Search

Single-stranded noncoding regulatory RNAs, as exemplified by bacterial riboswitches, are highly dynamic. The conformational dynamics allow the riboswitch to reach maximum switching efficiency under appropriate conditions. Here we characterize the conformational dynamics of preQ1 riboswitches from mesophilic and thermophilic bacterial species at various temperatures. With the integrative use of small-angle X-ray scattering, NMR, and molecular dynamics simulations, we model the ensemble-structures of the preQ1 riboswitch aptamers without or with a ligand bound. We show that the preQ1 riboswitch is sufficiently dynamic and fluctuating among multiple folding intermediates only near the physiological temperature of the microorganism. The hierarchical folding dynamics of the RNA involves the docking of 3'-tail to form a second RNA helix and the helical stacking to form an H-type pseudoknot structure. Further, we show that RNA secondary and tertiary dynamics can be modulated by temperature and by the length of an internal loop. The coupled equilibria between RNA folding intermediates are essential for preQ1 binding, and a four-state exchange model can account for the change of ligand-triggered switching efficiency with temperature. Together, we have established a relationship between the hierarchical dynamics and riboswitch function, and illustrated how the RNA adapts to high temperature.

Because of the potential link between -1 programmed ribosomal frameshifting and response of a pseudoknot (PK) RNA to force, a number of single molecule pulling experiments have been performed on PKs to decipher the mechanism of programmed ribosomal frameshifting. Motivated in part by these experiments, we performed simulations using a coarse-grained model of RNA to describe the response of a PK over a range of mechanical forces ($f$s) and monovalent salt concentrations ($C$s). The coarse-grained simulations quantitatively reproduce the multistep thermal melting observed in experiments, thus validating our model. The free energy changes obtained in simulations are in excellent agreement with experiments. By varying $f$ and $C$, we calculated the phase diagram that shows a sequence of structural transitions, populating distinct intermediate states. As $f$ and $C$ are changed, the stem-loop tertiary interactions rupture first, followed by unfolding of the $3^{\prime}$-end hairpin ($\textrm{I}\rightleftharpoons\textrm{F}$). Finally, the $5^{\prime}$-end hairpin unravels, producing an extended state ($\textrm{E}\rightleftharpoons\textrm{I}$). A theoretical analysis of the phase boundaries shows that the critical force for rupture scales as $\left(\log C_{\textrm{m}}\right)^{\alpha}$ with $\alpha=1\,(0.5)$ for $\textrm{E}\rightleftharpoons\textrm{I}$ ($\textrm{I}\rightleftharpoons\textrm{F}$) transition. This relation is used to obtain the preferential ion-RNA interaction coefficient, which can be quantitatively measured in single-molecule experiments, as done previously for DNA hairpins. A by-product of our work is the suggestion that the frameshift efficiency is likely determined by the stability of the $5^{\prime}$-end hairpin that the ribosome first encounters during translation., Comment: Final draft accepted in Journal of Molecular Biology, 16 pages including Supporting Information

Pseudoknot formation in the core region of the telomerase RNA has been demonstrated to be important for telomerase activity in vertebrates, ciliates, and yeast. Characterization of the Saccharomyces cerevisiae telomerase RNA (TLC1) pseudoknot identified tertiary structural interactions that are also important for telomerase activity, as previously observed for the Kluyveromyces lactis and human telomerase RNA pseudoknots. In addition, the contributions of backbone ribose 2'-OH groups in the pseudoknot to telomerase catalysis were investigated previously, using 2'-OH (ribose) to 2'-H (deoxyribose) or 2'-O-methyl substitutions in the stem 2 helix, and it was proposed that one or more 2'-OH groups from the stem 2 sequences at or near the triple helix participate in telomerase catalysis. Based on these studies and investigations of the structural and thermodynamic properties of the TLC1 RNA pseudoknot region, we have examined the structural and thermodynamic perturbations of the 2'-O-methyl and 2'-H substituted pseudoknots, using UV-monitored thermal denaturation, native gel electrophoresis, and circular dichroism spectroscopy. Our results demonstrate the presence of A-form helical geometry perturbations in the backbone sugar substituted pseudoknots, show a correlation between thermodynamic stability and telomerase activity, and are consistent with the identification of the U809 ribose 2'-OH as a potential contributor to telomerase activity.

Turnip yellow mosaic virus (TYMV) contains a tRNA-like structure (TLS) in its 3′ untranslated region (3′ UTR). This highly structured element induces valylation of the viral RNA by host cell enzymes and is important for virus proliferation. Directly upstream of the TYMV TLS is an upstream pseudoknot domain (UPD) that has been considered to be structurally distinct from the TLS. However, using a combination of functional, biochemical, and biophysical assays, we show that the entire 3′ UTR of the viral genome is a single structured element in the absence of cellular protein. This packing architecture stabilizes the RNA structure and creates a better substrate for aminoacylation, and thus the UPD and TLS are functionally and structurally coupled. It has been proposed that the TYMV TLS acts as a molecular switch between translation and replication. Our results suggest that this putative switch could be based on structural changes within the global architecture of the UTR induced by interactions with the ribosome. The TYMV TLS·UPD might demonstrate how RNA structural plasticity can play a role in regulation of biological processes.

Telomerase is a ribonucleoprotein complex that replicates the 3’ ends of linear chromosomes by successive additions of telomere repeat DNA. The telomerase holoenzyme contains two essential components for catalysis, a telomerase reverse transcriptase (TERT) and telomerase RNA (TER). The TER includes a template for telomere repeat synthesis as well as other domains required for function. We report the solution structure of the wild type minimal conserved human TER pseudoknot (PKWT) refined with an extensive set of RDCs, and a detailed analysis of the effect of the bulge U177 on pseudoknot structure, dynamics analyzed by RDC and 13C relaxation measurements, and base pair stability. The overall structure of PKWT is highly similar to the previously reported ΔU177 pseudoknot (PKDU) that has a deletion of a conserved bulge U important for catalytic activity. For direct comparison to PKWT, the structure of PKDU was re-refined with a comparable set of RDCs. Both pseudoknots contain a catalytically essential triple helix at the junction of the two stems, including two stem 1-loop 2 minor groove triples, a junction loop 1-loop 2 Hoogsteen base pair, and stem 2-loop 1 major groove U•A-U Watson-Crick-Hoogsteen triples located directly above the bulge U177. However there are significant differences in stabilities of base pairs near the bulge and the dynamics of some nucleotides. The stability of the base pairs in stem 2 surrounding the bulge U177 is greatly decreased, with the result that the Watson-Crick pairs in the triple helix begin to unfold before the Hoogsteen pairs, which may affect telomerase assembly and activity. The bulge U is positioned in the minor groove on the opposite face from the triple helical interactions, and sterically blocks the A176 2’OH which has recently been proposed to play a role in catalysis. The bulge U may serve as a hinge to provide backbone flexibility in this region.

