Search

Quinoa is a potential new crop for New England; however, its susceptibility to downy mildew, caused by Peronospora variabilis, is a key obstacle for cultivation. The objectives of this study were to evaluate differential resistance within the Chenopodium genus, identify novel sources of resistance for use in future genetic studies or breeding programs, and investigate phylogenetic relationships of P. variabilis isolates from different Chenopodium hosts. The long-term goal of this research is to develop a resistant variety of quinoa to be grown in New England. Field trials conducted at the University of New Hampshire evaluated downy mildew disease severity on 10 Chenopodium accessions representing four species. Disease severity for each treatment was compared and significant differences in disease severity were observed between accessions. C. berlandieri var. macrocalycium ecotypes collected from Rye Beach, New Hampshire and Appledore Island, Maine exhibited the lowest disease severity over the growing season. P. variabilis was isolated from each accession, and COX2 sequences were compared. Phylogenetic analyses suggest no effect of host species on P. variabilis sequence similarity; however, isolates are shown to cluster by geographic location. This research provides the first step in identifying potential New England native sources of resistance to downy mildew within the genus Chenopodium and provides preliminary information needed to further investigate resistance at the genomic level in Chenopodium spp.

Chenopodium quinoa Wild, a pseudocereal food crop, has been cultivated for several thousand years in South America (Jacobsen S. E., et al. 2003), which has been accepted as a functional food in China and planted with increasing coverage recently. In November 2019, an ear rot disease was observed on Chenopodium quinoa in greenhouses from a farm located at Yuanping City (112.7° E; 38.73° N), and in 2020, about 5-50% of plants in greenhouses and fields were infected, yield loss was estimated to be 5-30% in Shanxi Province, north China. At first, an olive green spot-shaped mildew layer appeared on some glume shells, and then the color gradually deepened, turning brown to black-brown, the number of affected glume shells gradually increased, and spread to the whole spikelets, most of the infected spikelets became withered and moldy. Occasionally, a necrotic patch covering the mildew layer appeared on the young stem close to the ear, causing the upper part of the plant to wilt and even die. To identify the causal agent of the disease, fresh spikelets with symptoms of ear rot were collected from the diseased plants (n=7). Spores produced by the pathogen were picked with a sterilized inoculation needle in a sterilized airflow hood and were suspended in sterilized deionized water. Then dilution plate method was deployed to obtain the single-spore cultures on potato dextrose agar (PDA) plate, the colonies (n=14) had appeared in a round and flat in powder form, olive green, with folds and depresses in the center, and dark green at the backside of the colony, and cracks in the medium. Conidiophore grows from the side of hyphae, smooth or sometimes verruculose, with the size of 51.50 to 127.63 μm × 2.91 to 5.35μm (n = 50). Ramoconidia have 0-1 septa, mostly 2~3 conidial scars, and measured 6.51 to 15.73 μm × 2.4 to 4.47 μm (n=50). Conidia formed in long branched chains that were readily disarticulating, single-celled, colorless or brown, elliptic or rod-shaped, with blunt round ends, and measured 2.76 to 5.42 μm × 1.78 to 3.88 μm (n=50). The morphological characteristics of the isolates were First Report of Ear Rot of Chenopodium quinoa caused by Cladosporium cladosporioides in Shanxi, China Xinfeng Li, Tianchun Yu, Xiaodong Jiang, Chunlai Zhang, Xiaojun Zhao, and Jianmin Wang. Shanxi Agricultural University, Taigu, Shanxi Province 030801, China. Chenopodium quinoa Wild, a pseudocereal food crop, has been cultivated for several thousand years in South America(1), which has been accepted as a functional food in China and planted with increasing coverage recently. In November 2019, an ear rot disease was observed on Chenopodium quinoa in greenhouses from a farm located at Yuanping City (112.7° E; 38.73° N), and in 2020, about 5-50% of plants in greenhouses and fields were infected, yield loss was estimated to be 5-30% in Shanxi Province, north China. At first, an olive green spot-shaped mildew layer appeared on some glume shells, and then the color gradually deepened, turning brown to black-brown, the number of affected glume shells gradually increased, and spread to the whole spikelets, most of the infected spikelets became withered and moldy. Occasionally, a necrotic patch covering the mildew layer appeared on the young stem close to the ear, causing the upper part of the plant to wilt and even die. To identify the causal agent of the disease, fresh spikelets with symptoms of ear rot were collected from the diseased plants (n=7). Spores produced by the pathogen were picked with a sterilized inoculation needle in a sterilized airflow hood and were suspended in sterilized deionized water. Then dilution plate method was deployed to obtain the single-spore cultures on potato dextrose agar (PDA) plate, the colonies (n=14) had appeared in a round and flat in powder form, olive green, with folds and depresses in the center, and dark green at the backside of the colony, and cracks in the medium. Conidiophore grows from the side of hyphae, smooth or sometimes verruculose, with the size of 51.50 to 127.63 μm × 2.91 to 5.35μm (n = 50). Ramoconidia have 0-1 septa, mostly 2~3 conidial scars, and measured 6.51 to 15.73 μm × 2.4 to 4.47 μm (n=50). Conidia formed in long branched chains that were readily disarticulating, single-celled, colorless or brown, elliptic or rod-shaped, with blunt round ends, and measured 2.76 to 5.42 μm × 1.78 to 3.88 μm (n=50). The morphological characteristics of the isolates were consistent with those of Cladosporium cladosporioides(2). To further identify the causal agent, the actin (Act), translation elongation factor (TEF-1α), and rDNA internal transcribed spacer regions of ribosomal DNA (rDNA ITS) of the selected isolate 'YTC1' were amplified and sequenced. BLASTn analysis showed that Act (MW560123), TEF-1α(MW560124), and ITS (MZ674407) of the isolate 'YTC1' were 99 to 100% identical to C. cladosporioides (GenBank accession Nos. HM148504, HM148515, and HM148527 for ACT sequences; HM148258, HM148269, and HM148281 for TEF-1α sequences; HM148017, HM148028, and HM148040 for ITS sequences). The pathogenicity test was performed by injecting 10 μl of conidial suspending liquid (107 conidia/ml) into the inoculated ears (n=5), each of which had 8-10 spikelets, treatments without inoculation were the control(n=5), and all the treatments were maintained at 25°C and 90% relative humidity in an incubator. All inoculated ears showed the symptoms similar to those observed above after 5 days, but no symptoms were observed on the control, and C. cladosporioides isolates were re-isolated from plants and identified by the morphological and molecular traits described above, thus fulfilling Koch's postulates. Cladosporium cladosporioides are known to be on fading and decaying plant material, or a secondary invader on living plants(2). To our best knowledge, this is the first report of C.cladosporioides as the causal agent of ear rot of C. quinoa in China and perhaps the world. The new disease has impacted the yield and quality of C. quinoa and alerted scientists to investigate effective control strategies in the future. Xinfeng Li, Tianchun Yu, and Xiaodong Jiang contributed equally to this work. The authors are grateful to Mr. Xiangyun Wu, CEO of Jiaqi Seeds Ltd for his useful information. The author(s) declare no conflict of interest. Funding: Funding was provided by Shanxi Province Key Science and Technology Program on Agriculture (201803D221012-2, 201703D221006-3), the Sino-Pakistan aid project of Science and Technology Department of China （KY202002002）, and Shanxi Agriculture Valley Construction Program (SXNGJSKYZX201702, SXNGJSKYZX201704). References: [1] Jacobsen, S. E. 2003. Food Reviews International, 19:167-177. [2] Bensch K., Braun U., Groenewald J.Z., et al. 2012. Studies in Mycology, 72: 1- 401.

Foliar symptoms suggestive of virus infection were observed on the ornamental plant hoya (Hoya spp.; commonly known as waxflower) in Florida. An agent that reacted with commercially available tobamovirus detection reagents was mechanically transmitted to Chenopodium quinoa and Nicotiana benthamiana. Rod-shaped particles ∼300 nm in length and typical of tobamoviruses were observed in partially purified virion preparations by electron microscopy. An experimental host range was determined by mechanical inoculation with virions, and systemic infections were observed in plants in the Asclepiadaceae, Apocynaceae, and Solanaceae families. Some species in the Solanaceae and Chenopodiaceae families allowed virus replication only in inoculated leaves, and were thus only local hosts for the virus. Tested plants in the Amaranthaceae, Apiaceae, Brassicaceae, Cucurbitaceae, Fabaceae, and Malvaceae did not support either local or systemic virus infection. The complete genome for the virus was sequenced and shown to have a typical tobamovirus organization. Comparisons of genome nucleotide sequence and individual gene deduced amino acid sequences indicate that it is a novel tobamovirus sharing the highest level of sequence identity with Streptocarpus flower break virus and members of the Brassicaceae-infecting subgroup of tobamoviruses. The virus, for which the name Hoya chlorotic spot virus (HoCSV) is proposed, was detected in multiple hoya plants from different locations in Florida.

Quinoa black stem is a new disease that affects the stems of quinoa plants and is more likely to develop under cool conditions (15 to 25°C, RH = 55 ± 2%). The typical symptoms include the formation of black necrotic lesions on the stem, which can completely wrap around the stem, causing lodging and blanking (development of 'empty' and sterile grain on the panicle). Furthermore, the pycnidia form small round protrusions on the surface of the lesions. Phylogenetic analysis revealed that representative isolates LMHS-3 and LMHS-5 were closely related to

During March 1997, 20 to 30% of field-grown onion (Allium cepa), observed in Bet Shean Valley, Israel, had unusual viral symptoms of straw-colored ringspots on leaves and flower stalks. Leaf samples were analyzed by transmission electron microscopy (EM) of leaf dip preparations. Typical tospovirus-like particles were observed only with samples taken from symptomatic plants. Crude sap from symptomatic tissue was mechanically transmitted to Nicotiana benthamiana, Chenopodium quinoa, and Gomphrena globosa. On inoculated plants of N. benthamiana, chlorotic spots developed on inoculated leaves, followed by systemic necrosis, 4 and 7 days post inoculation (DPI), respectively. On inoculated plants of C. quinoa and G. globosa, necrotic local lesions developed by 4 to 5 DPI. EM studies with ultrathin sections of infected onion and N. benthamiana leaves revealed the presence of tospovirus-like particles. Virus was purified from mechanically infected N. benthamiana and identified as Iris yellow spot tospovirus (IYSV) by Western blots (immunoblots) and enzyme-linked immunosorbent assay (ELISA) (anti-IYSV antiserum was provided by D. Peters, Wageningen, the Netherlands). A high incidence of the disease observed in the surrounding fields and in other onion-growing areas in Israel was associated with large populations of the onion thrips (Thrips tabaci). Although characteristic symptoms have been noted on a frequent basis, effects on yield have yet to be determined. IYSV is known to occur in the Netherlands, where it has been occasionally detected in Iris (1) and leek (A. Porrum) (J. Verhoeven, personal communication). The detection of IYSV in Israel and the wide distribution of thrips in the natural vegetation may be an important constraint on onion and other bulb-crop production in Israel. Reference: (1) A. F. L. M. Derks and M. E. C. Lemmers. Acta Hortic. 432:132, 1996.

