14 results
Search Results
2. The roles of MHC class II genes and post-translational modification in celiac disease.
- Author
-
Sollid, Ludvig
- Subjects
CELIAC disease ,MAJOR histocompatibility complex ,IMMUNE response ,T cells ,AUTOANTIBODIES - Abstract
Our increasing understanding of the etiology of celiac disease, previously considered a simple food hypersensitivity disorder caused by an immune response to cereal gluten proteins, challenges established concepts of autoimmunity. HLA is a chief genetic determinant, and certain HLA-DQ allotypes predispose to the disease by presenting posttranslationally modified (deamidated) gluten peptides to CD4 T cells. The deamidation of gluten peptides is mediated by transglutaminase 2. Strikingly, celiac disease patients generate highly disease-specific autoantibodies to the transglutaminase 2 enzyme. The dual role of transglutaminase 2 in celiac disease is hardly coincidental. This paper reviews the genetic mapping and involvement of MHC class II genes in disease pathogenesis, and discusses the evidence that MHC class II genes, via the involvement of transglutaminase 2, influence the generation of celiac disease-specific autoantibodies. [ABSTRACT FROM AUTHOR]
- Published
- 2017
- Full Text
- View/download PDF
3. The COVID-19 inflammation and high mortality mechanism trigger
- Author
-
Stróż, Samuel, Kosiorek, Piotr, and Stasiak-Barmuta, Anna
- Published
- 2024
- Full Text
- View/download PDF
4. Innate immune genes of the chicken MHC and related regions.
- Author
-
Kaufman, Jim
- Subjects
OLFACTORY receptors ,CHICKENS ,GENES ,MAJOR histocompatibility complex ,NATURAL immunity ,IMMUNE response - Abstract
Compared to the major histocompatibility complex (MHC) of typical mammals, the chicken BF/BL region is small and simple, with most of the genes playing central roles in the adaptive immune response. However, some genes of the chicken MHC are almost certainly involved in innate immunity, such as the complement component C4 and the lectin-like receptor/ligand gene pair BNK and Blec. The poorly expressed classical class I molecule BF1 is known to be recognised by natural killer (NK) cells and, analogous to mammalian immune responses, the classical class I molecules BF1 and BF2, the CD1 homologs and the butyrophilin homologs called BG may be recognised by adaptive immune lymphocytes with semi-invariant receptors in a so-called adaptate manner. Moreover, the TRIM and BG regions next to the chicken MHC, along with the genetically unlinked Y and olfactory/scavenger receptor regions on the same chromosome, have multigene families almost certainly involved in innate and adaptate responses. On this chicken microchromosome, the simplicity of the adaptive immune gene systems contrasts with the complexity of the gene systems potentially involved in innate immunity. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
5. In silico analysis reveals interrelation of enriched pathways and genes in type 1 diabetes
- Author
-
Sur, Saubashya
- Published
- 2020
- Full Text
- View/download PDF
6. Polymorphism of duck MHC class molecules.
- Author
-
Zhang, Lin, Lin, Dongmei, Yu, Sen, Bai, Junping, Jiang, Wanchun, Su, Wenzheng, Huang, Yanyan, Yang, Shaohua, and Wu, Jiaqiang
- Subjects
MAJOR histocompatibility complex ,GENETIC polymorphisms ,DUCK populations ,BIRD diseases ,IMMUNE response ,HOMOLOGY (Biology) - Abstract
Major histocompatibility complex class I (MHC I) molecules are critically involved in defense against pathogens, and their high polymorphism is advantageous to a range of immune responses, especially in duck displaying biased expression of one MHC I gene. Here, we examined MHC I polymorphism in two duck (Anas platyrhynchos) breeds from China: Shaoxing (SX) and Jinding (JD). Twenty-seven unique UAA alleles identified from the MHC I genes of these breeds were analyzed concerning amino acid composition, homology, and phylogenetic relationships. Based on amino acid sequence homology, allelic groups of Anas platyrhynchos MHC I (Anpl-MHC I) were established and their distribution was analyzed. Then, highly variable sites (HVSs) in peptide-binding domains (PBD) were estimated and located in the three-dimensional structure of Anpl-MHC I. The UAA alleles identified showed high polymorphism, based on full-length sequence homology. By adding the alleles found here to known Anpl-MHC I genes from domestic ducks, they could be divided into 17 groups and four novel groups were revealed for SX and JD ducks. The UAA alleles of the two breeds were not divergent from the MHC I of other duck breeds, and HVSs were mostly located in the peptide-binding groove (PBG), suggesting that they might determine peptide-binding characteristics and subsequently influence peptide presentation and recognition. The results from the present study enrich Anpl-MHC I polymorphism data and clarify the distribution of alleles with different peptide-binding specificities, which might also accelerate effective vaccine development and help control various infections in ducks. [ABSTRACT FROM AUTHOR]
- Published
- 2019
- Full Text
- View/download PDF
7. High prevalence of dengue antibodies and the arginine variant of the FcγRIIa polymorphism in asymptomatic individuals in a population of Minas Gerais State, Southeast Brazil.
