasome. • Unlike previous studies, recent studies do not show ORF3a as an ion channel. • SARS-CoV-2 PLpro alters host immune responses via interfering withUPS. • Proteomic studies reveal changes in ubiquitination in SARS-CoV-2 infected cells. • Promising treatment include targeting PLpro with zinc-ejector drugs, targeting viral nsp12 via heat treatment. The Ubiquitin proteasome system (UPS), an essential eukaryotic/host/cellular post-translational modification (PTM), plays a critical role in the regulation of diverse cellular functions including regulation of protein stability, immune signaling, antiviral activity, as well as virus replication. Although UPS regulation of viral proteins may be utilized by the host as a defense mechanism to invade viruses, viruses may have adapted to take advantage of the host UPS. This system can be manipulated by viruses such as the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) to stimulate various steps of the viral replication cycle and facilitate pathogenesis, thereby causing the respiratory disease COVID-19. Many SARS-CoV-2 encoded proteins including open reading frame 3a (ORF3a), ORF6, ORF7a, ORF9b, and ORF10 interact with the host's UPS machinery, influencing host immune signaling and apoptosis. Moreover, SARS-CoV-2 encoded papain-like protease (PLpro) interferes with the host UPS to facilitate viral replication and to evade the host's immune system. These alterations in SARS-CoV-2 infected cells have been revealed by various proteomic studies, suggesting potential targets for clinical treatment. To provide insight into the underlying causes of COVID-19 and suggest possible directions for therapeutic interventions, this paper reviews the intricate relationship between SARS-CoV-2 and UPS. Promising treatment strategies are also investigated in this paper including targeting PLpro with zinc-ejector drugs, as well as targeting viral non-structural protein (nsp12) via heat treatment associated ubiquitin-mediated proteasomal degradation to reduce viral pathogenesis. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
35. A review of the role of epigenetic studies for intramuscular fat deposition in beef cattle.
- Author
-
Kuraz Abebe, Belete, Wang, Jianfang, Guo, Juntao, Wang, Hongbao, Li, Anning, and Zan, Linsen
- Subjects
- *
BEEF cattle , *EPIGENETICS , *CATTLE growth , *WHOLE genome sequencing , *BEEF quality , *RNA metabolism - Abstract
• IMF deposition is crucial for beef quality and economic value. • Epigenetic mechanisms transform beef-cattle IMF research globally. • Our paper synthesizes epigenetic-IMF associations in cattle. • We explore environmental factors impacting IMF. • This paper emphasizes DNA methylation, histone modifications, and non-coding RNAs in IMF regulation. Intramuscular fat (IMF) deposition profoundly influences meat quality and economic value in beef cattle production. Meanwhile, contemporary developments in epigenetics have opened new outlooks for understanding the molecular basics of IMF regulation, and it has become a key area of research for world scholars. Therefore, the aim of this paper was to provide insight and synthesis into the intricate relationship between epigenetic mechanisms and IMF deposition in beef cattle. The methodology involves a thorough analysis of existing literature, including pertinent books, academic journals, and online resources, to provide a comprehensive overview of the role of epigenetic studies in IMF deposition in beef cattle. This review summarizes the contemporary studies in epigenetic mechanisms in IMF regulation, high-resolution epigenomic mapping, single-cell epigenomics, multi-omics integration, epigenome editing approaches, longitudinal studies in cattle growth, environmental epigenetics, machine learning in epigenetics, ethical and regulatory considerations, and translation to industry practices from perspectives of IMF deposition in beef cattle. Moreover, this paper highlights DNA methylation, histone modifications, acetylation, phosphorylation, ubiquitylation, non-coding RNAs, DNA hydroxymethylation, epigenetic readers, writers, and erasers, chromatin immunoprecipitation followed by sequencing, whole genome bisulfite sequencing, epigenome-wide association studies, and their profound impact on the expression of crucial genes governing adipogenesis and lipid metabolism. Nutrition and stress also have significant influences on epigenetic modifications and IMF deposition. The key findings underscore the pivotal role of epigenetic studies in understanding and enhancing IMF deposition in beef cattle, with implications for precision livestock farming and ethical livestock management. In conclusion, this review highlights the crucial significance of epigenetic pathways and environmental factors in affecting IMF deposition in beef cattle, providing insightful information for improving the economics and meat quality of cattle production. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