Wasabi (Wasabia japonica (Miquel) Matsum.), a native perennial of Japan and Shakhalin Island used to produce a condiment for Japanese dishes, is under commercial development in Tasmania, Australia. Plants propagated within shade houses showed systemic necrotic flecks and veinal necrosis in leaves and sunken necrotic stem lesions similar to those, reported in Japan (1), caused by cucumber mosaic cucumovirus (CMV). Necrosis progressed rapidly, resulting in death of plants transferred to or mechanically inoculated in a glasshouse (15 to 30°C) under full light. Disease progression in plants maintained in shade houses (5 to 20°C) was slower and symptoms less severe. Presence of CMV in symptomatic plants was confirmed by enzyme-linked immunosorbent assay (ELISA), using antiserum from Agdia (Elkhart, IN), and by sap transmission tests to healthy wasabi and Chenopodium quinoa plants. Incidence of CMV among plants in the shade houses was estimated at 10%. A survey of a commercial planting of 400 to 500 plants in November 1997, using ELISA, showed an incidence of 2.6% CMV-infected plants. They were concentrated at the field margins, suggesting that the inoculum originated from external sources rather than from transplants. This pathogen could have significant impact on the longevity and production of this crop in Australia. Reference: (1) S. Adachi. 1987. Wasabi cultivation. Shizuoka Pref. Agric. Exp. Sta. Pub., Shizuoka, Japan.

Filamentous viral ribonucleoproteins (RNPs) 12 to 16 nm in diameter and 100 to 1,260 nm in length, and characteristic of the genus Tenuivirus, were detected by transmission electron microscopy in purified extracts of needles collected from two mature, asymptomatic black spruce (Picea mariana) trees in New York, but not in extracts of needles from nursery seedlings. Purified RNPs from one tree had a buoyant density in CsCl = 1.39 g/cm3 and an A 260/280 = 1.436. Four ssRNA segments of 1.3, 2.1, 2.3, and 3.5 kb, but not the 8- to 9-kb fragment characteristic of most tenuiviruses, were detected in purified RNA extracts. Amplification products of the expected size were observed when RNA extracts from the two spruce trees and Maize stripe tenuivirus (MStpV), but not from tobacco, Chenopodium quinoa, or spruce seedlings were subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers to the p3 open reading frame (ORF) of MStpV vRNA 3. However, only MStpV amplified when primers to the nucleocapsid ORF (pc3 ORF on vcRNA 3) were used. Similarly, only MStpV amplified by immunocapture polymerase chain reaction (PCR) using antiserum to MStpV and primers to the p3 ORF. Sequence comparisons suggest that two distinct tenuiviruses occur in black spruce, one more closely related to MStpV than the other. One of these tenuiviruses was detected in one of 10 additional black spruce trees tested, but not in trees of six other coniferous species sampled in the Adirondack Mountains of New York.

In 1994, characteristic viruslike symptoms on grapevine were reported in the collection of the Grapevine Institute in Athens, Greece, on the hybrid Baresana × Baresana. The symptoms were sharp angular mosaic, leaf crinkle, and little leaf. The affected vines showed gradual decline and severe stunting or death. Such vines produced abortive flowers or very few berries with smaller, wrinkled, and nongerminating seeds. Serological testing, by enzyme-linked immunosorbent assay (ELISA), of the affected vines against the most common grapevine viruses Alfalfa mosaic, Arabis mosaic, Grapevine fanleaf, Grapevine fleck, Grapevine A, Rasberry ringspot, and grapevine leafroll-associated viruses gave negative results. A virus was isolated from affected grapevine young leaves by mechanical inoculation of Gomphrena globosa and single lesioned. The virus host range included G. globosa (local and systemic dark red or necrotic lesions), Chenopodium quinoa (necrotic local lesions and systemic mottle), and three tobacco cultivars (sharp necrotic local lesions, 1 to 3 mm in diameter). Pollination of C. quinoa with pollen from infected plant gave about 30% infected seedlings. The virus was purified from C. quinoa by differential centrifugation using 0.02 M phosphate buffer pH 8.0, containing 0.01 M DIECA and 0.01 M sodium thioglycolate as extraction buffers. In a purified preparation, quasisphaerical virus particles of about 29 nm were observed. Electrophoretic mobility of the viral coat protein showed a molecular weight of 30 kDa. Using purified preparations, an antiserum was obtained with a titer of 1:1024 in microprecipitin test and an optimum IgG dilution in ELISA of 1:10,000 for maximum absorption at OD405 nm Using degenerate primers designed from homologous regions in RNA-2 corresponding to a fragment of the polymerase gene of Ilarviruses, the expected 381-bp polymerase chain reaction product was obtained. This product was cloned and sequenced. Comparisons with sequence data from the homologous regions of RNA-2 of other known Ilarviruses, showed that the sequence of the above 381-bp amplicon shared 72% sequence similarity with Tobacco streak virus, 67% of Citrus variegation virus and Spinach latent virus, 66% of Asparagus virus 2 and Elm mottle virus, and 65% of Citrus leaf rugose virus. Based on the above data, it is concluded that the isolated virus is an Ilarvirus with closest similarity to Tobacco streak virus. From the relative bibliography (1–3) it appears that the virus reported here is different from Grapevine line pattern virus, a possible Ilarvirus, previously reported from Hungary. References: (1) J. Lehoczky et al. Kertgazdasag 19:61, 1987. (2) J. Lehoczky et al. Phytoparasitica 17:59, 1989. (3) J. Lehoczky et al. Phytopathol. Medit. 31:115, 1992.

Beet necrotic yellow vein virus (BNYVV) causes rhizomania in beets. BNYVV is widespread in Europe and can be divided into an A and B group based on reverse transcription-polymerase chain reaction (RT-PCR) restriction fragment length polymorphism (RFLP) analysis (1). The vector of BNYVV, Polymyxa betae, is widespread in Denmark. However, surveys for BNYVV have regularly been carried out in Denmark since 1985, but it has not been detected until now. In the autumn of 2000, attention was drawn to a sugar beet field in the southeastern part of Denmark containing plants with unusually low sugar content. Typical BNYVV symptoms of bearded roots were observed on all plants sampled in the field. Root samples of 12 plants all tested positive for the presence of BNYVV by ELISA using antiserum from Adgen, Loewe, and Aschersleben, respectively. Immunosorbent electron microscopy with antiserum to BNYVV coat protein revealed decorated rod-shaped particles of lengths typical for BNYVV. Pulverized infected root tissue was used to mechanically inoculate Chenopodium quinoa and resulted in formation of few local chlorotic lesions. RNA was extracted from symptomatic C. quinoa and subjected to RT-PCR analysis using two primer sets specific for RNA 2 of BNYVV (1) and bands of the expected sizes were observed with both. The nucleotide sequence of a part of the PCR products corresponding to the N-terminus of the coat protein was determined and showed 99.5% identity to sequences derived from A group isolates (1). Finally, a bait-plant test was carried out, where sugar beet seeds were sown in 20 soil samples collected from different locations within the infested field. After 8 weeks of growth, all samples tested positive for the presence of BNYVV by ELISA, indicating that the entire field is infested and that viruliferous P. betae must have been present in several years. To our knowledge, this is the first record of BNYVV in Denmark. Reference: (1) M. Kruse et al. J. Gen. Virol. 75:1835, 1994.

Cassava (Manihot esculenta Crantz) is a vegetatively propagated tropical root crop. Viral infections have been identified as an important biotic component limiting cassava production (2). To survey for virus diseases, symptomatic samples of cassava plants were collected from the Venezuelan cassava production states Amazonas, Aragua, Barinas, Cojedes, Monagas, and Portuguesa. Mechanical transmissions to a differential host (Chenopodium quinoa) and a previously described double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) procedure (3) were used to test for the presence of Cassava virus X (CsVX). The DAS-ELISA procedure used gamma globulin diluted 1/2,000, conjugate diluted 1/2,000, and leaf sap extracts diluted 1/100 (1). CsVX and frog skin disease (detected graft inoculation tests with cultivar Secundina and electron microscopy) were detected in mixed infections in plants collected in Barinas. CsVX was not detected in any of the plants collected in the other surveyed areas. The low incidence of the virus (11.43%; 4 of 35 samples) suggests that CsVX has been introduced only recently via infected planting stock. Transmission of the virus is 100% when infected cuttings are used as propagation material. CsVX caused no symptoms on any of the cultivars examined in the field, and the occurrence of symptomless CsVX in Venezuela may result from the inadvertent use of cuttings from virus-infected plants. This is the first report of CsVX in cassava in Venezuela. References: (1) B. L. Nolt et al. Ann. Appl. Biol. 118:105, 1991. (2) B. L. Nolt et al. Plant Pathol. 41:348, 1992. (3) A. C. Velasco et al. 1994. Prog. Virol. Yuca, CIAT, Cali, Colombia.

Citrus mosaic disease, a potential threat to citrus production throughout India, is currently an important disease in the southern and northeastern states (2). The reported incidence of the disease ranges from 10 to 77% (K. Gopal, G. S. Aparna, M. Sreenivasuluk, K. V. Subbaiah, and A. R. K. Rao, unpublished data). This yellow mosaic disease of citrus is caused by Citrus yellow mosaic badna virus (CMBV), formerly citrus yellow mosaic disease, (CYMD) (1). Host range studies were done to find herbaceous noncitrus host plant species for virus maintenance. The following are the noncitrus plants tested in this study: Arachis hypogaea, Chenopodium amaranticolor, Chenopodium quinoa, Vigna mungo, Macrotyloma uniflorum, Cicer arietinum, Helianthus annuus, Cajanus cajan, V. sinensis, Cyamopsis tetragonoloba, V. radiata, Pisum sativum, Phaseolus vulgaris, Trichosanthes anguina, Nicotiana tabacum (Harrison special), Dolichos lablab, Petunia × hybrida, Gomphrena globosa, Cucumis melo, Cucumis pepo, Glycine max, Sorghum bicolor, Zea mays, and Canna indica. Young leaves with mosaic symptoms were collected from Citrus sinensis Osbeck, Citrus aurantiifolia Osbeck, and Citrus × limonia Osbeck plants, which are being maintained in an insect-proof glasshouse. The leaves were cut into small pieces, transferred to a chilled mortar, and macerated using 0.01 M phosphate buffer, pH 7.0, containing 0.2% (v/v) of 2-mercapto-ethanol at a tissue/buffer ratio of 1 g/9 ml (wt/vol). The extract was filtered and used for inoculation. The above-mentioned noncitrus plants were uniformly dusted with 600-mesh Carborundum and inoculated with sap extract from the citrus species. The plants were kept in an insect-proof glasshouse and observed for 6 weeks for symptom development. Only three hosts, Canna indica, sorghum, and maize produced visible symptoms. Symptoms were observed 14 days postinoculation on C. indica as chlorotic spots, which later developed into a mosaic pattern. Developing young leaves showed severe mosaic with vein banding symptoms. In sorghum and maize, chlorotic streaks were observed on young leaves after 10 days, which developed into dark green streaks in the leaf lamina. All the inoculated hosts were checked using virus double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and dot blot ELISA using CMBV polyclonal antiserum (Department of Virology, S.V. University, Tirupati, India). In both tests, only the C. indica, sorghum, and maize samples reacted positively. In dot blot ELISA, as little as 100 ng of virus could be detected in C. indica, sorghum, and maize. Virus from all three citrus sources produced the same symptoms on C. indica, sorghum, and maize. To our knowledge, this is the first report of herbaceous hosts of CMBV, which should prove useful as propagation and index hosts for CMBV. References: (1) Y. S. Ahlawat et al. Plant Dis. 80:590, 1996. (2) G. S. Reddy et al. Page 130 in: 3rd Int. Symp. Subtrop. Hortic. Bangalore, 1972.

