Search

The K1 protein of Kaposi's sarcoma-associated herpesvirus (KSHV) has been shown to be a transforming protein capable of inducing morphological changes and focus formation in rodent fibroblasts. K1 can activate B-cell receptor (BCR) signaling and upregulate activity of the NFAT and NF-κB transcription factors. In order to understand the regulation of K1 gene expression, we have analyzed sequences upstream of the K1 gene to identify the K1 promoter element. We have performed 5′ rapid amplification of cDNA ends as well as a nuclease protection assay to map the transcriptional start site of the KSHV K1 transcript. The K1 transcriptional start site lies 75 bp upstream of the translation start site. Sequences upstream of the K1 gene were characterized for their ability to activate a luciferase reporter gene in 293 epithelial cells, KSHV-negative B cells (BJAB), KSHV-positive B cells (BCBL-1), and KS tumor-derived endothelial cells (SLK-KS − ). We found that a 125-bp sequence upstream of the K1 transcript start site was sufficient to fully activate the luciferase reporter gene in all cell types tested. In addition, the viral transcription factor KSHV Orf50/Rta was capable of further activating this promoter element in 293, BJAB, and BCBL-1 cells but not in SLK-KS − cells. Promoter constructs containing additional sequences upstream of the 125-bp element did not show further augmentation of transcription in the presence or absence of KSHV Orf50.

Transcription of the six Epstein-Barr virus (EBV) EBNA genes is coordinately regulated, being driven by either the Cp promoter, which is encoded within the unique region just upstream of the EBV major internal repeat (IR-1), or by the Wp promoter, which is encoded within the IR-1 repeat and thus present in multiple copies. Previous analyses of Cp- and Wp-initiated transcription have identified a shared cis -regulatory element mapping to the region extending from −169 to −369 bp upstream of the Wp transcription initiation site (M. T. Puglielli, N. Desai, and S. H. Speck, J. Virol. 71:120-128, 1997). To assess the impact of this regulatory region on Cp and Wp activity in the context of the viral genome, we attempted to delete this regulatory region upstream of the first copy of Wp (Wp1). While 10 recombinant viruses were obtained in which this deletion was incorporated in the interior of the IR-1 repeat, only a single lymphoblastoid cell line (LCL) immortalized by a recombinant EBV harboring the deletion upstream of Wp1 was recovered. In contrast, using a control targeting vector in which the Wp regulatory sequences were intact but which contained a sequence tag within the W0 exon, we demonstrated that of the five recombinant viruses analyzed in which the crossover event had occurred upstream of the Wp sequence tag, four had incorporated the tagged sequences into Wp1 of the virus. Taken together, these results indicate that deletion of the regulatory sequences from −369 to −169 bp upstream of Wp1 is unfavorable for EBV-driven B-cell immortalization but is tolerated within the interior of the IR-1 repeat. Analysis of promoter usage in the clone 9-60 LCL, in which the W enhancer sequences were deleted upstream of Wp1, revealed the following: (i) the level of Cp-initiated transcription was significantly diminished compared to that of wild-type LCLs; (ii) the decreased Cp-initiated transcription was not efficiently compensated by transcription initiation from Wp1; and (iii) transcription initiation from downstream Wp promoters was detectable. This is the first report of an LCL in which transcription initiation from a Wp downstream of Wp1 has been documented.

Vesicular stomatitis virus (VSV), the prototypic rhabdovirus, has a nonsegmented negative-sense RNA genome with five genes flanked by 3′ leader and 5′ trailer sequences. Transcription of VSV mRNAs is obligatorily sequential, starting from a single 3′ polymerase entry site, and termination of an upstream mRNA is essential for transcription of a downstream gene. cis -acting signals for transcription of VSV mRNAs are present within the leader region, at the leader-N junction, and at the internal gene junctions. The gene junctions of VSV consist of a conserved 23-nucleotide region that includes the gene end sequence of the upstream gene, 3′-AUACU7-5′, a nontranscribed intergenic dinucleotide, 3′-G/CA-5′, and the gene start sequence, 3′-UUGUCNNUAG-5′, at the beginning of the gene immediately downstream. Previous work has shown that the gene end sequence and intergenic region are sufficient to signal polyadenylation and termination of VSV transcripts. Mutagenesis of the gene start sequence has determined the importance of this region in the processes of initiation and 5′-end modification of mRNAs. However, because the gene end sequence is positioned directly upstream of the gene start sequence in the gene junction, and because of the requirement for termination of the upstream gene prior to transcription of the downstream gene, it has not been possible to investigate whether the gene end sequence contributes to transcription of the downstream gene. In this study, we inserted an additional gene end sequence upstream of the gene junction in a subgenomic replicon of VSV, which extended the intergenic region from 2 to 88 nucleotides. This duplication of termination signals allowed us to separate the signals required for termination from those required for initiation. We investigated the effect that the upstream gene end sequences had on downstream mRNA transcription. Our data show that the U7 tract of the upstream gene end sequence is necessary for optimal transcription of the downstream gene, independent of its role in termination of the upstream gene. Altering the sequence or changing the length of the U tract directly upstream of the gene start sequence significantly decreased transcription of the downstream gene. These results show that the U tract is a multifunctional region that is required not only for polyadenylation and termination of the upstream mRNA but also for efficient transcription of the downstream gene.