36. Use of sulfonated primers to detect and type papillomavirus in cell cultures and cervical biopsies
- Author
-
Michael Friedman, Israel Nur, and Thierry Paper
- Subjects
Sexually transmitted disease ,Biopsy ,Molecular Sequence Data ,Cervix Uteri ,Biology ,Polymerase Chain Reaction ,Sensitivity and Specificity ,law.invention ,chemistry.chemical_compound ,law ,Primer dimer ,Genetics ,Humans ,DNA Probes, HPV ,Papillomaviridae ,Polymerase chain reaction ,Electroblotting ,Cells, Cultured ,Base Sequence ,DNA–DNA hybridization ,General Medicine ,Virology ,Molecular biology ,Blotting, Southern ,Poly C ,chemistry ,Oligodeoxyribonucleotides ,Recombinant DNA ,Female ,Primer (molecular biology) ,Ethidium bromide ,Sulfur ,Plasmids - Abstract
Human papillomavirus (HPV) was detected by using two sets of deoxyribonucleotide primers for differentiating between 'low-risk' types (HPV11 and HPV6) and 'high-risk' (hri) types (HPV16, HPV18 and HPV33). A new application of the Chemiprobe method for labeling DNA was used to detect products of the polymerase chain reaction (PCR) from 36 cervical biopsies. This method, first demonstrated by Uchimura et al. (submitted), is based on the sulfonation of a polycytidylic acid tail of 5-20 monomers attached to the 5' end of either one or both of the PCR primers. This procedure can increase the sensitivity of detection of PCR products more than 100-fold with respect to ethidium bromide (EtdBr) staining. Various methods were used to detect hri HPV DNA in the 36 clinical samples. The number of positive results obtained was as follows, two by Southern-blot hybridization; five by PCR amplification followed by electrophoresis and detection of products by EtdBr staining; six by PCR amplification using one or two sulfonated C-tailed primers followed by electroblotting and immunoenzymatic visualization; and five by hybridization of sulfonated genomic viral recombinant with a PCR product immobilized on a membrane. The yield of the PCR product was significantly greater when one of the primers was C-tailed than when both or neither of the primers were C-tailed. PCR employing sulfonated C-tailed oligo primers is very specific and sensitive, and the entire procedure can be employed as a nonradioactive substitute for radioactive dot-blot or Southern-blot hybridization procedures, routinely used for detection of HPV in clinical samples.
- Published
- 1991
37. Use of sulfonated primers to detect and type papillomavirus in cell cultures and cervical biopsies
- Author
-
Paper, Thierry, primary, Friedman, Michael, additional, and Nur, Israel, additional
- Published
- 1991
- Full Text
- View/download PDF
38. Role of tumor-derived exosomes mediated immune cell reprograming in cancer.
- Author
-
Liu, Zening, Chen, Zichao, Zhang, Jing, Liu, Junqiu, Li, Baohong, Zhang, Zhenyong, Cai, Meichao, and Zhang, Zhen
- Subjects
- *
EXOSOMES , *T cells , *CANCER cells , *KILLER cells , *DENDRITIC cells , *TUMOR microenvironment - Abstract
• Release of Tumor-derived Exosomes (TDEs) is involved in intercellular information exchange. • Tumor-derived Exosomes (TDEs) can negatively regulate the tumor microenvironment. • Tumor-derived Exosomes (TDEs) inhibit peritumour immune cells and create an immunosuppressive environment. Tumor-derived exosomes (TDEs), as topologies of tumor cells, not only carry biological information from the mother, but also act as messengers for cellular communication. It has been demonstrated that TDEs play a key role in inducing an immunosuppressive tumor microenvironment (TME). They can reprogram immune cells indirectly or directly by delivering inhibitory proteins, cytokines, RNA and other substances. They not only inhibit the maturation and function of dendritic cells (DCs) and natural killer (NK) cells, but also remodel M2 macrophages and inhibit T cell infiltration to promote immunosuppression and create a favorable ecological niche for tumor growth, invasion and metastasis. Based on the specificity of TDEs, targeting TDEs has become a new strategy to monitor tumor progression and enhance treatment efficacy. This paper reviews the intricate molecular mechanisms underlying the immunosuppressive effects induced by TDEs to establish a theoretical foundation for cancer therapy. Additionally, the challenges of TDEs as a novel approach to tumor treatment are discussed. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
39. Extended use of a selective inhibitor of acid lipase for the diagnosis of Wolman disease and cholesteryl ester storage disease.