Mechanically transmissible viruses were isolated from two soybean (Glycine max Merr.) plants from Rustenburg, Northwest Province and Greytown, KwaZulu-Natal, South Africa, respectively (2). Viruses were isolated by two serial local-lesion transmissions on Chenopodium quinoa. Ringspot symptoms on Nicotiana benthamiana suggested the presence of tospoviruses. This was supported by the detection of typical tospoviruslike particles in ultrathin sections of infected plants. Serological analysis of samples using various tospovirus antisera in a number of enzymelinked immunosorbent assay formats suggested the two isolates had epitopes in common with Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), and Tomato chlorotic spot virus (TCSV). Nucleotide sequences were determined using reverse transcriptionpolymerase chain reaction (RT-PCR) for 857 bp of the nucleoprotein gene of the two isolates (GenBank Accession Nos. AF487516 and AF 487517). These revealed a 99% nucleotide identity with each other. Sequence comparison with cognate regions of TSWV (GenBank Accession No. D00645), GRSV-SA-05 (GenBank Accession No. S54327), and TCSV (GenBank Accession No. S54325) revealed that both isolates share 97% nucleotide sequence identity with GRSV (SA-05) from peanut also originally from South Africa (1). Both isolates are therefore considered GRSV. To our knowledge, this is the first report of the natural occurrence of GRSV on soybean worldwide. References: (1) A. C. de Avila et al. J. Gen. Virol. 74:153, 1993. (2) G. Pietersen et al. Afr. Plant Prot. 4:65, 1998.

Downy mildew, caused by Peronospora farinosa (Fr.) Fr. f. sp. chenopodii Byford, is the most important disease of quinoa (Chenopodium quinoa Willd.) in the high mountainous areas of the Andes in South America (1), where the crop originated. While quinoa is not well known outside its traditional growing area, interest in this crop is increasing rapidly due to its high nutrient quality, many uses for human consumption, and agronomic characteristics of the plant; it is one of the most drought, salt, and frost tolerant crops known (2). From 1990 to 2001, several field trials were conducted in Denmark to study the performance of quinoa germ plasm of different origin under Danish conditions. Natural infection by downy mildew was observed each year on a range of cultivars, as well as on the common weed species, C. album L., which was observed growing near the quinoa. In 2001, 25 isolates of P. farinosa were collected from a field trial at the experimental station of the Royal Veterinary and Agricultural University in Taastrup, Denmark, from two Dutch quinoa cultivars (Carmen and Atlas) and one Danish breeding line (G205). Plants showed typical downy mildew symptoms: chlorotic lesions on the upper leaf surface and grayish spore masses on the lower leaf surface. Microscopic examination of the material showed the presence of dichotomously branched sporangiophores (200 to 400 μm long), which tapered to a blunt point and produced ellipsoidal, light brown sporangia with mean dimensions of 22 × 18 μm. The isolates were propagated and maintained by inoculation of detached quinoa leaves of two highly susceptible Peruvian cultivars (Toledo and Pandela) with a sporangium suspension (105 sporangia per ml), followed by incubation on water agar plates (10 to 15 leaves per plate) at 15°C and 12 h light/dark for 9 to 11 days. All isolates grew readily on these cultivars, and microscopic examination of the pathogen showed the same morphology as the original isolate. When the isolates were tested for their virulence on a range of quinoa cultivars with different geographic origin, specific interactions between host genotype and pathogen isolate were observed, measured as the degree of sporulation in the detached leaf assay, suggesting the presence of several pathotypes. To our knowledge, this is the first report of P. farinosa on quinoa in Denmark. Downy mildew should be considered as a potential problem for future large-scale quinoa production in Europe. References: (1) S. Danielsen. (Abstr.) Phytopathology 90(suppl):S17, 2000. (2) N. W. Galwey. Biologist 36:267, 1989.

A novel tobamovirus recently was isolated from hibiscus in Florida. Serological and molecular methods, including enzyme-linked immunosorbent assay (ELISA), dot-blot immunoassay (DBIA), tissue-blot immunoassay (TBIA), and immunocapture reverse-transcription poly-merase chain reaction (IC-RT-PCR) were compared to evaluate their usefulness for diagnosis of this virus. Each method was tested with partially purified virus preparations and tissue samples from infected hibiscus and Chenopodium quinoa plants. Indirect ELISA was more sensitive than double-antibody sandwich (DAS)-ELISA with all samples tested. The Florida hibiscus virus was detectable in hibiscus leaves and bark up to 1:12,800 and 1:6,400 dilutions, respectively, by indirect ELISA and up to 1:3,200 and 1:400 dilutions by DAS-ELISA. End-point dilutions of partially purified virus preparations from indirect and DAS-ELISA were 4 and 31 ng/ml, respectively. Florida hibiscus virus was detected by DBIA in sap from hibiscus bark and leaves at dilutions up to 1:400 and 1:800, respectively, showing that DBIA was less sensitive than either ELISA method. The virus also was detected reliably by TBIA from leaves and bark of hibiscus plants. The most sensitive method was IC-RT-PCR, which could detect as little as 500 pg/ml of virus in partially purified preparations and was 16- and 32-fold more sensitive than DAS-ELISA with hibiscus bark and leaf extracts, respectively. Over 600 hibiscus samples were tested by various combinations of these methods to validate their usefulness.

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Calla lilies are ornamental plants of major economic importance in Taiwan. They are grown in the central and northern areas of the island, and ≈3 million stems are shipped annually. Calla lilies are susceptible to several viruses (1). Infections by Cucumber mosaic virus, Dasheen mosaic virus, Turnip mosaic virus, and Watermelon silver mottle virus were reported in Taiwan. Recently, virus-like symptoms including yellow mottling, light yellow spot, yellow ringspot, and mosaic were observed on leaves of field-grown calla lilies from Changhua County, located in central Taiwan. In March 2001, a virus culture was isolated from diseased calla lilies and established in Chenopodium quinoa Willd. and Nicotiana benthamiana Domin. When inoculated with the virus, healthy calla lilies developed chlorotic spots that enlarged and fused to form large, yellow patches on inoculated leaves. Symptoms were similar to those on the naturally infected plants observed in the fields. The virus induced chlorotic local lesions on C. quinoa, C. ficifolium Sm., C. amaranticolor Coste & Reyn, Cucurbita moschata Duchesne ex Poir, Lisianthus russellianum (Don.) Griseb, Phaseolus angularis Wight, Vigna angularis Willd., and V. radiata (L.) Wilczek. In addition to the localized chlorotic spots on inoculated leaves, systemic invasion of the virus was also observed 8 to 10 days postinoculation in Dianthus caryophyllus L., D. chinensis L., and Glycine max Merr. In N. benthamiana, the only symptom observed was systemic wilting. Examination of 2% of uranyl-acetate-stained samples using electron microscopy revealed the presence of spherical particles ≈34 to 35 nm in diameter in crude extracts of leaves of diseased calla lilies, or infected C. quinoa. Similar particles were also observed in the cytoplasm but not in the nuclei in ultrathin sections of virus-infected leaf tissues of C. quinoa and N. benthamiana. Differential centrifugation followed by sucrose density gradient centrifugation of tissue extracts of infected C. quinoa yielded virions with similar size. Sodium dodesyl sulfate polyacrylamide gel electrophoresis of the purified virus showed a single structural polypeptide ith a Mr of 41.6 kDa. The viral antigen reacted positively with its homologous antiserum and an antiserum against Carnation mottle virus (CarMV; Agdia, Inc., Elkhart, IN) in double antibody sandwich enzyme-linked immunosorbent assay. Using primers 5′-CTCCATGGTCATGGAA(A/G)ATAAA GGAGAA and 3′-CAACAAATATCCTACACTGTCCTAGGTG specific to the coat protein (CP) gene of CarMV, an expected viral CP gene product of 1.05 kb was amplified by reverse transcription-polymerase chain reaction from total RNA isolated from infected N. benthamiana. Comparisons of the 1,047-nucleotide CP gene with those of 15 CarMV isolates available in GenBank showed 94.6 to 98.2% nucleotide identity and 94.8 to 96.8% amino acid identity. Results from current studies indicate that the virus infecting calla lilies is an isolate of CarMV. To our knowledge, this is the first report of CarMV infection in calla lilies. The occurrence of CarMV in calla lilies has direct implication for the economically important nursery and floral industry in Taiwan. Reference: (1) F. W. Zettler and R. D. Hartman. Dieffenbachia, Caladium, and Zantedeschia. Pages 464–470 in: Virus and Virus-Like Diseases of Bulb and Flower Crops. G. Loebenstein, R. H. Lawson, and A. A. Brunt, eds. John Wiley and Sons, West Sussex, U.K., 1995.

Allamanda (Allamanda cathartica L., family Apocynaceae) is native to Brazil and is a popular perennial shrub or vine ornamental in Taiwan. Plants showing severe mosaic, rugosity, and leaf distortion symptoms on leaves are common in commercial nurseries and private gardens. Examination of crude sap prepared from symptomatic leaves using an electron microscope revealed the presence of spherical virus particles with a diameter of approximately 28 nm. The virus was mechanically transmitted to indicator plants and induced symptoms similar to those incited by Cucumber mosaic virus (CMV). The virus caused local lesions on inoculated leaves of Chenopodium quinoa and C. amaranticolor and systemic mosaic in Cucumis sativus, Lycopersicon esculentum, Nicotiana benthamiana, N. glutinosa, N. rustica, and N. tabacum. On N. tabacum, necrotic ringspots developed on inoculated leaves followed by systemic mosaic. Tests of leaf sap extracted from naturally infected allamanda and inoculated indicator plants using enzyme-linked immunosorbent assay were positive to rabbit antiserum prepared to CMV. Viral coat protein on transblots of sodium dodecyl sulfate-polyacrylamide gel electrophoresis reacted with CMV subgroup I specific monoclonal antibodies (2). With primers specific to the 3′-half of RNA 3 (1), amplicons of an expected size (1,115 bp) were obtained in reverse transcription-polymerase chain reaction (RT-PCR) using total RNA extracted from infected allamanda and N. benthamiana. The amplified fragment (EMBL Accession No. AJ871492) was cloned and sequenced. It encompasses the 3′ part of the intergenic region of RNA 3 (158 nt), CP ORF (657 nt), and 3′ NTR (300 nt) showing 91.8–98.9% and 71.4–72.8% identities to those of CMV in subgroups I and II, respectively. Results of MspI-digested restriction fragment length polymorphism patterns of the RT-PCR fragment and the nucleotide sequence analysis indicate that the CMV isolate from allamanda belongs to subgroup IB, which is predominant on the island. To our knowledge, CMV is the only reported virus that infects allamanda and was first detected in Brazil (3), and this is the first report of CMV infection in allamanda plants occurring in Taiwan. References: (1) Y. K. Chen et al. Arch. Virol. 146:1631, 2001. (2) H. T. Hsu et al. Phytopathology 90:615, 2000. (3) E. W. Kitajima. Acta. Hortic. 234:451, 1988.