The expression of hepatitis B virus (HBV) genes is regulated by a number of transcription factors. One such factor, Sp1, has two binding sites in the core promoter and one in its upstream regulatory element, which is also known as the ENII enhancer. In this study, we have analyzed the effects of these three Sp1 binding sites on the expression of HBV genes. Our results indicate that both Sp1 binding sites in the core promoter are important for the transcription of the core RNA and the precore RNA. Moreover, while the downstream Sp1 site (the Sp1-1 site) in the core promoter did not affect the transcription of the S gene and the X gene, the upstream Sp1 site (the Sp1-2 site) in the core promoter was found to negatively regulate the transcription of the S gene and the X gene, as removal of the latter led to enhancement of transcription of these two genes. The Sp1 binding site in the ENII enhancer (the Sp1-3 site) positively regulates the expression of all of the HBV genes, as its removal by mutation suppressed the expression of all of the HBV genes. However, the suppressive effect of the Sp1-3 site mutation on the expression of the S gene and the X gene was abolished if the two Sp1 sites in the core promoter were also mutated. These results indicate that Sp1 can serve both as a positive regulator and as a negative regulator for the expression of HBV genes. This dual activity may be important for the differential regulation of HBV gene expression.

Ty3 is a gypsy-type, retrovirus-like element found in the budding yeast Saccharomyces cerevisiae . In cells overexpressing Ty3 under the GAL1 upstream activation sequence, Ty3 RNA, proteins, and DNA are made. Elucidation of the molecular masses and amino-terminal sequences of protease and reverse transcriptase indicated the existence of an additional intervening domain, designated J, in the Ty3 Gag3-Pol3p polyprotein. A region analogous to J can be found in many retrotransposable elements closely related to Ty3; however, J does not correspond to any of the highly conserved retroviral protein domains. Ty3 mutants deleted for the J-coding region showed moderately reduced transposition frequency but greatly reduced levels of Ty3 DNA. These results show that under galactose regulation, the Ty3 J domain is not absolutely essential.

Coronavirus transcription is a discontinuous process, involving interactions between a trans-acting leader and the intergenic transcription initiation sequences. A 9-nucleotide (nt) sequence (UUUAUAAAC), which is located immediately downstream of the leader at the 5' terminus of the mouse hepatitis virus (MHV) genomic RNA, contains a sequence resembling the consensus intergenic sequence (UCUAAAC). It has been shown previously that the presence of the 9-nt sequence facilitates leader RNA switching and may enhance subgenomic mRNA transcription. It is unclear how the 9-nt sequence exerts these functions. In this study, we inserted the 9-nt sequence into a defective interfering (DI) RNA reporter system and demonstrated that mRNA transcription could be initiated from the 9-nt sequence almost as efficiently as from the intergenic sequence between genes 6 and 7. Sequence analysis of the mRNAs showed that the 9-nt sequence served as a site of fusion between the leaders and mRNA. The transcription initiation function of the 9-nt sequence could not be substituted by other 5'-terminal sequences. When the entire 5'-terminal sequence, including four copies of the UCUAA sequence plus the 9-nt sequence, was present, transcription could be initiated from any of the UCUAA copies or the 9-nt sequence, resulting in different copy numbers of the UCUAA sequence and the deletion of the 9-nt sequence in some mRNAs. All of these heterogeneous RNA species were also detected from the 5'-terminal region of the viral genomic-length RNA in MHV-infected cells. These results thus suggest tha the heterogeneity of the copy number of UCUAA sequences at the 5' end, the deletion of the 9-nt sequence in viral and DI RNAs, and the leader RNA switching are the results of transcriptional initiation from the 9-nt site. They also show that an mRNA species (mRNA 1) that lacks the 9-nt sequence can be synthesized during MHV infection. Therefore, MHV genomic RNA replication and mRNA 1 transcription may be distinguishable.