Simian Immunodeficiency Virus (SIV), like its human homologues (HIV-1, HIV-2), requires a −1 translational frameshift event to properly synthesize all of the proteins required for viral replication. The frameshift mechanism is dependent upon a seven nucleotide slippery sequence and a downstream RNA structure. In SIV, the downstream RNA structure has been proposed to be either a stem-loop or a pseudoknot. Here, we report the functional, structural and thermodynamic characterization of the SIV frameshift site RNA. Translational frameshift assays indicate that a stem-loop structure is sufficient to promote efficient frameshifting in vitro. NMR and thermodynamic studies of SIV RNA constructs of varying length further support the absence of any pseudoknot interaction and indicate the presence of a stable stem-loop structure. We determined the structure of the SIV frameshift-inducing RNA by NMR. The structure reveals a highly ordered 12 nucleotide loop containing a sheared G-A pair, cross-strand adenine stacking, two G-C base-pairs, and a novel CCC triloop turn. The loop structure and its high thermostability preclude pseudoknot formation. Sequence conservation and modeling studies suggest that HIV-2 RNA forms the same structure. We conclude that, like the main sub-groups of HIV-1, SIV and HIV-2 utilize stable stem-loop structures to function as a thermodynamic barrier to translation, thereby inducing ribosomal pausing and frameshifting.

The hepatitis delta virus (HDV) ribozyme is a self-cleaving RNA that resides in the HDV genome and regulates its replication. The native fold of the ribozyme is complex, having two pseudoknots. Earlier work implicated four non-native pairings in slowing pseudoknot formation: Alt 1, Alt 2, Alt 3, and Alt P1. The goal of the present work was design of a kinetically simplified and maximally reactive construct for in vitro mechanistic and structural studies. The initial approach chosen was site-directed mutagenesis in which known alternative pairings were destabilized while leaving the catalytic core intact. Based on prior studies, the G11C/U27Delta double mutant was prepared. However, biphasic kinetics and antisense oligonucleotide response trends opposite those of the well-studied G11C mutant were observed suggesting that new alternative pairings with multiple registers, termed Alt X and Alt Y, had been created. Enzymatic structure mapping of oligonucleotide models supported this notion. This led to a model wherein Alt 2 and the phylogenetically conserved Alt 3 act as "folding guides", facilitating folding of the major population of the RNA molecules by hindering formation of the Alt X and Alt Y registers. Attempts to eliminate the strongest of the Alt X pairings by rational design of a quadruple mutant only resulted in more complex kinetic behavior. In an effort to simultaneously destabilize multiple alternative pairings, studies were carried out on G11C/U27Delta in the presence of urea or increased monovalent ion concentration. Inclusion of physiological ionic strength allowed the goal of monophasic, fast-folding (kobs approximately 60 min(-1)) kinetics to be realized. To account for this, a model is developed wherein Na+, which destabilizes secondary and tertiary structures in the presence of Mg2+, facilitates native folding by destabilizing the multiple alternative secondary structures with a higher-order dependence.

The expression of eukaryotic antizyme genes requires +1 translational frameshifting. The frameshift in decoding most vertebrate antizyme mRNAs is stimulated by an RNA pseudoknot 3' of the frameshift site. Although the frameshifting event itself is conserved in a wide variety of organisms from yeast to mammals, until recently no corresponding 3' RNA pseudoknot was known in invertebrate antizyme mRNAs. A pseudoknot, different in structure and origin from its vertebrate counterparts, is now shown to be encoded by the antizyme genes of distantly related invertebrates. Identification of the 3' frameshifting stimulator in intermediate species or other invertebrates remains unresolved.

Human immunodeficiency virus type 1 (HIV-1) requires a programmed −1 ribosomal frameshift to produce Gag–Pol, the precursor of its enzymatic activities. This frameshift occurs at a slippery sequence on the viral messenger RNA and is stimulated by a specific structure, downstream of the shift site. While in group M, the most abundant HIV-1 group, the frameshift stimulatory signal is an extended bulged stem-loop, we show here, using a combination of mutagenesis and probing studies, that it is a pseudoknot in group O. The mutagenesis and probing studies coupled to an in silico analysis show that group O pseudoknot is a hairpin-type pseudoknot with two coaxially stacked stems of eight base-pairs (stem 1 and stem 2), connected by single-stranded loops of 2 nt (loop 1) and 20 nt (loop 2). Mutations impairing formation of stem 1 or stem 2 of the pseudoknot reduce frameshift efficiency, whereas compensatory changes that allow re-formation of these stems restore the frameshift efficiency to near wild-type level. The difference between the frameshift stimulatory signal of group O and group M supports the hypothesis that these groups originate from a different monkey to human transmission.

A hairpin-type messenger RNA pseudoknot from pea enation mosaic virus RNA1 (PEMV-1) regulates the efficiency of programmed -1 ribosomal frameshifting. The solution structure and 15N relaxation rates reveal that the PEMV-1 pseudoknot is a compact-folded structure composed almost entirely of RNA triple helix. A three nucleotide reverse turn in loop 1 positions a protonated cytidine, C(10), in the correct orientation to form an A((n-1)).C(+).G-C(n) major groove base quadruple, like that found in the beet western yellows virus pseudoknot and the hepatitis delta virus ribozyme, despite distinct structural contexts. A novel loop 2-loop 1 A.U Hoogsteen base-pair stacks on the C(10)(+).G(28) base-pair of the A(12).C(10)(+).G(28)-C(13) quadruple and forms a wedge between the pseudoknot stems stabilizing a bent and over-rotated global conformation. Substitution of key nucleotides that stabilize the unique conformation of the PEMV-1 pseudoknot greatly reduces ribosomal frameshifting efficacy.