We were able to mechanically transmit a small isometric virus from field tomato samples showing severe necrotic symptoms, collected in the Culiacan area of Sinaloa state (Mexico). After gradient purification and three rounds of single-lesion passage on Chenopodium quinoa, the virus was back-inoculated to tomato plants and reproduced the original apical necrosis symptoms. The virus could be transmitted to a wide range of experimental hosts, including a number of solanaceous plants. Purified virus was used to produce specific polyclonal rabbit antibodies and serological tests such as enzyme-linked immunosorbent assay, Western blot analysis, and an immunochromatographic lateral flow assay. Such assays confirmed the wide distribution of this virus in symptomatic field plants in the area of the epidemic. Purified particles contained two genomic RNA molecules of ca. 7 kb (RNA1) and 5 kb (RNA2) estimated length. Analysis of clones from a cDNA library provided 6.5 and 3.0 kb of sequence for RNA1 and RNA2, respectively. Sequence analysis of the encoded replicase showed greatest similarity with members of the Sequiviridae family, and indicated that the virus we isolated is a new virus species, provisionally named Tomato apex necrosis virus.

In November 2005, 13 accessions of Petunia hybrida from the United States of America entered the post-entry quarantine station of the Plant Protection Service in the Netherlands. The plants were inspected and tested for quarantine organisms according to Directives 95/44 and 97/46 of the European Union. No virus and viroid symptoms were observed in the imported plants or in mechanically inoculated plants of Chenopodium quinoa, Nicotiana benthamiana, and N. occidentalis-P1 (3). Testing for pospiviroids by return-polyacrylamide gel electrophoresis (1) and reverse transcriptase-PCR with universal pospiviroid primers Pospi1-RE/FW (2) indicated the presence of pospiviroids in 3 and 11 P. hybrida accessions, respectively. The 196-bp amplicons of six accessions were sequenced. Sequence analysis showed the highest identity for all amplicons to both isolates of Tomato chlorotic dwarf viroid (TCDVd) in NCBI GenBank, Accession Nos. AF162131and AY372399, from Canada and the United States, respectively. Additional RT-PCRs with the Pospi1-RE/FW primers in opposite order and the semi-universal pospiviroid primers Vid-RE/FW (2) for one isolate, followed by sequence analysis, confirmed the identity as TCDVd. The isolate consisted of 359 nucleotides (GenBank Accession No. DQ859013) and showed sequence identities of 98.6 and 96.1% to the Canadian and American tomato isolates of this viroid, respectively. The next highest sequence identity was 90.0% to two accessions of Potato spindle tuber viroid (GenBank Accession Nos. AJ593449 and AY962324). On the basis of these results, the viroid from P. hybrida was identified as TCDVd. To our knowledge, this is the first report of TCDVd in this plant species. Reference: (1) J. W. Roenhorst et al. EPPO Bull. 30:453, 2000. (2) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (3) J. Th. J. Verhoeven and J. W. Roenhorst. EPPO Bull. 33:305, 2003.

During the last several years, two California propagators have detected what was believed to be the tymovirus Scrophularia mottle virus (ScrMV) in several ornamental plant species on the basis of enzyme-linked immunosorbent assay (ELISA) using a ScrMV antibody system. Symptoms were generally mild, ranging from nonsymptomatic to a mild mosaic. Our laboratory confirmed the presence of a tymovirus in one Verbena sp. and two Diascia spp. cultivars on the basis of dsRNA analysis that showed bands of approximately 6,400 and 300 nucleotides representing the genomic and coat protein subgenomic RNAs, respectively. While these plants and those that were experimentally infected (Nicotiana benthamiana and N. clevelandii) also tested positive for ScrMV by ELISA, the host range did not match that published for ScrMV, notably the lack of symptoms in Chenopodium quinoa and the lack of systemic infection in Datura stramonium. A similar host range result was reported in Europe for another tymovirus that cross reacts with ScrMV antiserum, Nemesia ring necrosis virus (NeRNV) (2). Using NeRNV specific primers (1), we used reverse transcription-polymerase chain reaction (RT-PCR) to test plants that had previously tested positive for ScrMV by ELISA and had dsRNAs typical of a tymovirus. An amplicon of the appropriate size (960 bp) for NeRNV was obtained from each of five samples. Using ScrMV specific primers, the same samples failed to amplify the expected product. We have found NeRNV in three Diascia spp., one Verbena sp., and one Nemesia sp. plants in two counties in California (Riverside and San Diego). When the RT-PCR products were sequenced, they all had 99% sequence identities to NeRNV with 4 to 7 single nucleotide changes (GenBank Accession Nos. DQ648150 to DQ648154). Notably, each of the five amplicons had changes at nucleotides 5134 (G to C) and 5549 (G to T) when compared with the European isolates of NeRNV, which did not result in any amino acid changes. To our knowledge, this is the first report of NeRNV in North America and more specifically, in California. References: (1) R. Koenig et al. J. Gen. Virol. 86:1827, 2005. (2) A. L. Skelton et al. Plant Pathol. 53:798, 2004.

In October of 2005, sugar beet (Beta vulgaris L.) plants exhibiting symptoms of rhizomania caused by Beet necrotic yellow vein virus (BNYVV) (3) were observed in a production field near Greeley, CO. The roots of seven plants exhibiting moderate to severe symptoms characteristic of this disease were tested using double-antibody sandwich enzyme-linked immunosorbent assay with anti-BNYVV antiserum from rabbits. Of these, only two roots exhibiting the mildest symptoms tested positive for BNYVV (all roots tested negative for the presence of the related Beet soilborne mosaic virus (BSBMV). ‘Hairy’ lateral roots characteristic of the disease were combined from the remaining five roots, ground in phosphate buffer, and the supernatant from the suspension was mechanically applied to leaves of Chenopodium quinoa in an effort to isolate an infectious agent. Five days postinoculation (dpi), yellow lesions with necrotic centers were visible on inoculated leaves, well in advance of those typically observed for BNYVV or BSBMV. Lesions exhibiting a similar rate of development on C. quinoa subsequently were induced from extracts of root vascular tissue prepared from four of seven additional beet roots tested from this location. Transfer of the infection from the C. quinoa lesions to 32 healthy C. quinoa and 10 sugar beet plants (hybrid ACH9369; American Crystal Sugar Co., Moorhead MN) resulted in 100% infection. Inoculated leaves of C. quinoa exhibited a high density of necrotic local lesions within 3 dpi, whereas inoculated leaves of sugar beet exhibited pinpoint, necrotic to diffuse, chlorotic local lesions evident by 5 dpi. Electron microscopic examination of fixed, ultra-thin sections of symptomatic C. quinoa leaf tissue revealed aggregates of virus-like particles of icosahedral symmetry within the cell cytoplasm. Following a virus minipreparation procedure, nucleic acid extracted from the partially purified virus was found to be single-stranded RNA by ribonuclease digestion and alone was infectious when inoculated to C. quinoa leaves. The apparently monopartite RNA genome was 3.5 kb long and a candidate for the single coat protein (CP) had a mass of ˜25 kDa. The sole reference set found in the literature for a virus naturally occurring on sugar beet with similar characteristics was that for Beet black scorch virus (BBSV), a virus recently accepted by the ICTV into the genus Necrovirus within the family Tombusviridae (2). Prior to this communication, BBSV has only been reported in China where it was first documented affecting sugar beet in the late 1980s (1). Using the published sequence of BBSV (Genbank Accession No. AY626780), DNA primers directed to the 3′ half of the BBSV genome were used in reverse transcription-polymerase chain reaction to produce an amplicon from the unknown virus. Sequencing the amplicon revealed 88.8% nucleotide sequence identity to the BBSV CP gene and 97% amino acid sequence identity to the predicted CP gene product. Combined, the nucleotide sequence and physical characteristics confirm the presence of BBSV in a U.S. sugarbeet field for the first time. To our knowledge, this is the first report of the occurrence of BBSV outside of China. References: (1) Y. Cao et al. Arch. Virol. 147:2431, 2002. (2) C. M. Fauquet et al. Eighth Report of the International Committee on the Taxonomy of Viruses. Academic Press, New York, 2005. (3) C. M. Rush. Ann. Rev. Phytopathol. 41:567, 2003.

Lavandula angustifolia Mill. (synonym Lavandula officinalis Chaix), belonging to the Lamiaceae family, is a plant that is widespread in Mediterranean countries. The species is widely grown as an ornamental crop in Poland. Currently, only Alfalfa mosaic virus (AMV) is known to infect L. latifolia × L. officinalis in Italy (3). In the spring of 2005, we observed yellow mottling, leaf deformation, and growth reduction of L. angustifolia plants from the Agricultural Academy of Kraków collection of medicinal herbs and spices. Mechanical inoculation of a range of indicator plant species, Chenopodium quinoa, Cucumis sativus, Datura strammonium, Nicotiana glutinosa, N. tabacum cv. Xanthi, Lycopersicon esculentum, and Spinacia oleracea, with sap from symptomatic L. angustifolia plants resulted in symptoms typical of Cucumber mosaic virus (CMV). Chlorotic local lesions and systemic mosaic were observed after a few days on the tested plant species. However, local lesions did not develop on inoculated C. sativus cotyledons. A lack of systemic infection on Chenopodium quinoa excluded infection by AMV. The sap from symptomatic N. tabacum cv. Xanthi leaves contained spherical virus particles of 29 nm in diameter when examined with electron microscopy. Symptomatic N. tabacum cv. Xanthi leaves were positive for CMV in a double-antibody-ELISA using commercial CMV antiserum (Loewe Biochemica GmbH, Sauerlach, Germany). Total RNA was extracted from infected N. tabacum cv. Xanthi plants by the phenolchloroform method. Reverse transcription-PCR was carried out using specific primers CMVF 5′-CCCACAGGTAGAATCAAAT-3′ and CMVR 5′-ATGGACAAATCTGAATCAAC-3′ (1). The 367-bp amplicon representing a portion of the coat protein gene located in RNA3 was cloned into pGEM-T Easy Vector (Promega, Madison, WI) and two clones were sequenced. The fragment sequence (Accession No. EU303304) was compared with homologous sequences of CMV isolates from the GenBank database. Multiple sequence alignment was performed by using Mega 4 (Center for Evolutionary Functional Genomics, Tempe, AZ) (4) and revealed 99% nucleotide and amino acid identity between the Polish isolate of CMV-PL and the RT67 (subgroup II) isolate from the Netherlands (2) To our knowledge, this is the first report on the occurrence of CMV on Lavandula angustifolia Mill. in Poland or worldwide. References: (1) N. Borodynko et al. Prog. Plant Protect. 44:604, 2004. (2) Z. Deyong et al. J Virol. Methods 123:101, 2005. (3) L. Giunchedi et al. Phytopathol. Mediterr. 11:74, 1972. (4) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007.