The herpes simplex virus type 1 (HSV-1) major capsid protein VP5 gene (UL19) is expressed with beta gamma (gamma 1 [leaky late]) kinetics. We have previously described the construction of recombinant HSV-1 in which the VP5 promoter was engineered to control the expression of the bacterial beta-galactosidase gene as a reporter (C.-J. Huang, S. A. Goodart, M. K. Rice, J. F. Guzowski, and E. K. Wagner, J. Virol. 67:5109-5116, 1993). Here we describe further mutational analysis in recombinant viruses. We have precisely defined the boundaries of the VP5 promoter and identified two regions important for both the level and the kinetics of expression. The 5' boundary was located at -48 relative to the initiation site of transcription by analyzing a series of nested deletions in the upstream sequence, and although a number of cis-acting sites influencing transient expression have been identified upstream of this point, these sites have no role in promoter activity during productive infection. Deletion of an Sp1-binding site located between -48 and the TATA box at -30 greatly reduced VP5 promoter activity late but not early after infection. A cis-acting element whose sequence resembles the human immunodeficiency virus type 1 initiator was located between -2 and +10 in the VP5 sequence by characterizing a series of deletions and site-directed block mutations downstream the TATA box. This element defines the 3' limit of the VP5 promoter, and like the upstream element, disruption of this element also inhibited promoter activity late in the productive cycle.

The bovine papillomavirus upstream regulatory region represents a common element in the regulation of transcription from the five early viral promoters. We have determined the sequences required for transcription from the viral P1 promoter, which is located at the 5' end of the upstream regulatory region. In vitro transcription from P1 requires a 123-bp fragment (nucleotides 7153 to 7275; -33 to +90) consisting of an upstream TATA-like sequence as well as an unidentified protein which binds to sequences immediately downstream of the initiation site. In vivo, this promoter requires additional downstream sequences (to position +160; nucleotide 7345) for maximal activity but does not require any additional DNA sequence upstream of a putative TATA box. Four regions within the downstream sequence from +9 to +160 are protected from DNase I digestion by proteins present in a HeLa cell extract. The presence of these sites correlates with the level of P1 activity. A constitutive enhancer maps to this same region, and mutations in this enhancer have been shown to affect downstream promoters. Deletion analysis indicates that the same sequences are required by both the P1 promoter and the constitutive enhancer, suggesting that the same proteins function in both activities.

Expression of the baculovirus major envelope glycoprotein gene (gp64) is regulated by transcription from both early and late promoters. To characterize the early promoter and identify sequences involved in the regulation of gp64 early transcription, promoter-reporter gene fusions were generated from the Orygia pseudotsugata nuclear polyhedrosis virus gp64 promoter and were analyzed by transient expression in uninfected insect cells. For these analyses, 5' deletion mutations were constructed in the gp64 upstream regulatory region. Larger promoter constructs were functional in uninfected Lymantria dispar cells, indicating that transcription from the gp64 early promoter required no additional viral gene products. Deletion analysis of the gp64 upstream region revealed several regulatory regions. These included a putative negative regulatory element between -319 and -166 nucleotides (nt) and multiple positive regulatory elements between -166 and -77 nt. Deletion of the TATA box located between -77 and -62 nt resulted in the loss of transcriptional activity. Cotransfections of reporter constructs and a plasmid containing a baculovirus transcriptional transactivator gene (Autographa californica nuclear polyhedrosis virus IE1) resulted in transcriptional transactivation of all constructs containing an intact TATA box. These data demonstrate that sequences upstream of the gp64 TATA box are not essential for IE1 transactivation and that only 34 nt upstream of the early transcription start site were necessary for basal levels of transcription and for transactivation by IE1. Function of the gp64 early promoter was also examined in cell lines from Spodoptera frugiperda and Drosophila melanogaster.