RNA pseudoknots play important roles in many biological processes. In the simian retrovirus type-1 (SRV-1) a pseudoknot together with a heptanucleotide slippery sequence are responsible for programmed ribosomal frameshifting, a translational recoding mechanism used to control expression of the Gag-Pol polyprotein from overlapping gag and pol open reading frames. Here we present the three-dimensional structure of the SRV-1 pseudoknot determined by NMR. The structure has a classical H-type fold and forms a triple helix by interactions between loop 2 and the minor groove of stem 1 involving base-base and base-sugar interactions and a ribose zipper motif, not identified in pseudoknots so far. Further stabilization is provided by a stack of five adenine bases and a uracil in loop 2, enforcing a cytidine to bulge. The two stems of the pseudoknot stack upon each other, demonstrating that a pseudoknot without an intercalated base at the junction can induce efficient frameshifting. Results of mutagenesis data are explained in context with the present three-dimensional structure. The two base-pairs at the junction of stem 1 and 2 have a helical twist of approximately 49 degrees, allowing proper alignment and close approach of the three different strands at the junction. In addition to the overwound junction the structure is somewhat kinked between stem 1 and 2, assisting the single adenosine in spanning the major groove of stem 2. Geometrical models are presented that reveal the importance of the magnitude of the helical twist at the junction in determining the overall architecture of classical pseudoknots, in particular related to the opening of the minor groove of stem 1 and the orientation of stem 2, which determines the number of loop 1 nucleotides that span its major groove.

Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They provide insights into the roles of the other non-Watson-Crick base-pairs in the early stages of unfolding of the pseudoknot, which must occur to allow readthrough of the message by the ribosome. The simulations revealed several critical, highly ordered hydration sites with close to 100 % occupancies and residency times of individual water molecules of up to 5 ns. Sodium cation coordination sites with occupancies above 50 % were also observed.

RNA pseudoknots play important roles in many biological processes. In the simian retrovirus type-1 (SRV-1) a pseudoknot together with a heptanucleotide slippery sequence are responsible for programmed ribosomal frameshifting, a translational recoding mechanism used to control expression of the Gag-Pol polyprotein from overlapping gag and pol open reading frames. Here we present the three-dimensional structure of the SRV-1 pseudoknot determined by NMR. The structure has a classical H-type fold and forms a triple helix by interactions between loop 2 and the minor groove of stem 1 involving base-base and base-sugar interactions and a ribose zipper motif, not identified in pseudoknots so far. Further stabilization is provided by a stack of five adenine bases and a uracil in loop 2, enforcing a cytidine to bulge. The two stems of the pseudoknot stack upon each other, demonstrating that a pseudoknot without an intercalated base at the junction can induce efficient frameshifting. Results of mutagenesis data are explained in context with the present three-dimensional structure. The two base-pairs at the junction of stem 1 and 2 have a helical twist of approximately 49 degrees, allowing proper alignment and close approach of the three different strands at the junction. In addition to the overwound junction the structure is somewhat kinked between stem 1 and 2, assisting the single adenosine in spanning the major groove of stem 2. Geometrical models are presented that reveal the importance of the magnitude of the helical twist at the junction in determining the overall architecture of classical pseudoknots, in particular related to the opening of the minor groove of stem 1 and the orientation of stem 2, which determines the number of loop 1 nucleotides that span its major groove.

We have derived a secondary structure model for the c- myc internal ribosome entry segment (IRES) by using information from chemical probing of the c- myc IRES RNA to constrain structure prediction programs. Our data suggest that the IRES is modular in nature, and can be divided into two structural domains linked by a long unstructured region. Both domains are required for full IRES function. Domain 1 is a complex element that contains a GNNRA apical loop and an overlapping double pseudoknot motif that is topologically unique amongst published RNA structures. Domain 2, the smaller of the two, contains an apical AUUU loop. We have located the ribosome landing site and have shown that ribosomes enter in a 16 nt region downstream of the pseudoknots in a situation similar to that observed in several viral IRESs. To test the structure, several key regions of the IRES were mutated and, interestingly, it appears that some of the structural elements that we have identified function to repress c- myc IRES function. This has profound implications for de-regulation of c- myc expression by mutations occurring in the IRES.

X-ray crystallographic studies of human immunodeficiency virus type 1 reverse transcriptase complexed with or without substrates or inhibitors show that the heterodimeric enzyme adopts distinct conformations that differ in the orientation of the so-called thumb subdomain in the large subunit. Site-directed spin labelling of mutated residue positions W24C and K287C is applied here to determine the distances between the fingers and thumb subdomains of liganded and unliganded RT in solution. The inter-spin distances of a DNA/DNA and a pseudoknot RNA complexed reverse transcriptase in solution was found to agree with the respective crystal data of the open and closed conformations. For the unliganded reverse transcriptase a temperature-dependent equilibrium between these two states was observed. The fraction of the closed conformation decreased from 95% at 313 K to 65% at 273 K. The spectral separation between the two structures was facilitated by the use of a perdeuterated ([15)N]nitroxide methane-thiosulfonate spin label.

Retroviruses employ -1 translational frameshifting to regulate the relative concentrations of structural and non-structural proteins critical to the viral life cycle. The 1.6 A crystal structure of the -1 frameshifting pseudoknot from beet western yellows virus reveals, in addition to Watson-Crick base-pairing, many loop-stem RNA tertiary structural interactions and a bound Na(+). Investigation of the thermodynamics of unfolding of the beet western yellows virus pseudoknot reveals strongly pH-dependent loop-stem tertiary structural interactions which stabilize the molecule, contributing a net of DeltaH approximately -30 kcal mol(-1) and DeltaG degrees (37) of -3.3 kcal mol(-1) to a total DeltaH and DeltaG degrees (37) of -121 and -16 kcal mol(-1), respectively, at pH 6.0, 0.5 M K(+) by DSC. Characterization of mutant RNAs supports the presence of a C8(+).G12-C26 loop 1-stem 2 base-triple (pK(a)=6.8), protonation of which contributes nearly -3.5 kcal mol(-1) in net stability in the presence of a wild-type loop 2. Substitution of the nucleotides in loop 2 with uridine bases, which would eliminate the minor groove triplex, destroys pseudoknot formation. An examination of the dependence of the monovalent ion and type on melting profiles suggests that tertiary structure unfolding occurs in a manner quantitatively consistent with previous studies on the stabilizing effects of K(+), NH(4)(+) and Na(+) on other simple duplex and pseudoknotted RNAs.