Dahlia is an important ornamental crop in the Czech Republic where they have been grown for more than 150 years. New dahlia cultivars have been selected by Czech plant breeders. Virus diseases, including mosaic and stunt caused mostly by Dahlia mosaic virus, have been a problem. From 2003 to 2005, color breaking was observed in several dahlia cultivars of foreign and Czech origin. White stripes in blossoms were most frequently expressed in the second half of the flowering season. No symptoms are visible in flowers of white and yellow cultivars. It was difficult to characterize symptoms on leaves because most cultivars were infected simultaneously by Dahlia mosaic virus. Sap inoculations of Chenopodium quinoa produced local lesions after 5 to 7 days, followed by systemic chlorosis, necrosis of younger leaves, and death of the shoot apex, indicating possible Tobacco streak virus (TSV) infection (2). Spherical particles (25 to 30 nm) were observed in leaf-dip preparations of samples from experimentally infected C. quinoa plants and analyzed by using transmission electron microscopy. These particles became decorated when using immunoelectron microscopy with TSV IgG (Bioreba, Reinach, Switzerland and Neogen, Ayrshire, Scotland). Samples of 80 dahlia cultivars were tested for TSV infection by ELISA using commercially available kits (Bioreba and Neogen). Most of the samples were grown in a collection of dahlia cultivars of Czech and foreign origin and some were obtained from growers in the Czech Republic. Fifty six dahlia cultivars were shown to be TSV infected. ELISA also indicated a higher concentration of the virus in flowers. The identity of the virus isolated from symptomatic plants was confirmed by reverse transcription (RT)-PCR using total RNA extraction from symptomatic plants. RT-PCR (4), using a primer pair (1) derived from the coat protein gene sequence of TSV (3), was followed by electrophoresis on 1.0% agarose gels. Products of the predicted size (approximately 700 bp) were found in naturally infected dahlia plants (n = 10), systemically infected host plants C. quinoa (n = 10), and symptomatic Nicotina megalosiphon (n = 10) that scored as TSV positive by ELISA. No bands of this size were seen in negative controls. To our knowledge, this is the first detection of TSV in the Czech Republic. References: (1) A. I. Bhat et al. Arch. Virol. 147:651, 2002. (2) A. A. Brunt Plant Pathol. 17:119, 1968. (3) B. J. C. Cornelissen et al. Nucleic Acids Res.12:2427, 1984. (4) S. S. Pappu et al. J. Virol. Methods 4:9, 1993.

In a survey of soilborne viruses infecting sugar beet in central Spain, Beet black scorch virus (BBSV) was detected in field grown sugar beets with symptoms of rhizomania disease. BBSV was found in all analyzed sugar beet producing regions from central Spain, as well as in bait plants grown in soils with a history of rhizomania from several Western European countries, thereby constituting the first report of BBSV in Europe. BBSV was transferred to Chenopodium quinoa, where it caused chlorotic local lesions from which virus particles were purified. The nucleotide sequence of the 3′-untranslated region of the genomic RNA was determined for 13 European isolates, and sequences were highly similar to those reported for Chinese and U.S. isolates. Sequence comparisons revealed three clusters of sequences, one including most European isolates, one including one European and two Chinese isolates, and the third including the U.S. isolate. BBSV was detected in a number of samples with rhizomania symptoms in which Beet necrotic yellow vein virus went undetected. However, its role in rhizomania disease in Europe, if any, remains to be established.

Capsicum chlorosis virus (CaCV), a thrips-transmitted, tentative species in the genus Tospovirus, family Bunyaviridae, was first identified in solanaceous crops, but also infects several ornamental crops such as orchid (4), gloxinia (3), and calla lily (1). From 2005 to 2007, virus-like yellow ringspots were observed on the leaves of amaryllis (Hippeastrum hybridum Hort.) and blood lily (Haemanthus multiflorus Martyn.) plants cultured in screenhouses and a private garden, respectively. Three of several hundred amaryllis plants in screenhouses from two places were observed as showing yellow ringspot symptoms and one of six blood lily plants was observed as showing similar yellow ringspot symptoms. Sap extracts from symptomatic leaves were inoculated to Chenopodium quinoa Willd. and the resulting local lesions were passaged three successive times to C. quinoa for virus isolation. Using the tospovirus genus-specific primers gL3637 and gL4435c designed from the conserved region in the L RNA (2), DNA fragments of the expected size of 800 bp were amplified by reverse transcription (RT)-PCR from field samples and local lesions from C. quinoa. Extracts from the diseased plants and local lesions of C. quinoa reacted strongly with antiserum against the nucleocapsid (N) protein of CaCV in ELISA and western blotting. To confirm the identity of this virus, we amplified the N gene from three amaryllis and one blood lily source using primer pair WN2328 and WN3534 designed from the S RNA of Watermelon silver mottle virus (1), and these products were cloned and sequenced. The sequence from each virus isolate was determined from three independent clones. The nucleotide and deduced amino acid sequences of N genes for the blood lily isolate (GenBank Accession No. EF101344) and three amaryllis isolates (GenBank Accession Nos. EF101343, EF137177, and FJ185170) had identities greater than 97% with that of a CaCV isolate infecting Capsicum spp. found in Australia (GenBank Accession No. AY036057). Phylogenetic analysis using maximum parsimony showed that these sequences clustered with CaCV. These results show that the virus identified from amaryllis and blood lily that were expressing yellow ringspot symptoms are isolates of CaCV. To our knowledge, this is the first report of CaCV naturally infecting amaryllis and blood lily and it could become an important threat to ornamental production in Taiwan. References: (1) C. C. Chen et al. Plant Dis. 91:1201, 2007. (2) F. H. Chu et al. Phytopathology 91:361, 2001. (3) H. T. Hsu et al. J. Gen. Plant Pathol. 66:167, 2000. (4) Y. X. Zheng et al. Eur. J. Plant Pathol. 120:199, 2008.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′) designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a “bud blight” isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Vigna marina (Burm.) Merr., the dune bean or notched cowpea, is a tropical creeping vine that grows on sand dunes along the coastal regions of Taiwan. Although V. marina is a weed, some varieties are also grown for fodder and food. This legume is a natural host of Bean common mosaic virus in the Solomon Islands (1) and Alfalfa mosaic virus or Beet western yellows virus in Australia (2). In April 2009, plants of V. marina showing severe mosaic and chlorotic ringspots on the foliage were found in the coastal region of Hualien County in eastern Taiwan. Indirect ELISA on a single diseased plant showed positive results with antibodies against the cucumber isolate of Cucumber mosaic virus (CMV) but negative to Broad bean wilt virus-1, Broad bean wilt virus-2, and some potyviruses (Agdia Inc., Elkhart, IN). A pure isolate of CMV was obtained from V. marina through three successive passages of single lesion isolation in sap-inoculated Chenopodium quinoa. Results of mechanical inoculations showed that the CMV-V. marina isolate was successfully transmitted to C. amaranticolor, C. murale, C. quinoa, Chrysanthemum coronarium, Gomphrena globosa, Nicotiana benthamiana, N. tabacum cv. Vam-Hicks, Phaseolus limensis, P. lunatus, P. vulgaris, Tetragonia tetragonioides, V. marina, V. radiata, and V. unguiculata subsp. sesquipedalis. These results of artificial inoculations were confirmed by ELISA. Homologous reactions of the CMV-V. marina isolate with a stock polyclonal antiserum against the CMV-cucumber isolate (4) were observed in sodium dodecyl sulfate-immunodiffusion. To determine the specific CMV subgroup, total RNA was extracted from inoculated leaves of C. quinoa using the Total Plant RNA Extraction Miniprep System (Viogene, Sunnyvale, CA). A DNA fragment of 940 bp covering the 3′ end of the coat protein gene and C-terminal noncoding region of RNA-3 was amplified using the Cucumovirus-specific primers (3) after reverse transcription (RT)-PCR with AccuPower RT/PCR PreMix Kit (Bioneer, Daejeon, Korea). The product was gel purified by Micro-Elute DNA/Clean Extraction Kit (GeneMark Technology Co., Tainan, Taiwan) and cloned in yT&A Cloning Vector System (Yeastern Biotech Co., Taipei, Taiwan) for sequencing (Mission Biotech Co., Taipei, Taiwan) and the sequence was submitted to GenBank (No. HM015286). Pairwise comparisons of the sequence of CMV-V. marina isolate with corresponding sequences of other CMV isolates revealed the maximum (95 to 96%) nucleotide identities with CMV subgroup IB isolates (strains Nt9 and Tfn) compared with 94 to 95% identities with subgroup IA isolates (strains Y and Fny) or 77 to 78% identities with subgroup II (strains LS and Q). These results suggest that CMV is the causal agent for the mosaic disease of V. marina in Taiwan and the isolate belongs to subgroup I. To our knowledge, this is the first report of V. marina as a natural host of CMV. This strain of CMV with specific pathogenicity could threaten crop production in the coastal zones. In addition, V. marina associated with native coastal vegetation was injured by CMV infection, which might lead to ecological impacts on shoreline fading. References: (1) A. A. Brunt. Surveys for Plant Viruses and Virus Diseases in Solomon Islands. FAO, Rome, 1987. (2) C. Büchen-Osmond, ed. Viruses of Plants in Australia. Retrieved from http://www.ictvdb.rothamsted.ac.uk/Aussi/aussi.htm . September, 2002. (3) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (4) S. H. Hseu et al. Plant Prot. Bull. (Taiwan) 29:233, 1987.

Blephilia hirsuta (Pursh) Benth. var. hirsuta, an ornamental plant known as hairy pagoda or hairy wood mint (Lamiaceae), is native to eastern North America and is listed as an endangered species or a species of special concern in several northeastern states ( http://www.ct.gov/dep/cwp/view.asp?a=2702&q=323482&depNav_GID=1628 and http://www.mass.gov/dfwele/dfw/nhesp/species_info/mesa_list/mesa_list.htm ). B. hirsuta, grown as an ornamental on the University of Arkansas campus in Fayetteville, exhibited mottling symptoms indicative of viral infection. Double-stranded RNA extractions (3) yielded four bands of approximately 3.2, 2.9, 2.2, and 0.9 kb, a pattern identical to that of Cucumber mosaic virus (CMV [2]). Nicotiana benthamiana and Chenopodium quinoa seedlings were mechanically inoculated with sap from symptomatic tissue. N. benthamiana inoculated plants were stunted and developed systemic mosaic and C. quinoa inoculated plants developed local lesions, whereas mock inoculated plants remained symptomless. Dot-blot and indirect ELISA using antisera against CMV (developed by H. A Scott) gave strong reactions when testing symptomatic tissue from B. hirusta, N. benthamiana, and C. quinoa compared with no reaction for symptomless plants. Total nucleic acid extractions (4) from symptomatic tissue was subjected to reverse transcription-PCR using Cucumovirus degenerate primers (1). An amplicon of approximately 940 bases was obtained and sequenced. The sequence, deposited in GenBank under Accession No. GU453918, confirmed the results of the immunological assays that B. hirsuta was infected with CMV. The nucleotide identities between the B. hirsuta isolate and those of the Fny CMV group exceeded 98%. To our knowledge, this is the first report of CMV infecting B. hirsuta, not only in North America, but globally. This finding has major implications for the ornamental industry and the viability of the endangered species. Given the wide range of CMV, B. hirsuta may act as a reservoir for the virus and facilitate transmission to ornamentals and other plants. In addition, the virus may reduce host fitness and undermine the efforts to preserve the species in areas that is threatened. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) I. E. Tzanetakis. Plant Dis. 93:431, 2009. (3) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008. (4) I. E. Tzanetakis et al. Virus Res. 127:26, 2007.