- Author
-
Pereira, Anna Carolina Toledo da Cunha, de Siqueira, Tatiane Ribeiro, de Oliveira Prado, Andressa Anunciação, da Silva, Camila Almeida Veiga, de Fátima Silva Moraes, Thaís, Aleixo, Alan Alex, de Magalhaes, José Carlos, de Souza, Gabriel Augusto Pires, Drumond, Betânia Paiva, Ferreira, Gustavo Portela, de Mello Silva, Breno, de Brito Magalhães, Cintia Lopes, Santos, Luciana Lara, Ferreira, Jaqueline Maria Siqueira, Malaquias, Luiz Cosme Cotta, and Coelho, Luiz Felipe Leomil
- Subjects
DENGUE viruses ,DENGUE ,DISEASE prevalence ,ARGININE ,SINGLE nucleotide polymorphisms ,IMMUNE response ,DISEASE susceptibility ,INFECTIOUS disease transmission - Abstract
Dengue is the most prevalent arthropod-borne viral illness in humans worldwide. Single-nucleotide polymorphisms (SNPs) in genes involved in the immune response, such as dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN), IgG Fc receptor II-A (FcγRIIa), vitamin D receptor (VDR), and tumor necrosis factor alpha (TNF-α), were previously reported to be associated with susceptibility to dengue disease in different human populations. Therefore, due to the relevant association of host immune and genetic status with disease susceptibility/severity of dengue, this work aims to verify the frequency of anti-dengue virus antibodies and some dengue-associated risk SNPs in a population in Minas Gerais State, Southeast Brazil. A total of 1560 individuals were genotyped for polymorphisms in DC-SIGN (rs4804803), FcγRIIa (rs1801274), VDR (rs7975232), and TNF-α (rs1800629). The presence of anti-dengue antibodies (IgM and/or IgG) in these samples was also assayed. Anti-dengue antibodies were detected at an overall frequency of 16.86%, indicating a virus infection in asymptomatic individuals. The genotypic frequencies of all SNPs studied did not differ between the asymptomatic and control groups. Regarding the allelic frequencies of the four SNPs analyzed, a higher frequency was detected of the G allele of FcγRIIa/rs1801274 in the asymptomatic individuals when compared to that in the control group (
p = 0.03). Therefore, the results showed a high prevalence of asymptomatic individuals in Minas Gerais State, with a potential association between the presence of the G allele of FcγRIIa/rs1801274 and protection against symptomatic disease. [ABSTRACT FROM AUTHOR]- Published
- 2018
- Full Text
- View/download PDF
8. On the feasibility of mining CD8+ T cell receptor patterns underlying immunogenic peptide recognition.
- Author
-
De Neuter, Nicolas, Bittremieux, Wout, Beirnaert, Charlie, Cuypers, Bart, Mrzic, Aida, Moris, Pieter, Suls, Arvid, Van Tendeloo, Viggo, Ogunjimi, Benson, Laukens, Kris, and Meysman, Pieter
- Subjects
T cell receptors ,EPITOPES ,IMMUNE response ,PATTERN perception ,MAJOR histocompatibility complex - Abstract
Current T cell epitope prediction tools are a valuable resource in designing targeted immunogenicity experiments. They typically focus on, and are able to, accurately predict peptide binding and presentation by major histocompatibility complex (MHC) molecules on the surface of antigen-presenting cells. However, recognition of the peptide-MHC complex by a T cell receptor (TCR) is often not included in these tools. We developed a classification approach based on random forest classifiers to predict recognition of a peptide by a T cell receptor and discover patterns that contribute to recognition. We considered two approaches to solve this problem: (1) distinguishing between two sets of TCRs that each bind to a known peptide and (2) retrieving TCRs that bind to a given peptide from a large pool of TCRs. Evaluation of the models on two HIV-1, B*08-restricted epitopes reveals good performance and hints towards structural CDR3 features that can determine peptide immunogenicity. These results are of particular importance as they show that prediction of T cell epitope and T cell epitope recognition based on sequence data is a feasible approach. In addition, the validity of our models not only serves as a proof of concept for the prediction of immunogenic T cell epitopes but also paves the way for more general and high-performing models. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
9. Genetic variants of tumor necrosis factor-α -308G/A (rs1800629) but not Toll-interacting proteins or vitamin D receptor genes enhances susceptibility and severity of malaria infection.