The protein subunit of Escherichia coli ribonuclease P (which has a cysteine residue at position 113) and its single cysteine-substituted mutant derivatives (S16C/C113S, K54C/C113S and K66C/C113S) have been modified using a sulfhydryl-specific iron complex of EDTA-2- aminoethyl 2-pyridyl disulfide (EPD-Fe). This reaction converts C5 protein, or its single cysteine-substituted mutant derivatives, into chemical nucleases which are capable of cleaving the cognate RNA ligand, M1 RNA, the catalytic RNA subunit of E. coli RNase P, in the presence of ascorbate and hydrogen peroxide. Cleavages in M1 RNA are expected to occur at positions proximal to the site of contact between the modified residue (in C5 protein) and the ribose units in M1 RNA. When EPD-Fe was used to modify residue Cys16 in C5 protein, hydroxyl radical-mediated cleavages occurred predominantly in the P3 helix of M1 RNA present in the reconstituted holoenzyme. C5 Cys54-EDTA-Fe produced cleavages on the 5' strand of the P4 pseudoknot of M1 RNA, while the cleavages promoted by C5 Cys66-EDTA-Fe were in the loop connecting helices P18 and P2 (J18/2) and the loop (J2/4) preceding the 3' strand of the P4 pseudoknot. However, hydroxyl radical-mediated cleavages in M1 RNA were not evident with Cys113-EDTA-Fe, perhaps indicative of Cys113 being distal from the RNA-protein interface in the RNase P holoenzyme. Our directed hydroxyl radical-mediated footprinting experiments indicate that conserved residues in the RNA and protein subunit of the RNase-P holoenzyme are adjacent to each other and provide structural information essential for understanding the assembly of RNase P.

The 110 nt hammerhead ribozyme in the satellite RNA of cereal yellow dwarf virus-RPV (satRPV RNA) folds into an alternative conformation that inhibits self-cleavage. This alternative structure comprises a pseudoknot with base-pairing between loop (L1) and a single-stranded bulge (L2a), which are located in hammerhead stems I and II, respectively. Mutations that disrupt this base-pairing, or otherwise cause the ribozyme to more closely resemble a canonical hammerhead, greatly increase self-cleavage. In a more natural multimeric sequence context containing the full-length satRPV RNA and two copies of the hammerhead, wild-type RNA cleaves much more efficiently than in the 110 nt context. Mutations in the upstream hammerhead, including a knock-out in the catalytic core, affect cleavage at the downstream cleavage site, indicating that multimers of satRPV RNA cleave via a double hammerhead. The double hammerhead includes base-pairing between two copies of the L1 sequence which extends stem I. Disruption of L1-L1 base-pairing slows cleavage of the multimer. L1-L2a base-pairing is required for efficient replication of satRPV RNA in oat protoplasts. Mutations that affect self-cleavage of the multimer do not correlate with replication efficiency, indicating that the ability to self-cleave is not a primary determinant of replication. We present a replication model in which multimeric satRPV RNA folds into alternative conformations that cannot form in the monomer. One potential metastable intermediate conformation involves L1-L2a base-pairing that may facilitate formation of the double hammerhead. However, we conclude that L1-L2a also performs some other essential function in the satRPV RNA replication cycle, because the L1-L2a base-pairing is more important than efficient self-cleavage for replication.

Prokaryotic protein S4 initiates assembly of the small ribosomal subunit by binding to 16 S rRNA. Residues 43-200 of S4 from Bacillus stearothermophilus (S4 Delta41) bind to both 16 S rRNA and to a mRNA pseudoknot. In order to obtain structure-based insights regarding RNA binding, we previously determined the solution structure of S4 Delta41 using NOE, hydrogen bond, and torsion angle restraints. S4 Delta41 is elongated, with two distinct subdomains, one all helical, the other including a beta-sheet. In contrast to the high resolution structures obtained for each individual subdomain, their relative orientation was not precisely defined because only 17 intersubdomain NOE restraints were determined. Compared to the 1.7 A crystal structure, when the sheet-containing subdomains are superimposed, the helical subdomain is twisted by almost 45 degrees about the long axis of the molecule in the solution structure. Because variations in subdomain orientation may explain how the protein recognizes multiple RNA targets, our current goal is to determine the orientation of the subdomains in solution with high precision. To this end, NOE assignments were re-examined. NOESY experiments on a specifically labeled sample revealed that one of the intersubdomain restraints had been misassigned. However, the revised set of NOE restraints produces solution structures that still have imprecisely defined subdomain orientations and that lie between the original NMR structure and the crystal structure. In contrast, augmenting the NOE restraints with N-H dipolar couplings, measured in uniaxial liquid crystalline phases, clearly establishes the relative orientation of the subdomains. Data obtained from two independent liquid crystalline milieux, DMPC/DHPC bicelles and the filamentous bacteriophage Pf1, show that the relative orientation of the subdomains in solution is quite similar to the subdomain orientation in the crystal structure. The solution structure, refined with dipolar data, is presented and its implications for S4's RNA binding activity are discussed.

The equilibrium unfolding pathway of a 41-nucleotide frameshifting RNA pseudoknot from the gag-pro junction of mouse intracisternal A-type particles (mIAP), an endogenous retrovirus, has been determined through analysis of dual optical wavelength, equilibrium thermal melting profiles and differential scanning calorimetry. The mIAP pseudoknot is an H-type pseudoknot proposed to have structural features in common with the gag-pro frameshifting pseudoknots from simian retrovirus-1 (SRV-1) and mouse mammary tumor virus (MMTV). In particular, the mIAP pseudoknot is proposed to contain an unpaired adenosine base at the junction of the two helical stems (A15), as well as one in the middle of stem 2 (A35). A mutational analysis of stem 1 hairpins and compensatory base-pair substitutions incorporated into helical stem 2 was used to assign optical melting transitions to molecular unfolding events. The optical melting profile of the wild-type RNA is most simply described by four sequential two-state unfolding transitions. Stem 2 melts first in two closely coupled low-enthalpy transitions at low t m in which the stem 3′ to A35, unfolds first, followed by unfolding of the remainder of the helical stem. The third unfolding transition is associated with some type of stacking interactions in the stem 1 hairpin loop not present in the pseudoknot. The fourth transition is assigned to unfolding of stem 1. In all RNAs nvestigated, Δ H vH ≈Δ H cal , suggesting that Δ C p for unfolding is small. A35 has the thermodynamic properties expected for an extrahelical, unpaired nucleotide. Deletion of A15 destabilizes the stem 2 unfolding transition in the context of both the wild-type and ΔA35 mutant RNAs only slightly, by ΔΔ G °≈1 kcal mol −1 (at 37 °C). The ΔA15 RNA is considerably more susceptible to thermal denaturation in the presence of moderate urea concentrations than is the wild-type RNA, further evidence of a detectable global destabilization of the molecule. Interestingly, substitution of the nine loop 2 nucleotides with uridine residues induces a more pronounced destabilization of the molecule (ΔΔ G °≈2.0 kcal mol −1 ), a long-range, non-nearest neighbor effect. These findings provide the thermodynamic basis with which to further refine the relationship between efficient ribosomal frameshifting and pseudoknot structure and stability.