Site-directed mutagenesis was used to examine the organization of cis-acting regulatory elements that comprise the promoter of the early 35,000-molecular-weight protein gene (35K protein gene) encoded by the EcoRI-S region of the baculovirus Autographa californica nuclear polyhedrosis virus. The promoter fragment, extending from positions -226 to +12 relative to the early RNA start site (position +1), was fused to the reporter gene encoding chloramphenicol acetyltransferase (CAT) and then inserted into the genome of recombinant viruses (3.96 map units) in order to ascertain the role of regulatory elements in the context of a normal infection. A combination of deletions and linker insertions revealed that early transcription was mediated by a basal (minimum) promoter, consisting of the TATA element (positions -30 to -25), that was in turn responsive to an upstream activating region located between -90 and -30. The TATA element exerted the single greatest influence on the level of early promoter activity and contained all information necessary to direct transcription from a site located 30 nucleotides downstream. The upstream activating region provided a 10- to 15-fold stimulation of transcription from the early +1 start site that was mediated by distinct DNA elements. These regulatory elements included two GC motifs (centered at positions -81 and -54, respectively), composed of alternating G and C residues, and a CGT motif (position -40) that contained the core sequence A(A/T)CGT(G/T). Each motif was required for full promoter activity during the early phase of infection. This organization that employs diverse cis-acting stimulatory elements is typical of promoters responsive to RNA polymerase II and may facilitate increased expression of A. californica nuclear polyhedrosis virus genes early in infection when the level of viral DNA for transcription is critically low.

We have replaced the polyomavirus (Py) enhancer, which is an essential component of the Py origin of DNA replication (ori), with five repeats of a 17-bp oligonucleotide including the yeast GAL4 upstream activating sequence (5xGAL4 sites). Plasmids containing this modified Py ori, designated test plasmids, and plasmids encoding either the GAL4 transcriptional activator protein or various derivatives of this protein were cotransfected into mouse cells which constitutively synthesize a temperature-sensitive Py large tumor antigen (T-Ag). Replication of the test plasmids was monitored by Southern blot determinations of the amounts of plasmid DNA that became resistant to cleavage by the enzyme DpnI. These studies showed that in the presence of a functional T-Ag, the GAL4 protein, and hybrid proteins including the GAL4 DNA-binding domain and the activating domain of the adenovirus E1a or herpesvirus VP16 protein transactivated the modified Py ori. A truncated protein including just the GAL4 DNA-binding domain was inactive in these assays. The authentic GAL4 protein was found to be a more efficient replication transactivator than the hybrid proteins. In contrast, chloramphenicol acetyltransferase assays showed that the hybrid proteins were more efficient transcriptional activators than the GAL4 protein. The extent of the GAL4-dependent replication of a plasmid in which the Py early promoter was deleted was 55% lower than that of a plasmid including the promoter. However, the extents of replication of plasmids including two tandem repeats of the remaining Py origin core and 5xGAL4 sites or two origin cores flanking a single cluster of 5xGAL4 sites were 4.8- and 1.6-fold higher than that of the plasmid including a single copy of each element. The replication of a plasmid including two clusters of 5xGAL4 sites flanking a single origin core was below the limit of detection of our assays. These results indicate that the GAL4 and hybrid transactivators do not activate the Py ori by virtue of their interactions with transcription factors that bind promoter elements. Rather, it appears that these activator proteins may interact with the replication initiation complexes, thereby facilitating or inhibiting the initiation of replication.

An adenovirus major late promoter (MLP) has been constructed with a 4-bp alteration in the sequence which binds the transcription factor known as USF or MLTF. This upstream element has often been considered necessary and sufficient for maximal transcription of the MLP. A duplex oligonucleotide containing the mutant sequence was not capable of binding specific proteins in a band shift assay, nor was it capable of inhibiting such binding by the wild-type sequence. In an in vitro assay, the mutant sequence was incapable of inhibiting transcription from a duplex sequence containing the MLP, whereas the wild-type sequence could. These two pieces of evidence suggest that the sequence is functionally impaired. Surprisingly, a virus containing the mutant MLP had a normal replication phenotype. On more detailed examination however, we show that the mutant viral MLP was deficient in transcription at 9 h postinfection but that the rate of transcription was close to normal by 20 h postinfection. An inverted CAAT box located immediately upstream of the USF-binding element was not previously thought to be of importance to the functioning of the MLP. However, a single point mutation in the CAAT box, placed in the USF mutant background, had a marked effect upon transcription from the MLP. This result suggests that the MLP may exhibit functional redundancy in which either the USF-binding site or the CAAT box can serve as an upstream promoter element. Neither of the mutant viruses displayed any change in the levels of the divergent IVa2 transcription unit, suggesting that the levels of divergent transcription are not determined by competition for limiting transcription factors.