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1–3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide. References: (1) G. Dellavalle et al. Acta Hortic. 432:332, 1996. (2) L. J. John et al. Acta Hortic. 110:195, 1980. (3) P. Roggero et al. Plant Pathol. 49:802, 2000. (4) R. Wick and B. Dicklow. Diseases in Fuchsia. Common Names of Plant Diseases. Online publication. The American Phytopathological Society, St. Paul, MN, 1999.

Tomatillo is an important vegetable in Mexican cuisine. It is of Mesoamerica origin and now is grown widely in the Western Hemisphere. In 2011, 2% of commercially grown tomatillo plants in San Benito County, California exhibited severe stunting with foliage showing mosaic symptoms and leaf distortion. The fruits on infected plants were mottled and unmarketable. Flexuous filamentous-shaped virus particles of 800 to 850 nm long and 11 to 12 nm wide were observed from sap of the symptomatic plants with a transmission electron microscope. Sap from the diseased tomatillo plants reacted positively in an immunostrip assay for potyvirus (Agdia Inc., Elkhart, IN), indicating a potyvirus was associated with the disease. The causal agent was mechanically transmitted from the diseased field plants to six virus-free greenhouse tomatillo plants and all inoculated plants induced identical symptoms. The causal agent was also transmitted to Chenopodium quinoa and C. murale (chlorotic local lesions) and Nicotiana clevelandii, N. tabacum, and Physalis wrightii (systemic symptoms). The disease was also transmitted to tomatillo plants by the green peach aphid (Myzus persicae) in a nonpersistent manner (1-min acquisition access period and 1-min transmission access period with no latent period). To further identify the causal agent, total nucleic acids were extracted by a cetyltrimethylammoniumbromide (CTAB) method (2) and tested by reverse transcription-PCR using potyvirus degenerate primers CIFor and CIRev (1). An amplicon of approximately 700 bp from the diseased tomatillo was cloned and sequenced. Analysis of the 631-bp partial CI sequence (GenBank Accession No. JN601884) showed that the virus had 93.6% nucleotide identity and 100% amino acid identity with cognate regions of Turnip mosaic virus (TuMV) (GenBank Accession No. D10927). Our results indicated that the disease was caused by TuMV. To our knowledge, this is the first report of TuMV in tomatillo. Since TuMV has a wide host range and is readily transmitted by green peach aphids, TuMV could be a new threat to tomatillo production in California. References: (1) C. Ha et al. Arch. Virol. 153:25, 2008. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

Desert rose (Adenium obesum (Forssk.) Roem. & Schult, family Apocynaceae) is native to southeastern Africa, and is a perennial potted ornamental with colorful flowers that are popular in Taiwan. Symptoms of mosaic and chlorotic ringspots and line patterns on leaves were observed in July 2010, on all eight plants in a private garden in Potzu, Chiayi, Taiwan. Spherical virus particles with a diameter of approximately 28 nm were observed in crude sap prepared from symptomatic leaves. Virus culture was established by successive local lesion isolation in Chenopodium quinoa and was maintained in the systemic host Nicotiana tabacum van Hicks. The virus was mechanically transmissible to indicator plants and induced symptoms similar to those incited by Cucumber mosaic virus (CMV). Observed symptoms included local lesions on inoculated leaves of C. amaranticolor and systemic mosaic in Cucumis sativus, Lycopersicon esculentum, N. benthamiana, N. glutinosa, and N. rustica. On N. tabacum, necrotic ringspots developed on inoculated leaves followed by systemic mosaic. Serological tests using ELISA assays and western blotting indicated that the virus reacted positively to a rabbit antiserum prepared to CMV (4). Amplicons of an expected size (1.1 kb) were obtained in reverse transcription-PCR with primers specific to the 3′-half of CMV RNA 3 (3) using total RNA extracted from infected desert rose and N. tabacum. The amplified cDNA fragment was cloned and sequenced (GenBank Accession No. AB667971). Nucleotide sequences of the coat protein open reading frame (CP ORF) (657 nt) had 92 to 96% and 76 to 77% sequence identity to those of CMV in subgroups I (GenBank Accession Nos. NC_001440, D00385, M57602, D28780, and AB008777) and II (GenBank Accession Nos. L15336, AF127976, AF198103, and M21464), respectively. Desert roses infected by Tomato spotted wilt virus (TSWV) (1) and CMV (2) have been reported previously. In spite of the plants showing mosaic symptoms similar to that caused by CMV (2) and chlorotic ringspots and line patterns caused by TSWV (1), only CMV was detected in and isolated from these infected desert roses. However, the possibility of mixed infection of CMV and other viruses were not excluded in this research. To our knowledge, this is the first report of CMV infection in desert rose plants occurring in Taiwan. References: (1) S. Adkins and C. A. Baker. Plant Dis. 89:526, 2005. (2) C. A. Baker et al. Plant Dis. 87:1007, 2003. (3) Y. K. Chen et al. Arch. Virol. 146:1631, 2001. (4) Y. K. Chen and C. C. Yang. Plant Dis. 89:529, 2005.

Potato virus S (PVS) is prevalent within potato (Solanum tuberosum) production worldwide. Traditionally, PVS has been split into two strains, Ordinary (PVSO) and Andean (PVSA), based on reaction in herbaceous indicator species such as Chenopodium quinoa. However, recent research has identified further strain designations, such as PVSO-CS (Ordinary and Chenopodium systemic). Forty-four isolates of PVS were collected from potato seed lines in different geographical regions within Tasmania, Australia. Isolates were initially characterized by reactions in C. quinoa. Nineteen isolates were characterized as PVSO, based on the development of local lesions and serological detection in inoculated leaves only. Three isolates were identified as PVSA-like, based on local lesion development in inoculated leaves, mild mottling or chlorotic spots on noninoculated leaves, and serological detection in both inoculated and noninoculated leaves. Thirteen isolates produced no symptoms, and were detected serologically in inoculated leaves only (PVSO-like). Four isolates produced no symptoms but were detected serologically in both inoculated and noninoculated leaves (PVSA-like). Five isolates produced symptoms in inoculated leaves only but were detected serologically in both inoculated and noninoculated leaves (also PVSA-like). The ability of isolates to infect tomato has also been used as a criterion to assist in PVS strain differentiation. A subsample of isolates (n = 16) was unable to infect tomato ‘Grosse Lisse’. Seventeen isolates representative of these groupings based on reactions in C. quinoa were also characterized by coat-protein sequencing. Phylogenetic comparisons suggested that all isolates were PVSO rather than PVSA. Therefore, whereas some of these PVS isolates were systemic in C. quinoa, findings from this study suggest that they were not PVSA, and that only PVSO and PVSO-CS isolates are present in Tasmania. The implications of this finding for disease management are discussed.

Uncommon, viruslike symptoms (yellowing, line patterns, leaf deformation, and necrosis), were observed in spinach fields in the Marathon area, Greece in 2004. Seedlings from the same seed lot, grown in the greenhouse, also developed the same viruslike symptoms, indicating that the causal agent(s) of the disorder is seed-transmissible. Spinach seedlings of the same variety but a different lot and herbaceous indicators (Chenopodium quinoa, C. amaranticolor, Sonchus oleraceus, and Nicotiana benthamiana) were mechanically inoculated with infected material. Spinach developed yellowing or necrotic spots whereas indicators showed variety of symptoms including mosaic, vein banding, and necrotic lesions. Virus purifications, double-stranded RNA extractions, cloning, and sequencing (2,3) followed by a combination of molecular (reverse transcription [RT]-PCR and immunocapture RT-PCR) and serological (ELISA) techniques with antisera provided by Dr. Avgelis were performed as described (4), verifying the presence of two viruses in the diseased seedlings: Sowbane mosaic virus (SoMV), a sobemovirus, was present in spinach and indicators with mottling and leaf deformation, whereas Olive mild mosaic virus (OMMV), a necrovirus, was present in plants with necrotic spots. All RT-PCR products amplified with primers SoMV-F (5′-CAAATGGTCTTGGTCAGCAGTC)/SoMV-R (5′-GCATACGCTCGACGATCTG) and OMMV-F (5′-CAAACCCAGCCTGTGTTCGATG)/OMMV-R (5′-CATCAGTTTGGTAATCCATTGA) were sequenced and found to confirm the other results. The SoMV-spinach isolate polyprotein gene sequence (GenBank Accession No. DQ450973) has 95% sequence identity with the type isolate from C. quinoa (GenBank Accession No. GQ845002), whereas the OMMV-spinach isolate (GenBank Accession No. JQ288895) has 92% sequence identity with the OMMV type isolate from olive (GenBank Accession No. AY616760). SoMV has been found to naturally infect spinach in the Netherlands (1) and, to our knowledge, this is the first report on spinach in Greece. The presence of OMMV in spinach is, to our knowledge, the first report worldwide. Its natural host range is limited to olive, tulip, and now spinach. OMMV might be transmitted by Olpidium spp. and may, according to data of its close relatives, persist in the soil for several decades. Pollen- and seedborne viruses (PSVs) like sobemoviruses and necroviruses are of particular importance for a crop like spinach where crop increase takes place in small, seed production-designated areas. If a PSV spreads in such an area it has the potential to become a major problem for the industry, especially when it remains undetected. Infected seed can be shipped worldwide with PSVs, causing diseases and becoming endemic in areas where they were absent. For this reason and the fact that field losses can exceed 50%, rigorous monitoring for the presence of SoMV and OMMV in seed fields is essential to minimize the possibility of the viruses moving to new areas. References: (1) L. Bos and N. Huijberts. Eur. J. Plant Pathol. 102:707, 1996. (2) S. M. Girgis et al., Eur. J. Plant Pathol. 125:203, 2009, (3) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005. (4) I. E. Tzanetakis et al. Virus Res. 121:199, 2006.