Identification and characterization of a metal ion binding site in an RNA pseudoknot was accomplished using cobalt (III) hexammine, Co(NH3)63+, as a probe for magnesium (II) hexahydrate, Mg(H2O)62+, in nuclear magnetic resonance (NMR) structural studies. The pseudoknot causes efficient -1 ribosomal frameshifting in mouse mammary tumor virus. Divalent metal ions, such as Mg2+, are critical for RNA structure and function; Mg2+preferentially stabilizes the pseudoknot relative to its constituent hairpins. The use of Co(NH3)63+as a substitute for Mg2+was investigated by ultraviolet absorbance melting curves, NMR titrations of the imino protons, and analysis of NMR spectra in the presence of Mg2+or Co (NH3)63+. The structure of the pseudoknot-Co(NH3)63+complex reveals an ion-binding pocket formed by a short, two-nucleotide loop and the major groove of a stem. Co(NH3)63+stabilizes the sharp loop-to-stem turn and reduces the electrostatic repulsion of the phosphates in three proximal strands. Hydrogen bonds are identified between the Co(NH3)63+protons and non-bridging phosphate oxygen atoms, 2' hydroxyl groups, and nitrogen and oxygen acceptors on the bases. The binding site is significantly different from that previously characterized in the major groove surface of tandem G.U base-pairs, but is similar to those observed in crystal structures of a fragment of the 5 S rRNA and the P5c helix of the Tetrahymena thermophila group I intron. Changes in chemical shifts occurred at the same pseudoknot protons on addition of Mg2+as on addition of Co(NH3)63+, indicating that both ions bind at the same site. Ion binding dissociation constants of approximately 0.6 mM and 5 mM (in 200 mM Na+and a temperature of 15 degrees C) were obtained for Co(NH3)63+and Mg2+, respectively, from the change in chemical shift as a function of metal ion concentration. An extensive array of non-sequence-specific hydrogen bond acceptors coupled with conserved structural elements within the binding pocket suggest a general mode of divalent metal ion stabilization of this type of frameshifter pseudoknot. These results provide new thermodynamic and structural insights into the role divalent metal ions play in stabilizing RNA tertiary structural motifs such as pseudoknots.

The ribosomal frameshifting signal present in the genomic RNA of the coronavirus infectious bronchitis virus (IBV) contains a classic hairpin-type RNA pseudoknot that is believed to possess coaxially stacked stems of 11 bp (stem 1) and 6 bp (stem 2). We investigated the influence of stem 1 length on the frameshift process by measuring the frameshift efficiency in vitro of a series of IBV-based pseudoknots whose stem 1 length was varied from 4 to 13 bp in single base-pair increments. Efficient frameshifting depended upon the presence of a minimum of 11 bp; pseudoknots with a shorter stem 1 were either non-functional or had reduced frameshift efficiency, despite the fact that a number of them had a stem 1 with a predicted stability equal to or greater than that of the wild-type IBV pseudoknot. An upper limit for stem 1 length was not determined, but pseudoknots containing a 12 or 13 bp stem 1 were fully functional. Structure probing analysis was carried out on RNAs containing either a ten or 11 bp stem 1; these experiments confirmed that both RNAs formed pseudoknots and appeared to be indistinguishable in conformation. Thus the difference in frameshifting efficiency seen with the two structures was not simply due to an inability of the 10 bp stem 1 construct to fold into a pseudoknot. In an attempt to identify other parameters which could account for the poor functionality of the shorter stem 1-containing pseudoknots, we investigated, in the context of the 10 bp stem 1 construct, the influence on frameshifting of altering the slippery sequence-pseudoknot spacing distance, loop 2 length, and the number of G residues at the bottom of the 5'-arm of stem 1. For each parameter, it was possible to find a condition where a modest stimulation of frameshifting was observable (about twofold, from seven to a maximal 17 %), but we were unable to find a situation where frameshifting approached the levels seen with 11 bp stem 1 constructs (48-57 %). Furthermore, in the next smaller construct (9 bp stem 1), changing the bottom four base-pairs to G.C (the optimal base composition) only stimulated frameshifting from 3 to 6 %, an efficiency about tenfold lower than seen with the 11 bp construct. Thus stem 1 length is a major factor in determining the functionality of this class of pseudoknot and this has implications for models of the frameshift process.

The secondary structure of a 170 nt transcript derived from a cDNA clone containing the 3′ untranslated region of bamboo mosaic potexvirus (BaMV) with 32 adenine residues of the poly(A) tail, was investigated in solution by using enzymatic and chemical probes. Three consecutive stem-loops forming a cloverleaf-like structure (domain ABC) and a major stem-loop (domain D) containing a bulge and an internal loop were identified as connected to a previously identified pseudoknot domain (domain E) comprising at least 13 adenylate residues of the 3′ poly(A) tail. The highly conserved hexamer nucleotides (ACc/uUAA) among potexviruses are located in loop D and the putative polyadenylation signal (AAUAAA) is located in the internal loop of domain D. Based on the data of the structural probing, a three-dimensional structure was modeled. Mutants with domain ABC deleted showed no detectable signal in protoplasts, while changes in domain D, except for the bulge deletion, showed interference of BaMV RNA accumulation in protoplasts. Mutants with disrupted stem D formation impaired BaMV accumulation. However, the mutant with compensatory mutations restored stem formation which could only improve the viral accumulation to 58 % that of the wild-type structure.