- Author
-
Civallero, G., De Mari, J., Bittar, C., Burin, M., and Giugliani, R.
- Subjects
- *
LIPASES , *CHOLESTERYL oleate , *IMMUNOLOGIC diseases , *LYSOSOMES , *TRIGLYCERIDES , *FIBROBLASTS , *PHYSIOLOGY - Abstract
Abstract: Lysosomal acid lipase (LAL) deficiency produces two well defined inborn disorders, Wolman disease (WD) and cholesteryl ester storage disease (CESD). WD is a severe, early-onset condition involving massive storage of triglycerides and cholesteryl esters in the liver, with death usually occurring before one year of life. CESD is a more attenuated, later-onset disease that leads to a progressive and variable liver dysfunction. Diagnosis of LAL deficiency is mainly based on the enzyme assay of LAL activity in fibroblasts. Recently, a selective acid lipase inhibitor was used for the determination of enzyme activity in dried-blood filter paper (DBFP) samples. To extend and to validate these studies, we tested LAL activity with selective inhibition on DBFP samples, leukocytes and fibroblasts. Our results showed a clear discrimination between patients with LAL deficiency and healthy controls when using DBFP, leukocytes or fibroblasts (p<0.001). Deficiency of LAL was also demonstrated in individuals referred to our laboratory with suspected clinical diagnosis of WD, CESD, and Niemann–Pick type B. We conclude that the assay of LAL using selective inhibitor is a reliable and useful method for the identification of LAL deficiency, not only in DBFP samples but also in leukocytes and fibroblasts. This is important as enzyme replacement therapy for LAL deficiency is currently being developed, making the correct diagnosis a critical issue. [Copyright &y& Elsevier]
- Published
- 2014
- Full Text
- View/download PDF
40. Role of microRNAs in inner ear development and hearing loss.
- Author
-
Mittal, Rahul, Liu, George, Polineni, Sai P., Bencie, Nicole, Yan, Denise, and Liu, Xue Zhong
- Subjects
- *
MICRORNA , *INNER ear , *EAR development , *HEARING disorders , *HAIR cells , *GENETIC regulation , *GENE expression - Abstract
Abstract The etiology of hearing loss tends to be multi-factorial and affects a significant proportion of the global population. Despite the differences in etiology, a common physical pathological change that leads to hearing loss is damage to the mechanosensory hair cells of the inner ear. MicroRNAs (miRNAs) have been shown to play a role in inner ear development and thus, may play a role in the development or prevention of hearing loss. In this paper, we review the mechanism of action of miRNAs in the auditory system. We present an overview about the role of miRNAs in inner ear development, summarize the current research on the role of miRNAs in gene regulation, and discuss the effects of both miRNA mutations as well as overexpression. We discuss the crucial role of miRNAs in ensuring normal physiological development of the inner ear. Any deviation from the proper function of miRNA in the cochlea seems to contribute to deleterious damage to the structure of the auditory system and subsequently results in hearing loss. As interest for miRNA research increases, this paper serves as a platform to review current understandings and postulate future avenues for research. A better knowledge about the role of miRNA in the auditory system will help in developing novel treatment modalities for restoring hearing function based on regeneration of damaged inner ear hair cells. Highlights • MicroRNAs (miRNAs) plays a crucial role in inner ear development. • Abnormal function of miRNAs in the auditory system has been associated with hearing loss. • A better knowledge about the miRNA regulated signaling pathways will pave the way for developing novel treatment modalities for hearing loss. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