The expression of the vaccinia virus intermediate I3 gene depends on trans-acting factors which are present in an active state prior to DNA replication. However, activation of transcription requires DNA replication in cis (J. C. Vos and H. G. Stunnenberg, EMBO J., 7:3487-3492, 1988). We have made deletion and linker scanner mutations of the I3 promoter to determine the sequence requirements for transcriptional activity and the dependence of DNA replication. The I3 promoter appears to consist of two elements which are essential and sufficient for accurate transcription initiation both in vivo and in vitro. An upstream and a downstream sequence element were defined ranging from -20 to -9 and +1 to +9, respectively. The upstream element appears to be highly homologous to a sequence in the intermediate I8 promoter. A 3-bp substitution in the upstream I3 promoter element resulted in a change of transcriptional specificity from intermediate to late. Finally, the mutations did not result in an activation of the intermediate promoter prior to DNA replication.

The adenovirus type 2 major late upstream element factor (UEF) recognizes two similar elements that lie between the major late promoter (MLP) and IVa2 promoter cap sites (the previously characterized MLP-UE from nucleotides -49 to -67 and the IVa2-UE from nucleotides -98 to -122). DNase I footprinting and gel retention assays showed that the UEF has a lower affinity for the IVa2-UE than for the MLP-UE. In vitro transcription experiments demonstrated first that the IVa2 promoter, which lacks a consensus TATA box, may work, as does the MLP, in the absence of its proximal upstream element and second that the IVa2-UE stimulated IVa2 transcription two- to threefold, as MLP-UE did for the MLP. In addition, we demonstrated that the more distal upstream element has a weak stimulatory effect on transcription of both promoters.

We have previously shown that the human cytomegalovirus early UL4 promoter has upstream negative and positive cis-acting regulatory elements. In the absence of the upstream negative regulatory region, the positive element confers strong transcriptional activity. The positive element contains a CCAAT box dyad symmetry and binds the cellular transcription factor NF-Y. The effect of the negative regulatory element is negated by the viral IE2 protein (L. Huang, C.L. Malone, and M.F. Stinski, J. Virol. 68:2108, 1994). We investigated the binding of cellular or viral IE2 protein to the negative regulatory region. The major cis-acting negative regulatory element was located between -168 and -134 bp relative to the transcription start site. This element could be transferred to a heterologous promoter, and it functioned in either orientation. Mutational analysis demonstrated that a core DNA sequence in the cis-acting negative regulatory element, 5'-GTTTGGAATCGTT-3', was required for the binding of either a cellular repressor protein(s) or the viral IE2 protein. The cellular DNA binding activity was present in both nonpermissive HeLa and permissive human fibroblast cells but more abundant in HeLa cells. Binding of the cellular repressor protein to the upstream cis-acting negative regulatory element correlates with repression of transcription from the early UL4 promoter. Binding of the viral IE2 protein correlates with negation of the repressive effect.

Electrophoretic mobility shift assays performed with nuclear extracts from human fibroblasts revealed the formation of two major protein complexes with an oligonucleotide (nucleotides 78 to 107) from the palindromic region located upstream from the minute virus of mice (MVM) P4 promoter. It was shown that this oligonucleotide bound USF at the enhancer E box CACATG. The second complex contained the transcription factor NF-Y, whose association was surprising because its target sequence lacks the canonical CCAAT motif present in all mammalian NF-Y binding sites identified so far. The MVM NF-Y recognition element instead contains the CCAAC sequence. USF and NF-Y had distinct but overlapping sequence requirements for binding, suggesting that their associations with MVM DNA were mutually exclusive. Because of the palindromic nature of MVM DNA terminal sequences, NF-Y associated with the three nucleotide configurations corresponding to the hairpin structure and to the external and internal arms of the extended duplex replication form, respectively. However, owing to the imperfection of the palindrome, the binding of USF was restricted to the internal arm. Point mutations that suppressed the in vitro binding of NF-Y to the internal palindromic arm reduced the activity of the resident P4 promoter, while those preventing complex formation with USF did not, as determined by transient expression assays using the luciferase reporter gene. The data led to the identification of a novel P4 upstream regulatory region capable of interacting with two transcription factors, from which one (NF-Y) appeared to upmodulate the activity of the promoter.

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression.