RNA pseudoknots are structural elements that participate in a variety of biological processes. At −1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G·C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3′-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2.

We describe a dynamic programming algorithm for predicting optimal RNA secondary structure, including pseudoknots. The algorithm has a worst case complexity of O(N6) in time and O(N4) in storage. The description of the algorithm is complex, which led us to adopt a useful graphical representation (Feynman diagrams) borrowed from quantum field theory. We present an implementation of the algorithm that generates the optimal minimum energy structure for a single RNA sequence, using standard RNA folding thermodynamic parameters augmented by a few parameters describing the thermodynamic stability of pseudoknots. We demonstrate the properties of the algorithm by using it to predict structures for several small pseudoknotted and non-pseudoknotted RNAs. Although the time and memory demands of the algorithm are steep, we believe this is the first algorithm to be able to fold optimal (minimum energy) pseudoknotted RNAs with the accepted RNA thermodynamic model.

A complex pseudoknot structure surrounds the first ribosome initiation site in the Escherichia coli alpha mRNA and mediates its regulation by ribosomal protein S4. A 112 nt RNA fragment containing this pseudoknot exists in two conformations that are resolvable by gel electrophoresis below room temperature. Between 30 degrees C and 45 degrees C the conformers reach thermodynamic equilibrium on a time scale ranging from one hour to one minute, and the interconversion between conformers is linked to H+, K+ and Mg2+ concentrations. Mg2+ favors formation of the "fast" electrophoretic form: a single Mg2+ is bound in the rate-limiting step, followed by cooperative binding of approximately 1.7 additional ions. Binding of the latter ions provides most of the favorable free energy for the reaction. However, the "slow" form binds about the same number of Mg ions, albeit more weakly, so that saturating Mg2+ concentrations drive the equilibrium to only approximatley 70% fast form. A single H+ is taken up in the switch to the "slow" conformer, which has apparent pK approximately 5.9; low pH also stabilizes part of the pseudoknot structure melting at approximately 62 degrees C. Mg2+ and H+ appear to direct alpha mRNA folding by relatively small (10 to 100-fold) differences in their affinities for alternative conformers. K+ has very little effect on the conformational equilibrium, but at high concentrations accelerates interconversion between the conformers. The alpha mRNA conformational switch is similar in its slow kinetics, large activation energy, and Mg2+ dependence of the equilibrium constant to slow steps in the folding of tRNA, group I introns, and RNase P RNA tertiary structures, though it differs from these in the association of a single Mg2+ with the rate-limiting step.

Frameshift and readthrough sites within retroviral messenger RNAs are often followed by nucleotide sequences that have the potential to form pseudoknot structures. In the work presented here, NMR methods were used to characterize the base-pairings and structural features of the RNA pseudoknot downstream of the gag-pro frameshift site of simian retrovirus type-1 (SRV-1) and a functional mutant of the SRV-1 pseudoknot. Evidence is presented that these pseudoknots contain two A-form helical stems of six base-pairs each, connected by two loops, in a classic H-type pseudoknot topology. A particularly interesting feature is that the shorter of the two connecting loops, loop 1, consists of only a single adenosine nucleotide that spans the major groove of stem 2. In this respect, the frameshift-associated pseudoknots are structurally similar to the pseudoknot within the gene 32 mRNA of bacteriophage T2, previously characterized by NMR methods. Despite having similar nucleotide sequences, the solvent exchange rates of the imino protons at the junction of the helical stems in the wild-type and mutant frameshifting pseudoknots differ from each other and from the bacteriophage T2 pseudoknot. The implications of this finding are discussed.

The reverse transcriptase (RT) of the human immunodeficiency virus (HIV) is a proven target for therapeutic intervention of HIV infections. We have found several new RNA inhibitors of HIV-1 RT that differ significantly from the pseudoknot ligands found previously, along with a wide variety of pseudoknot variants. One pseudoknot variant and three novel ligands were studied in more detail. Each specifically inhibits DNA polymerization by HIV RT (half-maximal inhibition at 0.3 to 20 nM inhibitor), but not that of RTs derived from MMLV or AMV. The minimal binding element of each isolate was determined by deletion analysis and by gel electrophoresis of protein-bound, partially alkaline-hydrolyzed RNA. Truncations of three of the isolates bound nearly as well as (or better than) the parental sequences, while most deletions in the fourth caused substantial disruption of binding. The truncated versions of two isolates were subjected to six rounds of secondary SELEX after resynthesizing them mutagenically. Patterns of conserved and covarying nucleotides yielded structural models consistent with 5′ and 3′ boundary determinations for these molecules. Among the four isolates studied in detail, the first is confirmed as being a pseudoknot, albeit with substantial structural differences as compared to the canonical pseudoknots identified previously. The second forms a stem-loop structure with additional flanking sequences required for binding. Tentative structural models for the other two isolates are presented. The minimal fully active truncations of each of these four isolates compete with each other and with a classical RNA pseudoknot for binding to HIV RT, suggesting that they all recognize the same or overlapping sites on the protein, in spite of their apparently dissimilar structures. We model their interactions with RT as mimicking the 40 to 45 degree bend in dsDNA co-crystallized with RT.

The structures of four different RNA pseudoknots that provide one of the signals required for ribosomal frameshifting in mouse mammary tumor virus have been determined by NMR. The RNA pseudoknots have similar sequences and assume similar secondary structures, but show significantly different frameshifting efficiencies. The three-dimensional structures of one frameshifting and one non-frameshifting RNA pseudoknot had been determined previously by our group. Here we determine the structures of two new RNA pseudoknots, and relate the structures of all four pseudoknots to their frameshifting abilities. The two efficient frameshifting pseudoknots adopt characteristic bent conformations with stem 1 bending towards the major groove of stem 2. In contrast, the two poor frameshifting pseudoknots have structures very different from each other and from the efficient frameshifters. One has linear, coaxially stacked stems, the other has stems twisted and bent, but in the opposite direction to the efficient frameshifters. Changes in loop size that favor bending (shorter loops) increase frameshifting efficiency; longer loops that allow linear arrangement of the stems decrease frameshifting. Frameshifting pseudoknots in feline immunodeficiency virus and simian retrovirus have different loop sequences, but the sequences at their stem junctions imply the same bent conformation as in the mouse mammary tumor viral RNA. The requirement for a precise pseudoknot conformation for efficient frameshifting strongly implies that a specific interaction occurs between the viral RNA pseudoknot and the host protein-synthesizing machinery.