- Author
-
Ojurongbe, Olusola, Funwei, Roland I., Snyder, Tara J., Farid, Iman, Aziz, Najihah, Li, Yi, Falade, Catherine O., and Thomas, Bolaji N.
- Subjects
TUMOR necrosis factors ,VITAMIN D receptors ,GENETIC polymorphisms ,GENOMICS ,IMMUNE response - Abstract
Susceptibility to malaria infection has been associated with host genetic polymorphisms that differs between groups. We hypothesize that Toll-interacting proteins ( TOLLIP), vitamin D receptor (VDR) and tumor necrosis factor-α (TNF) genes are significant contributors to susceptibility and disease severity in Plasmodium falciparum (Pf) infection. Our aim is to explore the genomic diversity and haplotype frequency of these genes, as well as extrapolate possible association with markers of severity, between malaria-infected and healthy controls. Genomic DNA samples extracted from the blood of 107 malaria-infected patients and 190 uninfected controls were analyzed, with no difference in genotypic or allelic frequencies of TOLLIP and VDR polymorphisms. However, a significant difference in the genotypic ( p = 2.20E-16) and allelic frequencies ( p = 2.20E-16) of the TNF-α (snp rs1800629) polymorphism was found. The preponderance of the mutant variant among the malaria-infected show a possible impaired capacity to mount an effective immune response, potentially confirmed by our association results. This result calls for analysis of clearly delineated uncomplicated versus severe disease groups, including serum assays, providing a basis to conclude that susceptibility to malaria infection and potential contribution to disease severity is significantly associated with polymorphisms of the tumor necrosis factor-α but not TOLLIP or VDR genes. [ABSTRACT FROM AUTHOR]
- Published
- 2018
- Full Text
- View/download PDF
10. Invariant natural killer T cells: front line fighters in the war against pathogenic microbes.
- Author
-
Crosby, Catherine and Kronenberg, Mitchell
- Subjects
KILLER cells ,IMMUNE response ,T cell receptors ,GLYCOLIPIDS ,CD11 antigen - Abstract
Invariant natural killer T ( iNKT) cells constitute a unique subset of innate-like T cells that have been shown to have crucial roles in a variety of immune responses. iNKT cells are characterized by their expression of both NK cell markers and an invariant T cell receptor (TCR) α chain, which recognizes glycolipids presented by the MHC class I-like molecule CD1d. Despite having a limited antigen repertoire, the iNKT cell response can be very complex, and participate in both protective and harmful immune responses. The protective role of these cells against a variety of pathogens has been particularly well documented. Through the use of these pathogen models, our knowledge of the breadth of the iNKT cell response has been expanded. Specific iNKT cell antigens have been isolated from several different bacteria, from which iNKT cells are critical for protection in mouse models. These responses can be generated by direct, CD1d-mediated activation, or indirect, cytokine-mediated activation, or a combination of the two. This can lead to secretion of a variety of different Th1, Th2, or Th17 cytokines, which differentially impact the downstream immune response against these pathogens. This critical role is emphasized by the conservation of these cells between mice and humans, warranting further investigation into how iNKT cells participate in protective immune responses, with the ultimate goal of harnessing their potential for treatment. [ABSTRACT FROM AUTHOR]
- Published
- 2016
- Full Text
- View/download PDF
11. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.
- Author
-
Ovsyannikova, Inna, Salk, Hannah, Larrabee, Beth, Pankratz, V., and Poland, Gregory
- Subjects
RUBELLA ,MMR vaccines ,IMMUNE response ,SINGLE nucleotide polymorphisms ,HAPLOTYPES ,CHILDREN'S health ,HEALTH outcome assessment ,THERAPEUTICS - Abstract
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes ( PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion ( t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers ( t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. [ABSTRACT FROM AUTHOR]