The gene (pol) encoding the Epstein-Barr virus (EBV) DNA polymerase is a member of the "early" class of viral genes which are expressed shortly after activation of latent virus infection. First, mRNA from the EBV-producing cell line, B95-8, treated with 12-O-tetradecanoylphorbol-13-acetate and sodium butyrate to induce lytic replication and expression of this gene was analyzed. Northern (RNA) analysis revealed a message of 3.7 kb found only in induced cells. 5' mapping of pol mRNA by S1 nuclease and primer extension analyses indicates that transcription initiates at tightly clustered sites within a G + C-rich region 126 bp upstream of the open reading frame. The same initiation region was identified in two other EBV-infected cell lines, P3HR1 and Raji, after induction. Second, a 1.29-kb genomic fragment containing this region, when cloned upstream of the chloramphenicol acetyltransferase reporter gene, demonstrated promoter activity in lymphoid cells cotransfected with pEBV-RZ, a genomic expression construct that includes genes for the EBV immediate-early transactivator proteins, BZLF-1 and BRLF-1. Within the upstream 1.29-kb sequence, two regions of 140 bp and 101 bp appear to be needed for promoter activity. These results demonstrate that unlike most EBV genes studied thus far, the pol gene contains multiple transcriptional start sites. The upstream regulatory region of the promoter for the pol gene does not contain canonical promoter elements such as TATA and CAAT boxes and, furthermore, is not constitutively active but requires transactivation by two or more viral proteins.

In the polyomavirus (Py)-transformed rat cell line designated LPT, replication of the integrated Py DNA can be induced by exposure of the cells to carcinogens. In view of the observation that enhancer elements are essential components of the Py origin of replication, it appeared plausible that the induction is triggered by synthesis or modification of an enhancer-binding protein which is required for activation of the viral origin. To test this hypothesis, we have used a plasmid containing a modified Py origin (test plasmid), in which the Py enhancer has been replaced with five repeats of the yeast GAL4 upstream activating sequence, and a plasmid encoding the GAL4 transcriptional activator protein. Previous studies in which these two plasmids were cotransfected into mouse cells that are permissive for Py showed that the GAL4 protein can transactivate the modified Py origin and cause replication of the test plasmid. When similar cotransfection assays were performed in LPT cells, no replication of the test plasmid was observed unless the cells were exposed to the carcinogen mitomycin C subsequent to the transfection, in which case replication of the test plasmid was induced. Control experiments showed that even though the GAL4 protein was required for the induction, its concentration was not affected by the exposure to mitomycin C. These results indicate that the primary target in the induction pathway is not an enhancer-binding protein; instead, the induction appears to be triggered by changes in other components of the replication initiation complex which may be associated with the origin core.

We determined the sequence of the gene for the virion transactivator protein Vmw65 of herpes simplex virus type 2 (HSV-2), strain 333. An analysis of the coding sequence revealed an overall high degree of primary sequence conservation (86%) relative to the HSV-1 protein, although the carboxy-terminal region which encompasses the powerful acidic transactivation domain of the HSV-1 protein was slightly less well conserved (70%). One important change in this region was the presence of a proline residue in a region of the HSV-2 protein which is thought to form an amphipathic alpha-helix in the HSV-1 homolog. Despite the occurrence of this helix-disrupting residue, the HSV-2 protein exhibited powerful transactivation properties for immediate-early target promoters. We also demonstrated that the HSV-2 protein forms a transcriptional complex (TRF.C) with the cellular Oct-1 protein and target TAATGARAT elements from immediate-early promoters. A comparison of upstream sequences from the two Vmw65 genes revealed good conservation of proximal promoter elements but considerable divergence elsewhere. Specifically, the HSV-2 promoter alone carries 9.5 copies of a 9-bp direct repeat (GGGGCGGGA) ending 85 bp upstream of the conserved TTAAAT element. An analysis of transcription factor binding sites in vitro revealed that cellular factor Sp1 bound to the direct repeat sequence of the HSV-2 promoter and that cellular factor USF bound to a proximal element present in both HSV-1 and HSV-2 promoters. Mutational analysis of the HSV-2 promoter demonstrated that the integrity of both of these binding sites was important for the full activity of the promoter.

We have analyzed the sequences that regulate the transcription of adenovirus type 5 early region 4 (E4). A region located immediately upstream of the E4 TATA box is required for efficient E4 transcription in vitro and in vivo. A cellular transcription factor, termed ETF-A, binds to this region. ETF-A also binds to additional sites in the E4 5'-flanking region, including the adenovirus terminal repeat, as well as to the adenovirus early region 2 promoter region and the adeno-associated virus early promoter region. A repeated sequence motif is found in each binding domain. The same factor binds to a region upstream of a cellular gene that contains a cyclic AMP response element. Consistent with this result, E4 expression is induced in vivo by cyclic AMP. Two other regions further upstream of the E4 initiation site also contribute to efficient E4 expression. These domains are functionally redundant and contain binding sites for ETF-A. One domain is the adenovirus terminal repeat, which has strong promoter activity in vitro and in vivo.