41. Exploring the association between SRPX2 variants and neurodevelopment: How causal is it?
- Author
-
Schirwani, Schaida, McConnell, Vivienne, Willoughby, Josh, and Balasubramanian, Meena
- Subjects
- *
EPILEPSY , *NEURONS - Abstract
Abstract The SRPX2 gene (Sushi-repeat-containing protein, X-linked, 2, OMIM*300642), located on Xq22.1, encodes a secreted protein that is highly expressed in neurons of cerebral cortex. SRPX2 was first implicated in neurodevelopment, learning and rolandic seizure when two patients with potentially pathogenic variants, c.980A>G (p.Asn327Ser) and c.215A>C (p.Tyr72Ser), in SRPX2 gene were identified. Subsequent experimental studies demonstrated that SRPX2 is needed for vocalization and synapse formation in mice, and that both silencing SRPX2 and injecting (p.Asn327Ser) in mouse models results in alteration in neuronal migration in cerebral cortex and epilepsy. A number of studies demonstrated that SRPX2 interacts with FOXP2 (Foxhead box protein P2), a gene responsible for speech and language disorder, and that FoxP2 controls timing and level of expression of SRPX2. Despite the supportive evidence for the role of SRPX2 in speech and language development and disorders, there are questions over its definitive association with neurodevelopmental disorders and epilepsy. In this paper, the role of SRPX2 as one in a network of many genes involved in speech and language is discussed. The goal of this paper is to examine the role of SRPX2 variants through describing two patients with potentially pathogenic variants in SRPX2 , c.751G>C (p.Ala251Pro) and c.762G>T (p.Lys254Asn) presenting with language and motor delay, intellectual disability as well as congenital anomalies. We explore the contribution of SRPX2 variants to clinical phenotype in our patients and conclude that these variants at least partially explain the phenotype. Further studies are necessary to establish and confirm the association between SRPX2 and neurodevelopment particularly speech and language development. Highlights • Review currently available evidence on involvement of SRPX2 in neurodevelopmental delay • We provide further evidence of neurodevelopmental delay being associated with SRPX2 variants. • Report two likely pathogenic variants in SRPX2 [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
42. Dissecting the role of miR-21 in different types of stroke.
- Author
-
Panagal, Mani, Biruntha, M., Vidhyavathi, R.M., Sivagurunathan, P., Senthilkumar, S.R., and Sekar, Durairaj
- Subjects
- *
STROKE , *NON-coding RNA , *MICRORNA , *NON-communicable diseases , *NEUROLOGICAL disorders , *INTERLEUKIN-21 - Abstract
Abstract Stroke is an important neurological disease in which blood flow to the brain is interrupted and it is becoming an increasing non-communicable disease in developing countries. Current treatment options for stroke is modifying lifestyle practice, diabetes treatment, drugs, and other factors management, but yet no cure is available in sight for the disease, despite it requires new insight into the molecular and therapeutic targets. In general, MicroRNAs (miRNAs) are small noncoding RNAs considered as of greater biological importance and controls molecular signaling pathways in diabetic pathogenesis. Among the reported MiRNAs, MIR-21 is considered to be an important MiRNA, which is frequently elevated in many types of types of strokes, suggesting that it plays an important role in cell proliferation, and apoptosis. Until now, there is no research paper that signifying the role of miR-21 in all types of strokes and the number of studies on the different category of strokes is limited, so in this paper, we are highlighting the recent investigations related to the significance of miR-21 in different types of strokes based on the up-to-date reports. It was found that MiR-21 was found to be normally up and down regulated in all types of strokes, however; we summarize the important research findings related to the role of miR-21 in different types of strokes. Highlights • Stroke is a neurological disease in which blood flow to the brain is interrupted and it is becoming an increasing non-communicable disease in developed as well as in developing countries. • Current treatments for stroke include modified lifestyle practice, diabetes treatment, drugs, and other factors management, yet no cure is available in sight for the disease, despite it requires new insight into the molecular and pathophysiology. • MicroRNAs (miRNAs) are small noncoding RNAs considered as of greater biological importance and controls molecular signaling pathways in stroke pathology. • MicroRNA 21 has been an important MicroRNA frequently upregulated in all types of diseases, suggesting that it plays an important role in cell proliferation, and apoptosis. • Among the reported miRNAs, miR-21 is considered to be an important miRNA, which is frequently elevated in many types of types of diseases, suggesting that it plays an important role in cell proliferation and apoptosis. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