Macroptilium atropurpureum (siratro plants) is a perennial wild legume plant introduced to Taiwan as a forage crop in 1961 (3) and has become a naturalized weed found all over the island. In 2010, siratro plants with virus-like symptoms of mosaic and leaf deformation were observed on the campus of Da-Yeh University in central Taiwan. Flexuous virus-like particles about 750 × 12 nm were observed in the crude sap extracted from symptomatic leaves with a transmission electron microscope. Crude sap was mechanically inoculated to Chenopodium quinoa and local lesions can be observed on inoculated leaves 4 to 5 days after inoculation. Virus was purified from the leaves of inoculated C. quinoa with modified protocols of Gonsalves and Ishii (2). The virus coat protein (CP) consisted of a single major peptide with relative molecular weight of approximately 33 kDa when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Viral RNA extracted from the purified virus was used as a template and was primed with several primer sets corresponding to potyviruses and carlaviruses in reverse transcription-PCR to amplify possible corresponding cDNA fragments. After several attempts, a cDNA fragment of about 1,300 bp could be amplified with the degenerated primer set of BCMNV-F (5′CCDTGGACDGTWGGVATGAC3′) and BCMNV-R (5′CACCAHACCATRAARCCATTCAT3′), which were designed on the basis of the conserved region of the nuclear inclusion b (NIb) and CP genes of some potyviruses including Bean common mosaic necrosis virus, Soybean mosaic virus, Blackeye cowpea mosaic virus, East Asian passiflora virus, and Passion fruit woodiness virus. BLAST analyses showed the amplicon was highly homologous to that of Passiflora virus Y (PaVY). Together with oligo dT, a specific primer (5′GATGACACTCAAATGGCTG3′) corresponding to PaVY CP was used to amplify the cDNA fragment of the most 3′ region of the viral RNA (about 800 bp). The assembled cDNA fragment of 1,958 bp (Accession No. AB679294) contains a partial NIb gene (877 nt), a complete CP gene (819 nt), and the 3′ noncoding region (262 nt). The CP gene shared sequence identities of 89.4 to 98.9% and 92.7 to 98.9% in nucleotide and amino acid, respectively, to that of documented PaVY isolates. PaVY has also been found to be infecting Vigna trilobata, Rhynchosia minima, Clitoria ternatea, and Passiflora foetida in Australia (1). Here we present the first report to our knowledge of PaVY and its infection of siratro (M. atropurpureum) in Taiwan. Additional work is needed to investigate the spread of PaVY and its interaction with other legume plants in Taiwan. References: (1) B. A. Coutts et al. Arch. Virol. 156:1757, 2011. (2) D. Gonsalves and M. Ishii. Phytopathology 70:1028, 1980. (3) Y. Y. Lai et al. J. Taiwan Livestock Res. 42:19, 2009.

Field-grown Echinacea purpurea plants showing necrosis, leaf roll, yellow mosaic, and mosaic symptoms in leaves were collected in June 2010 in Huairou, Beijing, China. ELISAs of extracts of four samples showed that one sample with mosaic symptoms had a positive reaction with Broad bean wilt virus 2 (BBWV-2) monoclonal antibody provided by Professor X. P. Zhou (1). The monoclonal antibody recognized the 44.7 kD coat protein subunit of BBWV-2. We used Chenopodium quinoa as an assay species to isolate the virus by sap transmissions and to maintain the virus strain. Sap from infected C. quinoa, when inoculated onto indicator plant species, induced the following symptoms: C. quinoa: local lesions in inoculated leaves, systemic chlorotic mottle in upper leaves, deformation, and apical necrosis; C. amaranticolor: chlorotic local lesions, systemic mosaic and leaf distortion; Nicotiana benthamiana: systemic mosaic; Gomphrena globosa: local purple spots in inoculated leaves and systemic infection in upper leaves; Tetragonia expansa: local lesions, but no symptoms of systemic infection; Physalis floridana: systemic mosaic. No symptoms were observed on Capsicum annuum, Datura stramonium, N. glutinosa, or N. tabacum cv. White Burley. To confirm BBWV-2 infection, total RNAs extracted from infected C. quinoa leaves were reverse transcripted to cDNA using oligo-dT primer (T17V). The primer pair Fab5′R1F (5′-AAATATTAAAACAAACAGCTTTCGTT-3′) and Fab5′R1R (5′-TTCAAAGCTCGTGCCATNTYATTKGC-3′) for specific detection of the Fabavirus genus (2) was used for PCR analysis. The amplified fragment is between the 5′-terminal non-translatable region (NTR) and the beginning of the coding region of RNA1. Amplicons of approximately the expected size (~391 bp) were produced from the virus-infected C. quinoa and a BBWV-2 positive control (ATCC PV131, PV0537). Amplicons of approximately the expected size (~350 bp) were produced from the BBWV-1 positive control (ATCC PV132). However, no such amplicons were observed from healthy C. quinoa plants and water control. The 391-bp amplicons of RNA1 obtained from the infected C. quinoa were cloned and sequenced. Comparison with sequences of other BBWV-2 isolates showed that the isolate we obtained (No. JX070674) had approximately 99% nt identity (98% amino acid identity) with Chinese BBWV-2 isolate BC (No. FJ485686.1) (3). As an ornamental and medicinal plant, E. purpurea is widely cultivated in northern China. Up until now, Tomato ring spot virus, Tobacco rattle virus, Cucumber mosaic virus, and Tomato spotted wilt virus have been detected or isolated from E. purpurea in the world (4). To our knowledge, this is the first report of BBWV-2 infecting E. purpurea in China. BBWV-2-infected E. purpurea may have less secondary metabolites, which could influence the quality and therapeutic efficacy of this herbal medicine. References: (1) L. Qing et al. Acta Microbiologica Sinica 40:166, 2000. (2) R. M. Ferrer et al. J. Virol. Methods 144:156, 2007. (3) C. Sui et al. Plant Dis. 93:844, 2009. (4) B. Dikova. Bulgarian J. Agric. Sci. 17:306, 2011.

In 2009, more than 50% of vine type French beans were found bearing severe viral symptoms in a vegetable garden in Nantou County, Taiwan. Infected plants were stunted and exhibited pronounced mottling symptoms on their leaves. The symptomatic plants were mechanically inoculated on Chenopodium quinoa and local lesions developed 7 to 10 days after inoculation. The virus source established by back isolation the single lesion from C. quinoa on French beans developed symptoms similar to those found in the field. Host range test showed that this isolate could only infect leguminous plants, including soybean, mung bean, pea, peanut, asparagus bean, cowpea, adzuki bean, and lima bean, but not cucurbitaceous and solanaceous plants. Since only Cucumber mosaic virus (CMV) has been reported in Taiwan to induce similar symptoms in French beans, we tested both the field collected and inoculated French beans by CMV antiserum in ELISA but obtained a negative result. Due to subsequent electron microscopy studies that found potyvirus and carlavirus like particles in the leaf dips of infected French beans, we conducted reverse transcription (RT)-PCR using generic degenerate primers for potyviruses (Hrp5/Pot1 (2) and PotZ/Pot1 (3)) and carlaviruses (Decarla-u2 (5′-TGCACTGARTCMGAYTATGARGCYTT-3′ and Decarla-d1 (5′-GCACATRTCRTCVCCDGCAAA-3′) previously designed in our lab. No amplification was found from the potyvirus primers, while the carlavirus one gave an expected amplicon of 285 bp, which was found sharing 81% nucleotide sequence identity with the replicase gene of Cowpea mild mottle virus (CpMMV) (GenBank Accession No. FJ560903). A primer pair (CpMMV-CPu: 5′-TTTACTCTTAggTWATggAgTC-3′ and CpMMV-CPd: 5′-CCTATTAAAACACACAAHTCAAA-3′) was thus designed to amplify the complete coat protein (CP) gene based on the reported CP sequences and obtained an expected 867-bp product from our French bean isolate. This 867-bp sequence (JX020701) was confirmed to have 97.6% amino acid sequence identities with the CP gene of a Puerto Rican CpMMV isolate (GU191840). In a separate survey, another isolate from asparagus bean (CpMMV-V) causing mild mottling symptom was obtained. Analyses of the CP gene of CpMMV-V (JX070669) confirmed that it shared 88.8% and 97.8% of nucleotide and amino acid sequence identities with the French bean isolate, respectively. Different from most carlaviruses with aphid transmissibility, CpMMV has been shown to be transmitted non-persistently by whiteflies (1). Both CpMMV isolates from Taiwan were confirmed to be transmitted by silver leaf whiteflies (Bemicia argentifolii Bellows and Perring). This is the first record of whitefly transmissible legume virus in Taiwan. Since whitefly has been a problem in agriculture worldwide, CpMMV can be a new emerging threat for Taiwan's legume crop production. References: (1) M. Iwaki et al. Plant Dis. 66:365, 1982. (2) S. S. Pappu et al. J. Virol. Methods 41:9, 1993. (3) F. M. Zerbini et al. Phytopathology 85:746.

In August 2012, field-grown pepper (Capsicum annuum) plants were inspected for the presence of viral diseases in Moravia, Czech Republic. Leaves taken from plants showing virus-like symptoms were examined for the presence of pepper viruses by double antibody sandwich (DAS)-ELISA. Of the 80 collected samples, 22 were infected with Cucumber mosaic virus, 17 with Potato virus Y, 13 with Broad bean wilt virus-1, and 11 with Broad bean wilt virus-2 (BBWV-2). The BBWV-2 positive samples were collected near the villages of Hrádek and Tasovice in Znojmo District and Loděnice in Brno-Country District. Six samples positive for BBWV-2 were also infected with one or two other viruses. BBWV-2 was mechanically transmitted from the field-collected samples where it was present alone onto Chenopodium quinoa plants. After systemic mottling emerged on indicator plants, symptomatic leaves were collected and the presence of BBWV-2 was confirmed by electron microscopy and reverse transcriptase (RT)-PCR. Isometric particles of about 25 nm corresponding in size and shape to the BBWV-2 virions (2) were observed. Total RNA was extracted from infected C. quinoa leaves, and RT-PCRs with primer pairs specific to four BBWV-2 genome regions (1) were carried out using oligo-dT and random hexamer mixtures for the cDNA synthesis. Amplicons of expected sizes, ~400 bp for Fab5′R1, ~460 bp for Pol2, ~500 bp for MP4, and ~250 bp for SCP were obtained for all samples. To the best of our knowledge, this is the first report of a natural occurrence of BBWV-2 in the Czech Republic. References: (1) R. M. Ferrer et al. Arch. Virol. 156:1445, 2011. (2) V. Lisa and G. Boccardo. The Plant Viruses 5:229. Plenum Press, New York, 1996.