Previous experiments have demonstrated that adenovirus infection of human and mouse cells leads to an E1A-dependent activation of the DNA-binding capacity of a cellular transcription factor termed E2F. E2F binds to two sites in the adenovirus E2 early promoter which have been shown to be critical for E1A-dependent E2 early transcription, and the E2F-binding sites can confer E1A-induced transcription to a heterologous promoter. In addition, under a variety of circumstances, the increase in E2F-binding activity coincides with the activation of E2 transcription. We now find that, in addition to the E1A gene, another early viral gene, the E4 gene, is necessary for the activation of E2F-binding activity. Extracts prepared from human 293 cells, which express the E1A and E1B genes, had low levels of E2F activity, whereas infection of 293 cells with the E1A mutant dl312 increased E2F activity. This increase did not occur when 293 cells were infected with dl366, an E4 deletion mutant, nor was there an increase in E2F activity in HeLa cells infected with either dl366 or dl312; however, a coinfection with the two mutants yielded the normal wild-type increase in E2F. Furthermore, infection of HeLa cells with a high multiplicity of dl312, conditions that allow E4 gene expression in the absence of E1A, did not yield an increase in E2F activity. Thus, it appears that both the E1A gene and the E4 gene are directly involved in E2F activation. Measurements of E2 RNA production in a dl366 infection as compared with a wild-type or dl312 infection demonstrate that the E4 gene is essential for full E2 transcription. Furthermore, transfection assays of the E2 promoter demonstrate that, although E1A alone can trans-activate the E2 promoter, it is not as effective as the combination of E1A and E4 in the induction of the E2 promoter. We therefore conclude that the activation of the E2F factor leading to the activation of E2 transcription requires the combined action of both the E1A 289-amino-acid protein and an E4 product.

We have studied initiation and regulation of early transcription of simian virus (SV40) DNA in vitro by eucaryotic RNA polymerase II, using both a crude HeLa cell extract and a partially purified calf thymus polymerase supplemented with a HeLa cell S100 fraction. Analysis of initiation sites by primer-directed cDNA synthesis and sequencing of cDNA's has revealed that early transcription is initiated at a multiplicity of sites corresponding to the 5' termini of early viral mRNA's. The pattern of in vitro initiation closely resembles the pattern of 5' termini of early mRNA's late in the lytic cycle, with principal initiations between residues 5184 to 5194, upstream from the early Hogness-Goldberg (TATA) sequence, and at residue 5123, well downstream from this sequence. In vitro transcription is initiated to a lesser extent at sites between residues 5150 and 5155, the principal 5' termini of early mRNA's in transformed cells and early in lytic infection, located 21 to 26 nucleotides downstream from the TATA sequence. Initiation occurs at identical sites and with similar efficiencies on form I and linearized DNA templates. There are minor differences in the efficiency of initiation at specific sites by the two transcriptional systems. Studies using a DNA template cleaved just downstream from the TATA sequence and a second template cleaved through a pair of 72-base-pair tandem repeats starting 87 nucleotides upstream from the TATA sequence have revealed that neither the TATA sequence nor the repeats are essential for early transcription in vitro. However, removal of the TATA and upstream sequences shifts initiation of transcription principally to the residue 5123 site. Comparison of the relative efficiencies of transcription on intact wild-type DNA, the two cleaved DNAs, and DNA from a deletion mutant suggests that all or most of the sequences constituting an early promoter lie within the genomic region 60-70 to 140 nucleotides upstream from the principal 5' termini of the early mRNA's.