43. DjRlc is required for the intestinal regeneration in planarian Dugesia japonica.
- Author
-
Ma, Kaifu, Wu, Suge, Zhen, Hui, Song, Qian, Wang, Mengwei, Deng, Hongkuan, and Zhao, Bosheng
- Subjects
- *
MYOSIN light chain kinase , *MUSCLE contraction , *DUGESIA , *REGENERATION (Biology) , *GENE expression - Abstract
Abstract The myosin regulatory light chain (RLC) proteins play an important role in cellular processes, especially in muscle contraction. The planarian intestine is a fascinating system for studying the organogenesis during regeneration. In this paper, A homolog gene of Rlc, DjRlc , was identified and characterized in Dugesia japonica. The DjRlc sequence analysis revealed that it contains an opening reading frame encoding a putative protein of 175 amino acids with functionally domains that are highly conserved, including an EF-Hand motif and Ca2+ binding sites. Whole mount in situ hybridization showed that DjRlc is predominantly expressed in the intestine of intact and regenerating planarians. The cross sections of planarians revealed that the DjRlc distributes in the muscle of intact planarians. Knockdown of RNA interference of DjRlc by dsRNA -DjRlc affected the intestinal morphology, causing distinct defects in branching morphogenesis. These finding suggest that DjRlc is required for intestinal regeneration. Highlights • The highlights of the paper include (1) planarian myosin regulatory light chain (DjRlc) gene expressed in the intestine during regeneration; (2) loss function of DjRlc by RNA interference during planarian regeneration inhibited intestinal branches regeneration. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
44. Modelling on COVID-19 control with double and booster-dose vaccination.
- Author
-
Kalra, Preety, Ali, Shoket, and Ocen, Samuel
- Subjects
- *
BOOSTER vaccines , *COVID-19 pandemic , *COVID-19 , *INFECTIOUS disease transmission , *COVID-19 vaccines - Abstract
• Vaccination strategies achieve stable control of COVID-19 when R 0 is less than 1. • Higher vaccination rates reduce COVID-19 prevalence and outbreak risk. • Studies confirm double-dose and booster vaccinations lower transmission and mortality, especially in older populations. • Ongoing preventive measures are essential alongside vaccinations to curb virus transmission. COVID-19 vaccines have been illustrated to lessen the growth of sickness caused by the virus effectively. In any case, inoculation has consistently been controversial, with differing opinions and viewpoints. This has compelled some individuals to decide against receiving the vaccine. These divergent viewpoints have had a trivial impact on the epidemic's dynamics and the disease's development. In response to vaccinated individuals still falling ill, many countries have implemented booster vaccines to protect further. In this specific investigation, a mathematical model composed of seven compartments is employed to examine the effectiveness of a booster dose in preventing and treating the transmission of COVID-19. The principles of mathematics are employed to analyse and investigate the dynamics of the disease. Using a qualitative prototype analysis, we acquired valuable insights into its effectiveness. One essential aspect is the basic reproduction number, a critical determinant of the disease's spread. This calculation is determined by studying the system's equilibrium and evaluating its stability. Furthermore, we examined the balance from a local and global viewpoint, considering the possibility of bifurcation and the model's reproductive number sensitivity index. Through numerical simulations, we have visually illustrated the analytical findings outlined in this research paper and presented a thorough examination of the efficacy of booster shots as a preventive and therapeutic measure in the spread dynamics of COVID-19. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