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

The solution conformation of an RNA pseudoknot, which is a mutant of the pseudoknot required for ribosomal frameshifting in mouse mammary tumor virus, has been determined by NMR. The 32-nucleotide RNA pseudoknot does not promote efficient frameshifting, although its sequence is very similar to the efficient frameshifting pseudoknot whose structure was recently determined by our group. 13C-labeling of the RNA and 13C-edited NMR techniques were used to facilitate spectral assignment. The three-dimensional structure of the RNA pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distances and torsion angle constraints. The conformation is very different from that previously determined for the efficient-frameshifting pseudoknot. Two unpaired nucleotides are stacked between stem 1 and stem 2, in contrast to the one unpaired nucleotide at the same junction region as found previously. The two stems of the pseudoknot are not coaxial, they are twisted and bent relative to each other. Loop 2 does not cross the shallow minor groove of stem 1, in contrast to the pseudoknots with one or no intervening nucleotides between the stems. The fact that a specific conformation is required for efficient frameshifting implies a specific interaction of the pseudoknot with the ribosome.

Udgivelsesdato: 1995-May-26 The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either of these base-pairs is disrupted, and it is completely abolished upon disruption of both base-pairs. Each mutant 23 S rRNA is assembled into 50 S subunits, but the mutant subunits do not stably interact with 30 S to engage in protein synthesis. Enzymatic and chemical probing of ribosomal particles reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits and ribosomes, but is rendered unreactive when either the pseudoknot is broken or when the r-proteins are removed. The structure of the pseudoknot region is possibly influenced by interaction of an r-protein at or close to the pseudoknot. Re-establishing the pseudoknot Watson-Crick interactions with one "eukaryal" (1005G.1138C or 1006U.1137A) pair and one "bacterial" C.G pair largely restores the structure and function of the rRNA. Bacterial ribosomes containing both these eukaryal pairs also participate in protein synthesis, although at much reduced efficiency, and the structure of their pseudoknot region is partially open and accessible.

The conformation of the last 201 nucleotides located at the 3'-end of brome mosaic virus (BMV) RNAs was investigated in solution using different chemical and enzymatic probes. Bases were probed with dimethylsulfate (which methylates N-1 positions of A, N-3 positions of C and N-7 positions of G), a carbodiimide (which modifies N-1 positions of G and N-3 positions of U) and diethylpyrocarbonate (which modifies N-7 positions of A). Ribonucleases T1, U2 and S1 were used to map unpaired nucleotides and ribonuclease V1 to monitor paired bases or stacked nucleotides. Cleavage or modification sites were detected by gel electrophoresis either indirectly by analyzing DNA sequence patterns generated by primer extension with reverse transcriptase of the modified RNAs or by direct identification within the statistical cleavage patterns of the RNA. On the basis of these biochemical results, an atomic model was built by computer modeling and its stereochemistry refined. The deduced secondary structure of the RNA confirms data previously proposed by others but contains additional base-pairs (A27-U32, A28-G31, G41-A134, G64-C68, U80-A99, G81-A98, G88-U91, G100-U126, U104-U125, G162-G166 and A172-A191), one new tertiary long-range interaction (U103-U164) and a small triple helical conformation with (G41-A134)-A18 and (C42-G133)-A17 interactions. The new secondary structure also indicates the existence of a second pseudoknot involving pairing between residues A181 to A184 and residues U197 to U194, outside the domain conferring tyrosylation ability to BMV RNA. The main outcome from the model stems from its intricate folding, which allows a new assignment for the domains mimicking the anticodon- and D-loop regions of tRNA. Interestingly, the stem and loop region found structurally to be analogous to the anticodon arm of tRNA(Tyr) does not contain the tyrosine anticodon involved in the aminoacylation process. The structural analogies with canonical tRNA(Tyr) illustrate the functional mimicry existing between the BMV RNA structure and canonical tRNA(Tyr) that allows for their efficient aminoacylation by tyrosyl-tRNA synthetase. This structural model rationalizes mutagenic and footprinting data that have established the importance of specific regions of the viral RNA for recognition by its replicase, (ATP,CTP):tRNA nucleotidyl-transferase and yeast tyrosyl-tRNA synthetase. The new fold has biological implications that can be used as a predictive tool for elaborating new experiments.

The structure of untranslated regions of mRNA is thought to play a key role in the degradation of mRNAs by specific RNases. As a model system, in vitro transcripts of the stability determining 5' non-coding region of bacterial ompA mRNA were investigated by calculation of secondary structure models and by experiments applying the temperature-gradient gel electrophoresis (TGGE). For the theoretical prediction of secondary structures an algorithm was used, which yields the structure of lowest free energy as well as a large set of suboptimal structures. Three structures were predicted to co-exist in similar concentrations under native conditions. They denature in a low temperature transition leading to a unique structure which denatures in a high temperature transition. The prediction of three structures and two transitions could be confirmed experimentally by TGGE. Due to the use of transcripts of different length the conformational transitions could be attributed to distinct parts of the molecules. A pseudoknot structural motif was predicted theoretically, but could not be confirmed experimentally. Comparing ompA transcripts of E. coli and S. marcescens, a conservation of structural features could be shown in spite of a sequence homology of only 63%. Regarding the sequential folding of the transcript after synthesis, a metastable structure is formed first and is converted slowly into structures of lower free energy. The biological implications for in vivo degradation are discussed.