E2-C, a protein consisting mainly of the carboxy-terminal 45% of the human papillomavirus type 11 (HPV-11) E2 protein, was expressed from the Rous sarcoma virus long terminal repeat in mammalian cells. It competitively repressed the stimulatory action of the full-length E2 protein on the HPV-11 enhancer located in the upstream regulatory region, as assayed by the expression of a reporter gene from the simian virus 40 (SV40) early promoter in transiently transfected monkey CV-1 cells. A mutation in the initiation codon for E2-C protein eliminated repression. In the human cervical carcinoma cell line C-33A, which apparently lacks endogenous HPV DNA, the HPV-11 enhancer-SV40 promoter and the HPV-11 enhancer in its normal association with the E6 promoter had high constitutive activity. In these cells, E2 proteins had little or no stimulatory effect on the transcriptional activity of the HPV-11 enhancer-SV40 promoter. In contrast, the HPV-11 enhancer-E6 promoter was stimulated by the HPV-11 E2 protein but repressed by the bovine papillomavirus type 1 E2 protein, an effect due either to a quantitative difference in E2 expression levels or to a qualitative difference in the trans-activating abilities of the two E2 proteins. In this cell line, the HPV-11 E2-C protein suppressed both the constitutive activity and the HPV-11 E2 trans activation. The E2-C protein was also produced from an expression vector in Escherichia coli. The E2-C protein present in crude E. coli lysates or purified by DNA affinity chromatography associated in vitro with a specific sequence, ACCN6GGT, in filter-binding assays. Moreover, the protein generated DNase I footprints spanning this motif identical to those of bacterially expressed full-length E2 proteins. This DNA sequence motif is necessary and sufficient for E2 binding in vitro and enhancer trans activation in vivo (H. Hirochika, R. Hirochika, T. R. Broker, and L. T. Chow, Genes Dev. 2:54-67, 1988). Mutations in this sequence that abolished interactions with E2 also precluded binding to the E2-C protein. These data strongly suggest that the full-length E2 protein consists of two functional domains: the amino-terminal half for trans activation and the carboxy-terminal half for DNA binding. The mechanism by which E2-C represses E2-dependent enhancer activity most likely involves competition with E2 for binding to a common transcriptional regulatory site.(ABSTRACT TRUNCATED AT 400 WORDS)

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.

We have demonstrated that gene expression from the promoter of the Epstein-Barr virus (EBV) MS gene with its upstream sequence is inducible by 12-O-tetradecanoylphorbol-13-acetate (TPA). By transfecting mammalian cells with plasmids in which the MS promoter and its upstream sequence are linked to the bacterial chloramphenicol acetyltransferase gene, we have shown that treatment of the cells with TPA stimulates the expression of chloramphenicol acetyltransferase activity in both EBV-negative and -positive cell lines. This TPA response requires the cis-acting sequence between nucleotides 84440 and 85046 of the EBV genome, located either upstream or downstream of the MS promoter. The TPA induction is at the transcriptional level. When this sequence is linked to the promoter of the human herpesvirus 1 thymidine kinase gene, it can also enhance the expression of, and confer TPA responsiveness on, the thymidine kinase promoter. By constructing and transfecting mutants with 5' and 3' deletions, we have identified two TPA-responsive elements, one located between -726 and -690 and the other located between -603 and -546 relative to the transcription start site. These two sequences do not contain any homology to the previously defined elements for TPA response and may play an important role in EBV induction by TPA.

To improve our knowledge of the simian virus 40 (SV40) late promoter control region, we took advantage of the fact that T antigen can be expressed with a heterologous promoter. We constructed three chimeric plasmids (pEMP-273, pEMP-LCAP-162, and pEMP-LCAP-113) each with a putative late promoter sequence positioned immediately upstream from the SV40 early gene coding region but in an orientation opposite to its natural orientation in the SV40 genome. After transfection of the recombinant DNA into HeLa or CV1 cells, T antigen accumulation, as scored by indirect immunofluorescence, was used as a functional test for promoter activity. We found that the sequence mapping from nucleotides 332 to 273 is not sufficient for promoting transcription of SV40 early gene but does potentiate the promoter activity of the 72-base-pair repeats in initiating the transcription at natural late cap sites. Considering that both plasmids pEMP-LCAP-162 and pEMP-LCAP-113 lack all of the sequence of the SV40 replication origin, we conclude that SV40 transcription can be mediated through a putative late promoter in the absence of the sequence for the SV40 replication origin.

Three avian nuclear proteins which bind to the Rous sarcoma virus long terminal repeat have been detected. Two of the proteins bind to sequences within the enhancer, and the third protein binds to a sequence spanning the enhancer and an upstream promoter region.

Nucleotides upstream of the B19 parvovirus P6 promoter affect in vitro transcription in HeLa cell nuclear extracts. Comparison of the relative transcriptional strengths of equimolar mixes of plasmids containing the intact upstream sequence and plasmids containing deletions within these nucleotides identified several regions that affect transcription in vitro. A fragment containing two of five GC-box motifs which correspond to high-affinity SP1-binding sites was shown, by using a gel shift assay, to bind a HeLa cell factor (or factors). DNase I, methylation interference, and methylation protection footprinting demonstrated that the HeLa cell factor(s) bound to one of the two GC-box motifs within this fragment. Mutation of this GC box abolished factor binding and significantly reduces in vitro transcription from the P6 promoter. These results suggest that the B19 parvovirus promoter includes a complex regulatory region containing multiple sequences which affect promoter strength and that the GC-box motif is a major controlling sequence for in vitro transcription.