45. Empowering rice breeding with NextGen genomics tools for rapid enhancement nitrogen use efficiency.
- Author
-
Salama, Ehab A.A., Kambale, Rohit, Gnanapanditha Mohan, Shobhana V., Premnath, Ameena, Fathy Yousef, Ahmed, Moursy, Ali R.A., Abdelsalam, Nader R., Abd El Moneim, Diaa, Muthurajan, Raveendran, and Manikanda Boopathi, Narayanan
- Subjects
- *
RAPID tooling , *RICE breeding , *NITROGEN in soils , *GENOMICS , *TECHNOLOGY transfer , *ECOLOGICAL impact , *NITROGEN fertilizers , *RICE - Abstract
• There is a soaring increase of the N fertilizers prices and the problems caused by excess use of N fertilizers forced the rice breeders to rethink other sustainable, affordable, accessible, and globally acceptable strategies. • Multidisciplinary scientific collaboration promotes innovation that leads to the development of rice varieties that use nitrogen most effectively, facilitate smart technology transfer, and promote the adoption of NUE practices by farmers and stakeholders and minimize environmental impact and contribute to a sustainable agricultural future. • The utilization of recent omics technologies, for instance, genomics and pan-genomics, transcriptomics, proteomics, metabolomics, ionomics, fluxomics and nutrigenomics could provide us an overview and facilitate our deep global understanding on NUE. As rice has no physiological capacity of fixing nitrogen in the soil, its production had always been reliant on the external application of nitrogen (N) to ensure enhanced productivity. In the light of improving nitrogen use efficiency (NUE) in rice, several advanced agronomic strategies have been proposed. However, the soared increase of the prices of N fertilizers and subsequent environmental downfalls caused by the excessive use of N fertilizers, reinforces the prerequisite adaptation of other sustainable, affordable, and globally acceptable strategies. An appropriate alternative approach would be to develop rice cultivars with better NUE. Conventional breeding techniques, however, have had only sporadic success in improving NUE, and hence, this paper proposes a new schema that employs the wholesome benefits of the recent advancements in omics technologies. The suggested approach promotes multidisciplinary research, since such cooperation enables the synthesis of many viewpoints, approaches, and data that result in a comprehensive understanding of NUE in rice. Such collaboration also encourages innovation that leads to developing rice varieties that use nitrogen more effectively, facilitate smart technology transfer, and promotes the adoption of NUE practices by farmers and stakeholders to minimize ecological impact and contribute to a sustainable agricultural future. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
46. Circular RNAs: Epigenetic regulators of PTEN expression and function in cancer.
- Author
-
Farazi, Mohammad-Mojtaba, Jafarinejad-Farsangi, Saeideh, Miri Karam, Zahra, Gholizadeh, Maryam, Hadadi, Maryam, and Yari, Abolfazl
- Subjects
- *
CIRCULAR RNA , *EPIGENOMICS , *GENE expression , *EPIGENETICS , *GENETIC regulation , *PTEN protein , *NUCLEOTIDE sequence - Abstract
[Display omitted] • PTEN gene expression is epigenetically controlled by circular RNAs from transcription to post-translation. • Most regulatory circRNAs exert their function through sponging miRNAs that target PTEN. • CircPTENs directly derived from PTEN mRNA negatively affect cancer progression. • CircPTENs suppress tumors by regulating PTEN function or affecting TGF-β and AKT pathways. Epigenetic regulation of gene expression, without altering the DNA sequence, is involved in many normal cellular growth and division events, as well as diseases such as cancer. Epigenetics is no longer limited to DNA methylation, and histone modification, but regulatory non-coding RNAs (ncRNAs) also play an important role in epigenetics. Circular RNAs (circRNAs), single-stranded RNAs without 3′ and 5′ ends, have recently emerged as a class of ncRNAs that regulate gene expression. CircRNAs regulate phosphatase and tensin homolog (PTEN) expression at various levels of transcription, post-transcription, translation, and post-translation under their own regulation. Given the importance of PTEN as a tumor suppressor in cancer that inhibits one of the most important cancer pathways PI3K/AKT involved in tumor cell proliferation and survival, significant studies have been conducted on the regulatory role of circRNAs in relation to PTEN. These studies will be reviewed in this paper to better understand the function of this protein in cancer and explore new therapeutic approaches. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