- Published
- 2015
- Full Text
- View/download PDF
12. The immunotranscriptome of the Caribbean reef-building coral Pseudodiploria strigosa.
- Author
-
Ocampo, Iván, Zárate-Potes, Alejandra, Pizarro, Valeria, Rojas, Cristian, Vera, Nelson, and Cadavid, Luis
- Subjects
SYMMETRICAL brain coral ,ETIOLOGY of diseases ,CORAL reefs & islands ,IMMUNE response ,LEUCINE ,IMMUNOGLOBULINS ,LECTINS - Abstract
The viability of coral reefs worldwide has been seriously compromised in the last few decades due in part to the emergence of coral diseases of infectious nature. Despite important efforts to understand the etiology and the contribution of environmental factors associated to coral diseases, the mechanisms of immune response in corals are just beginning to be studied systematically. In this study, we analyzed the set of conserved immune response genes of the Caribbean reef-building coral Pseudodiploria strigosa by Illumina-based transcriptome sequencing and annotation of healthy colonies challenged with whole live Gram-positive and Gram-negative bacteria. Searching the annotated transcriptome with immune-related terms yielded a total of 2782 transcripts predicted to encode conserved immune-related proteins that were classified into three modules: (a) the immune recognition module, containing a wide diversity of putative pattern recognition receptors including leucine-rich repeat-containing proteins, immunoglobulin superfamily receptors, representatives of various lectin families, and scavenger receptors; (b) the intracellular signaling module, containing components from the Toll-like receptor, transforming growth factor, MAPK, and apoptosis signaling pathways; and (3) the effector module, including the C3 and factor B complement components, a variety of proteases and protease inhibitors, and the melanization-inducing phenoloxidase. P. strigosa displays a highly variable and diverse immune recognition repertoire that has likely contributed to its resilience to coral diseases. [ABSTRACT FROM AUTHOR]
- Published
- 2015
- Full Text
- View/download PDF
13. Chicken major histocompatibility complex polymorphism and its association with production traits.
- Author
-
Nikbakht, Gholamreza and Esmailnejad, Atefeh
- Subjects
MAJOR histocompatibility complex ,CHICKENS as laboratory animals ,GENETIC polymorphisms ,IMMUNE response ,POLYMERASE chain reaction - Abstract
Major histocompatibility complex (MHC) is the best characterized genetic region controlling disease resistance and immune responses in chicken. MHC genes are also involved in various non-immune functions such as productive traits and reproductive success. The genetic diversity of MHC in an Iranian indigenous chicken (Khorasan) was studied, and association of the MHC alleles with production traits was determined. The MHC polymorphism was ascertained by genotyping the LEI0258 microsatellite locus by PCR-based fragment analysis. LEI0258 microsatellite marker is a genetic indicator for MHC, which is located on microchromosome 16 and strongly associated with serologically defined MHC haplotypes. A total of 25 different LEI0258 alleles (185-493 bp) and 76 genotypes were identified in 313 chickens. An allele of 361 bp had the highest frequency (26.44 %), and alleles of 207 and 262 bp had the lowest (0.16 %). High level of heterozygosity (87 %) and good genotype frequency fit to the Hardy-Weinberg equilibrium was observed in this population ( P = 0.238). The association study also revealed a significant influence of MHC alleles on body weight, egg weight, egg laying intensity, and weight of sexual maturity in Khorasan population ( P < 0.05). The information obtained from this study indicates a high MHC genetic diversity and the association of MHC alleles with important production traits in Khorasan chicken. These data would be applicable in designing breeding and genetic resource conservation for indigenous chicken populations. [ABSTRACT FROM AUTHOR]
- Published
- 2015
- Full Text
- View/download PDF
14. Hematopoiesis in the equine fetal liver suggests immune preparedness.
- Author
-
Battista, J., Tallmadge, R., Stokol, T., and Felippe, M.
- Subjects
HEMATOPOIESIS ,ANTIBODY diversity ,IMMUNE response ,B cells ,HORSES ,ANIMAL young ,MESSENGER RNA - Abstract
We investigated how the equine fetus prepares its pre-immune humoral repertoire for an imminent exposure to pathogens in the neonatal period, particularly how the primary hematopoietic organs are equipped to support B cell hematopoiesis and immunoglobulin (Ig) diversity. We demonstrated that the liver and the bone marrow at approximately 100 days of gestation (DG) are active sites of hematopoiesis based on the expression of signature messenger RNA (mRNA) (c-KIT, CD34, IL7R, CXCL12, IRF8, PU.1, PAX5, NOTCH1, GATA1, CEBPA) and protein markers (CD34, CD19, IgM, CD3, CD4, CD5, CD8, CD11b, CD172A) of hematopoietic development and leukocyte differentiation molecules, respectively. To verify Ig diversity achieved during the production of B cells, V(D)J segments were sequenced in primary lymphoid organs of the equine fetus and adult horse, revealing that similar heavy chain VDJ segments and CDR3 lengths were most frequently used independent of life stage. In contrast, different lambda light chain segments were predominant in equine fetal compared to adult stage, and surprisingly, the fetus had less restricted use of variable gene segments to construct the lambda chain. Fetal Igs also contained elements of sequence diversity, albeit to a smaller degree than that of the adult horse. Our data suggest that the B cells produced in the liver and bone marrow of the equine fetus generate a wide repertoire of pre-immune Igs for protection, and the more diverse use of different lambda variable gene segments in fetal life may provide the neonate an opportunity to respond to a wider range of antigens at birth. [ABSTRACT FROM AUTHOR]
- Published
- 2014
- Full Text
- View/download PDF
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.