S-box (SAM-I) riboswitches are a widespread class of riboswitches involved in the regulation of sulfur metabolism in Gram-positive bacteria. We report here the 3.0-A crystal structure of the aptamer domain of the Bacillus subtilis yitJ S-box (SAM-I) riboswitch bound to S-adenosyl-L-methionine (SAM). The RNA folds into two sets of helical stacks spatially arranged by tertiary interactions including a K-turn and a pseudoknot at a four-way junction. The tertiary structure is further stabilized by metal coordination, extensive ribose zipper interactions, and SAM-mediated tertiary interactions. Despite structural differences in the peripheral regions, the SAM-binding core of the B. subtilis yitJ riboswitch is virtually superimposable with the previously determined Thermoanaerobacter tengcongensis yitJ riboswitch structure, suggesting that a highly conserved ligand-recognition mechanism is utilized by all S-box riboswitches. SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension) chemical probing analysis further revealed that the alternative base-pairing element in the expression platform controls the conformational switching process. In the absence of SAM, the apo yitJ aptamer domain folds predominantly into a pre-binding conformation that resembles, but is not identical with, the SAM-bound state. We propose that SAM enters the ligand-binding site through the "J1/2-J3/4" gate and "locks" down the SAM-bound conformation through an induced-fit mechanism. Temperature-dependent SHAPE revealed that the tertiary interaction-stabilized SAM-binding core is extremely stable, likely due to the cooperative RNA folding behavior. Mutational studies revealed that certain modifications in the SAM-binding region result in loss of SAM binding and constitutive termination, which suggests that these mutations lock the RNA into a form that resembles the SAM-bound form in the absence of SAM.

The ribosomal frameshift signal in the genomic RNA of the coronavirus IBV is composed of two elements, a heptanucleotide "slippery-sequence" and a downstream RNA pseudoknot. We have investigated the kinds of slippery sequence that can function at the IBV frameshift site by analysing the frameshifting properties of a series of slippery-sequence mutants. We firstly confirmed that the site of frameshifting in IBV was at the heptanucleotide stretch UUUAAAC, and then used our knowledge of the pseudoknot structure and a suitable reporter gene to prepare an expression construct that allowed both the magnitude and direction of ribosomal frameshifting to be determined for candidate slippery sequences. Our results show that in almost all of the sequences tested, frameshifting is strictly into the -1 reading frame. Monotonous runs of nucleotides, however, gave detectable levels of a -2/+1 frameshift product, and U stretches in particular gave significant levels (2% to 21%). Preliminary evidence suggests that the RNA pseudoknot may play a role in influencing frameshift direction. The spectrum of slip-sequences tested in this analysis included all those known or suspected to be utilized in vivo. Our results indicate that triplets of A, C, G and U are functional when decoded in the ribosomal P-site following slippage (XXXYYYN) although C triplets were the least effective. In the A-site (XXYYYYN), triplets of C and G were non-functional. The identity of the nucleotide at position 7 of the slippery sequence (XXXYYYN) was found to be a critical determinant of frameshift efficiency and we show that a hierarchy of frameshifting exists for A-site codons. These observations lead us to suggest that ribosomal frameshifting at a particular site is determined, at least in part, by the strength of the interaction of normal cellular tRNAs with the A-site codon and does not necessarily involve specialized "shifty" tRNAs.

Site-directed mutations were introduced in the connecting loops and one of the two stem regions of the RNA pseudoknot in the tRNA-like structure of turnip yellow mosaic virus RNA. The kinetic parameters of valylation for each mutated RNA were determined in a cell-free extract from wheat germ. Structure mapping was performed on most mutants with enzymic probes, like RNase T1, nuclease S1 and cobra venom ribonuclease. An insertion of four A residues in the four-membered connecting loop L1 that crosses the deep groove of the pseudoknot reduces aminoacylation efficiency. Deletions up to three nucleotides do not affect aminoacylation or RNA pseudoknot formation. Deletion of the entire loop abolishes aminoacylation. Although elimination of the pseudoknot is presumed, this could not be demonstrated. Unlike the mutations in loop L1, all mutations in the three-membered connecting loop L2 that crosses the shallow groove of the RNA pseudoknot decrease the aminoacylation efficiency considerably. Nonetheless, the RNA pseudoknot is still present in most mutated RNAs. These results indicate that a number of mutations can be introduced in both loops without abolishing aminoacylation. Results obtained with the introduction of mismatches and A.U base-pairs in stem S1 of the pseudoknot, containing three G.C base-pairs in wild-type RNA, indicate that the pseudoknot is only marginally stable. Our estimation of the gain of free energy due to the pseudoknot formation is at most 2.0 kcal/mol. The pseudoknot structure can, however, be stabilized upon binding the valyl-tRNA synthetase.

Programmed ribosomal frameshifting allows the synthesis of alternative, N-terminally coincident, C-terminally distinct proteins from the same RNA. Many viruses utilize frameshifting to optimize the coding potential of compact genomes, to circumvent the host cell's canonical rule of one functional protein per mRNA, or to express alternative proteins in a fixed ratio. Programmed frameshifting is also used in the decoding of a small number of cellular genes. Recently, specific ribosomal − 1 frameshifting was discovered at a conserved U_UUU_UUA motif within the sequence encoding the alphavirus 6K protein. In this case, frameshifting results in the synthesis of an additional protein, termed TF (TransFrame). This new case of frameshifting is unusual in that the − 1 frame ORF is very short and completely embedded within the sequence encoding the overlapping polyprotein. The present work shows that there is remarkable diversity in the 3′ sequences that are functionally important for efficient frameshifting at the U_UUU_UUA motif. While many alphavirus species utilize a 3′ RNA structure such as a hairpin or pseudoknot, some species (such as Semliki Forest virus) apparently lack any intra-mRNA stimulatory structure, yet just 20 nt 3′-adjacent to the shift site stimulates up to 10% frameshifting. The analysis, both experimental and bioinformatic, significantly expands the known repertoire of − 1 frameshifting stimulators in mammalian and insect systems.

There is phylogenetic evidence for the existence of a new pairing in subgroup IA1 self-splicing introns. This tertiary interaction, called P11, which is extraneous to the catalytic centre of these ribozymes was modelled after a “pseudoknot” and grafted by computer modelling on the common core structure of group I introns that was recently proposed by Michel & Westhof. In order to probe the function of the P11 pairing, we mutated the P11 helix in the intron of the large ribosomal precursor of Saccharomyces cerevisiae mitochondria (Sc.LSU). Our experimental data show that the P11 pairing plays a role in stabilizing the overall fold of the RNA molecule. While P11 is not essential for self-splicing activity in vitro, mutants with disrupted P11 require higher concentration of MgCl2 for self-splicing. By contrast, mutants with a reinforced P11 pairing (via introduction of several G · C base-pairs) self-splice more efficiently than the wild-type at 55 °C. Based on this work, the possible engineering of new stable versions of the ribozyme is discussed.

The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3′- endo, anti ) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A -form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al .