47. Revisiting the role and mechanism of ELF3 in circadian clock modulation.
- Author
-
Zhu, Xingzun and Wang, Hongtao
- Subjects
- *
CIRCADIAN rhythms , *FLOWERING time , *POST-translational modification , *PLANT growth , *PLANT development , *TRANSCRIPTION factors , *PROTEIN-protein interactions , *BIOTECHNOLOGY - Abstract
[Display omitted] • ELF3 controls photoperiodic flowering and circadian rhythms for proper plant growth and development. • ELF3 enhances plant resilience and adaptability to diverse environmental conditions. • ELF3 interacts with other transcription factors in the EC-independent pathways. • ELF3 provides a strategy to optimize crop cultivation in different geographical regions. The gene encoding EARLY FLOWERING3 (ELF3) is necessary for photoperiodic flowering and the normal regulation of circadian rhythms. It provides important information at the cellular level to uncover the biological mechanisms that improve plant growth and development. ELF3 interactions with transcription factors such as BROTHER OF LUX ARRHYTHMO (BOA), LIGHT-REGULATED WD1 (LWD1), PHYTOCHROME-INTERACTING FACTOR 4 (PIF4), PHYTOCHROME-INTERACTING FACTOR 7 (PIF7), and LUX ARRHYTHMO (LUX) suggest a role in evening complex (EC) independent pathways, demanding further investigation to elucidate the EC-dependent versus EC-independent mechanisms. The ELF3 regulation of flowering time about photoperiod and temperature variations can also optimize crop cultivation across diverse latitudes. In this review paper, we summarize how ELF3′s role in the circadian clock and light-responsive flowering control in crops offers substantial potential for scientific advancement and practical applications in biotechnology and agriculture. Despite its essential role in crop adaptation, very little is known in many important crops. Consequently, comprehensive and targeted research is essential for extrapolating ELF3-related insights from Arabidopsis to other crops, utilizing both computational and experimental methodologies. This research should prioritize investigations into ELF3′s protein–protein interactions, post-translational modifications, and genomic targets to elucidate its contribution to accurate circadian clock regulation. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
48. A review of the advances, insights, and prospects of gene therapy for Alzheimer's disease: A novel target for therapeutic medicine.
- Author
-
Ataei, Bahar, Hokmabadi, Mahsa, Asadi, Sahar, Asadifard, Elnaz, Aghaei Zarch, Seyed Mohsen, Najafi, Sajad, and Bagheri-Mohammadi, Saeid
- Subjects
- *
ALZHEIMER'S disease , *TAU proteins , *GENE therapy , *NANOMEDICINE , *DRUG target , *FORENSIC pathology , *NEURODEGENERATION , *BRAIN anatomy - Abstract
• Multimodal strategies and interventions, e.g. healthy lifestyle (dietary and physical activity), can be recommended for treatment of Alzheimer's disease (AD). • Gene study and gene-based therapy with a critical role in the detection and cure of AD will have a fundamental role. • Attempts to enhance clinical results are focused on several main areas including design and detection of more effective carrier molecules, selection of the best gene delivery methods, and detection of novel therapeutic targets. Neurodegenerative diseases such as Alzheimer's disease (AD) are still an important issue for scientists because it is difficult to cure with the available molecular medications and conventional treatments. Due to the complex nature of the brain structures and heterogeneous morphological and physiological properties of neuronal cells, interventions for cerebral-related disorders using surgical approaches, and classical and ongoing treatments remain hard for physicians. Furthermore, the development of newly designed medications attempts to target AD are not successful in improving AD, because abnormalities of tau protein, aggregation of amyloid β (Aβ) peptide, inflammatory responses, etc lead to advanced neurodegeneration processes that conventional treatments cannot stop them. In recent years, novel diagnostic strategies and therapeutic approaches have been developed to identify and cure early pathological events of AD. Accordingly, many gene-based therapies have been developed and introduce the therapeutic potential to prevent and cure AD. On the other hand, genetic investigations and postmortem assessments have detected a large number of factors associated with AD pathology. Also, genetically diverse animal models of AD help us to detect and prioritize novel resilience mechanisms. Hence, gene therapy can be considered an effective and powerful tool to identify and treat human diseases. Ultimately, gene study and gene-based therapy with a critical role in the detection and cure of various human disorders will have a fundamental role in our lives forever. This scientific review paper discusses the present status of different therapeutic strategies, particularly gene-based therapy in treating AD, along with its challenges. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
49. A randomized optimal k-mer indexing approach for efficient parallel genome sequence compression.
- Author
-
Roy, Subhankar and Mukhopadhyay, Anirban
- Subjects
- *
SARS-CoV-2 , *NUCLEOTIDE sequencing - Abstract
• A reference-based, specialized lossless two-level compression technique is proposed for genomic sequences. • The technique employs optimized k -mer indexing with randomization, hashing data structures, and ASCII coding. • Parallel sequence compression is performed with Java multithreading on Amazon Web Services (AWS) Linux platform. • Use of IUPAC codes enables compression of genomic sequences in the FAST-ALL (FASTA) format. • The COVID-19 virus (SARS-CoV-2) and the human genome were used as sources of sequence data. Next Generation Sequencing (NGS) technology generates massive amounts of genome sequence that increases rapidly over time. As a result, there is a growing need for efficient compression algorithms to facilitate the processing, storage, transmission, and analysis of large-scale genome sequences. Over the past 31 years, numerous state-of-the-art compression algorithms have been developed. The performance of any compression algorithm is measured by three main compression metrics: compression ratio, time, and memory usage. Existing k -mer hash indexing systems take more time, due to the decision-making process based on compression results. In this paper, we propose a two-phase reference genome compression algorithm using optimal k -mer length (RGCOK). Reference-based compression takes advantage of the inter-similarity between chromosomes of the same species. RGCOK achieves this by finding the optimal k -mer length for matching, using a randomization method and hashing. The performance of RGCOK was evaluated on three different benchmark data sets: novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), Homo sapiens, and other species sequences using an Amazon AWS virtual cloud machine. Experiments showed that the optimal k -mer finding time by RGCOK is around 45.28 min, whereas the time for existing state-of-the-art algorithms HiRGC, SCCG, and HRCM ranges from 58 min to 8.97 h. [ABSTRACT FROM AUTHOR]
- Published
- 2024
- Full Text
- View/download PDF
50. CRISPR/Cas9-based gene-editing technology for sickle cell disease.
- Author
-
Ma, Liangliang, Yang, Shanglun, Peng, Qianya, Zhang, Jingping, and Zhang, Jing
- Subjects
- *
SICKLE cell anemia , *GLOBIN genes , *CRISPRS , *GENOME editing , *HEMATOPOIETIC stem cell transplantation , *GENE therapy - Abstract
• Gene therapy has advanced rapidly into the 21st century with the promise of a cure for SCD, and gene editing strategies based on the cluster-based regularly interspaced short palindromic repeat sequence (CRISPR)/Crispr associates protein 9 (Cas9) system have revolutionized the field of gene therapy by precisely targeting genes. • CRISPR-Cas9 systems can be delivered into cells and generally come in three types: the delivery of plasmid DNA, the delivery of messenger RNA (mRNA) capable of expressing the Cas9 protein and sgRNA, and delivering the Cas9 protein and sgRNA to form ribonucleoprotein (RNP). • Delivery technologies can be divided into three main categories: physical delivery, viral vectors, and nonviral vectors. • CRISPR-Cas9 can be used for gene correction of SCD, promoter mutation of γ-globins, CRISPR-Cas9 for partial deletion of the β-globin gene, use of CRISPR-Cas9 for editing transcriptional repressors. Sickle cell disease (SCD) is the most common monogenic hematologic disorder and is essentially congenital hemolytic anemia caused by an inherited point mutation in the β-globin on chromosome 11. Although the genetic basis of SCD was revealed as early as 1957, treatment options for SCD have been very limited to date. Hematopoietic stem cell transplantation (HSCT) was thought to hold promise as a cure for SCD, but the available donors were still only 15% useful. Gene therapy has advanced rapidly into the 21st century with the promise of a cure for SCD, and gene editing strategies based on the cluster-based regularly interspaced short palindromic repeat sequence (CRISPR)/Cas9 system have revolutionized the field of gene therapy by precisely targeting genes. In this paper, we review the pathogenesis and therapeutic approaches of SCD, briefly summarize the delivery strategies of CRISPR/Cas9, and finally discuss in depth the current status, application barriers, and solution directions of CRISPR/Cas9 in SCD. Through the review in this paper, we hope to provide some references for gene therapy in SCD. [ABSTRACT FROM AUTHOR]
- Published
- 2023
- Full Text
- View/download PDF
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.