Quinoa (Chenopodium quinoa Willd.) has become increasingly popular due to its high nutritional value and adaptability to harsh environments. Several field trials have recently been conducted to determine the ability of quinoa cultivars to grow under climate and soil conditions of Republic of Korea. During July 2013, which is the rainy season, plants showing typical symptoms of downy mildew were first observed in an experimental plot in Iksan City, Korea. Infection resulted in small to large, irregular chlorotic areas on the upper leaf surface with a gray mildew developing on the abaxial surface, and often leading to early defoliation. The same symptoms of downy mildew were also found in Pyeongchang County and Imsil County, Korea. A sample from Iksan City was deposited in the Korea University Herbarium (Accession No. KUS-F27388) and used for microscopy and molecular studies. Microscopic examination revealed colorless conidiophores emerging from stomata, straight to slightly curved, 350 to 550 × 10 to 18 μm, and sub-dichotomously branched in 5 to 7 orders. Ultimate branchlets were mostly in pairs, flexuous to curved, 10 to 30 μm long, and had obtuse tips. Conidia were pale brown to olivaceous, broadly ellipsoidal to ellipsoidal, and 25 to 32 × 22 to 25 μm with a length/width ratio of 1.20 to 1.35. These characteristics fit well with Peronospora variabilis, which was previously recorded to be parasitic to C. quinoa and C. album, although P. farinosa f. sp. chenopodii has often been considered a causal agent of downy mildew on quinoa (1). To confirm this morphological identification, amplification and sequencing of the internal transcribed spacer (ITS) region of the rDNA of the Korean specimen were performed using procedures outlined by Choi et al. (1) with oomycete-specific primers DC6 and LR0. The resulting 796-bp sequence was deposited in GenBank (Accession No. KF887493). A comparison with the ITS sequences available in GenBank revealed that it is identical to P. variabilis found on C. album (EF614959, EF614961), and shows only one base pair substitution with another isolates from C. quinoa (EU113305, EU113306). Therefore, the pathogen found in Korea was confirmed to be P. variabilis. Downy mildew is the most damaging disease of quinoa in Argentina, Bolivia, Colombia, Ecuador, and Peru (1). Increasing reports of this disease from India, Canada, the United States, Portugal, and Denmark (2,3,4) have revealed its worldwide occurrence and spread. To our knowledge, this is the first report of a downy mildew on quinoa in Korea (3). It suggests that quinoa downy mildew poses a new and serious threat to production of this crop in Korea. References: (1) Y. J. Choi et al. Mycopathologia 169:403, 2010. (2) S. Danielson et al. Seed Sci. Technol. 32:91, 2004. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved November 5, 2013. (4) A. L. Testen et al. Plant Dis. 96:146, 2012.

In the summer of 2012, zucchini (Cucurbita pepo L.) plants of F1 hybrid Rigas showing very severe malformation and blisters in leaves and fruit were observed in the prefectures of Ilia and Messinia, Peloponnese, southwestern Greece. Over 100 samples were collected and only a few were found by double antibody sandwich (DAS)-ELISA to be singly or mixed infected with the commonly encountered Cucumber mosaic virus (CMV, genus Cucumovirus), Zucchini yellow mosaic virus (ZYMV, genus Potyvirus), and Watermelon mosaic virus (WMV, genus Potyvirus), to which Rigas is known to be tolerant. All affected plants were also tested by DAS-ELISA and RT-PCR (2) for the presence of Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not previously reported in Greece, and were consistently found positive by both methods. Sap from plants in which MWMV was solely detected was used to mechanically inoculate Chenopodium quinoa Willd. and cucurbit species (zucchini, cucumber, melon, and watermelon). C. quinoa produced chlorotic local lesions, while cucurbits showed very severe mosaic and malformation of leaves. Zucchini plants of F1 hybrids Rigas, Golden (tolerant to WMV and ZYMV), and Elion (not exhibiting any tolerance) grown in a screenhouse produced equivalent severe symptoms on leaves and fruits. Furthermore, transmission experiments in a non-persistent manner using a clone of Myzus persicae Sulz. and zucchini plants of F1 hybrid Boreas as donor and test plants were carried out. Ten plants were used in each experiment (one aphid/plant) and this was repeated five times (50 plants in total). The transmission rate was high ranging from 75 to 90%. RT-PCR obtained amplicons of 627 bp were subjected to direct sequencing (GenBank Accession No KF772944), which revealed 99% sequence identity to the corresponding region of a MWMV Tunisian isolate (EF579955). In 2013, in addition to zucchini plants found MWMV positive, watermelon (Citrullus lanatus Thunb.) plants from the same region of Peloponnese showing leaf malformation and mosaic symptoms were found MWMV positive (4/30) by DAS-ELISA and RT-PCR, revealing the virus establishment and further spread. In the Mediterranean basin, the virus has already been reported in Morocco, Italy, France, Spain, Tunisia, and Algeria, where it has emerged recently from a common source, has quickly become established through rapid dissemination and is considered as an important emerging threat (4). Isolates from these countries, including the present one from Greece, are very closely molecularly related to each other, contrary to isolates from sub-Saharan Africa (South Africa, Sudan, Congo, Zimbabwe, Niger, Cameroon, Nigeria) that are much more divergent (1,3). To our knowledge, this is the first report of MWMV in Greece. References: (1) H. Lecoq et al. Plant Dis. 85:547, 2001. (2) H. Lecoq et al. New Dis. Rep. 16:19, 2007. (3) A. T. Owolabi et al. Int. J. Virol. 8:258, 2012. (4) S. Yakoubi et al. Arch. Virol. 153:775, 2008.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Galvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Quinoa (Chenopodium quinoa Willd.) is increasingly produced outside its native Andean range. In September 2019, stem lesions were observed on all six plants of quinoa accessions PI 510547 (25% severity) and PI 596293 (75% severity) in a demonstration plot in Ames, IA. Lesions were bleached, silvery-white to dark gray, slightly sunken, oval to linear with slightly tapered tips and contained setose acervuli. Fungi were isolated from both accessions following disinfestation with 70% ethanol and plating onto ½ acidified potato dextrose agar (APDA) and V8 medium. Isolates were examined morphologically. On V8 medium, isolate CQ1 produced sparse, flat, gray mycelia with profuse sclerotia and hyaline, aseptate, cylindrical conidia (n= 50, mean: 21.0 (range: 19.2-24) by 4.3 (2.4-4.8) µm); isolate CQ2 produced fluffy, gray to dark gray mycelia with profuse sclerotia and acervuli and hyaline, aseptate, falcate conidia (n =50, 26.8 (24-31.2) by 2.4 µm). Direct hyphal PCR was used to amplify ITS (ITS1/ITS4), ACT (ACT-512F/ACT-783R), GAPDH (GDF1/GDR1), CHS-1 (CHS-79F/CHS-234R), and TUB2 (T1/Bt-2b, CQ1 only) (Fu et al. 2019, Liu et al. 2013), and products were sequenced bidirectionally (MT772082-3, MT786524-30). A maximum likelihood tree was generated in MEGA X (Kumar et al. 2018) from a multiple sequence alignment of vouchered CBS isolates (Liu et al. 2013) and CQ1 was identified as Colletotrichum nigrum. CQ2 sequences showed 99-100% similarity to Colletotrichum truncatum sequences in Genbank (MN581860, MK675238, MF682518, MK118057). Koch's postulates were completed once with two isolates of each species grown on V8 medium under 12 hours of near UV light for two weeks. Greenhouse conditions were a 12 hr day/night cycle and temperature range of 26-30° C. Approximately 5 mL of mycelium on agar medium was sterilely removed and macerated in 6 mL of sterile distilled water. Non-inoculated medium was macerated in sterile water as a control. Forty-day old quinoa PI 634920 were inoculated by making three, 2-3 mm incisions between the cotyledons and first true leaves with a sterile razor blade. Next, 500 µL of slurry was placed on 2.54 cm2 of sterile cheesecloth and placed against the wound and wrapped with Parafilm. Six plants were inoculated per isolate and control. After two weeks, sunken, bleached to tan areas extended past wound sites of inoculated plants. No discoloration or sunken tissue was observed on control plants. Plants were tented with plastic film for one week. Acervuli were observed on C. truncatum- and C. nigrum-inoculated stems, and sclerotia were observed on C. nigrum-inoculated stems. Stems were surface disinfested with 10% bleach and plated onto ½ APDA. Colony morphologies of isolated fungi matched those of original inoculum for inoculated plants. Colletotrichum spp. were never isolated from control plants. When stems were inoculated, approximately 100 µL of slurry was also placed on 3-5 detached quinoa leaves in Petri dishes with moistened blotter paper and incubated for 48 hours at 25° C. Brownish, circular lesions developed on leaves inoculated with either species, but no lesions developed on control-slurry leaves. Colletotrichum spp. cause disease in quinoa relatives including spinach (Kurt 2015), beets (Gourley 1966) and amaranth (Wu 2001). This is the first description of Colletotrichum spp. causing stem lesions on quinoa in the United States. This disease may emerge in new quinoa production regions and may cause yield losses due to lodging.

Quinoa (Chenopodium quinoa Willd.) has been cultivated for centuries as an important subsidiary grain crop. In early August 2015 and 2016, Choanephora stem rot symptoms were observed on plants of Quinoa cultivar Longli 1 in a field with 0.3 ha planting area in Yanqing district, Beijing, China. This disease caused about 70% yield loss of quinoa. Disease symptoms initially appeared as water-soaked spots on the stem that turned into brown to dark brown lesions covering the whole stem, often resulting in the infected part breaking off the rest of the plant. Serious infections often caused the plant to wither and die under high humidity. The infected tissues produced an abundance of sporangiophores bearing brown to black sporangiola. To isolate the causal agent, sections of diseased stem were surface disinfected with sodium hypochlorite, placed on acidified potato dextrose agar (APDA), and incubated at 25°C with a 12-h photoperiod. Two isolates were obtained (ZD61 and ZD62). The colonies of both isolates grew quickly on PDA and were initially white with abundant aerial mycelia. The mycelia later turned pale yellow and produced abundant sporangiophores bearing sporangiola. Sporangiophores were smooth, hyaline, and aseptate, erect, unbranched, and apically dilated to form a clavate vesicle, which produced dichotomously branched and distally clavate secondary vesicles bearing monosporous sporangiola. Monosporous sporangiola were broadly ellipsoid, indehiscent, pediculate, brown to dark brown, with distinct longitudinal striations, and were 7 to 15 μm wide and 11 to 24 μm long by measuring 30 sporangiola. Sporangia contained few or multiple spores. They were also spherical, initially white to yellow, and pale brown to dark brown at maturity and measured 63 to 160 μm. Single-celled sporangiospores were aseptate, ellipsoid, and brown to pale brown, with multiple hyaline polar appendages and striations on the wall. They were 6 to 11 μm wide and 9 to 22 μm long by measuring 50 spores. The morphological and cultural characteristics of both isolates were identical to those of Choanephora cucurbitarum (Berk. & Ravenel) Thaxt. (Kirk 1984). Genomic DNA was extracted from the isolates with the DNA Isolation Kit (Sangon Biotech, Shanghai, China). The internal transcribed spacer (ITS) regions of the two isolates were sequenced using primers ITS1 and ITS4 (White et al. 1990). The two resulting sequences were submitted into NCBI (GenBank MG650193 and MG650194), which were 99% identical to known C. cucurbitarum strains (GenBank KY080447, KY080446, KU877802, and KR873353) according to a BLAST analysis. Pathogenicity tests were conducted on hypocotyls of 4-week-old quinoa seedlings inoculated with 2-day-old mycelia plugs. Control plants were inoculated with sterile APDA plugs. Plants were incubated under humid conditions for 3 days and then transferred to a greenhouse (28°C). After 4 to 5 days, lesions were evident on the stems of inoculated plants but not on control plants. After 7 days, all inoculated plants had developed brown stem lesions and were wilted. Additionally, C. cucurbitarum was reisolated from the inoculated plants, fulfilling Koch’s postulates. The fungus C. cucurbitarum reportedly has a wide host range. In China, C. cucurbitarum was recently observed on Moringa oleifera causing seed pod rot (He et al. 2017). However, to our knowledge, this is the first report of C. cucurbitarum causing stem rot on C. quinoa in China or globally.

Potato virus S (PVS genus Carlavirus; family Betaflexiviridae) naturally infects potato (Solanum tuberosum) and pepino (Solanum muricatum) and experimentally can infect other species of the families Solanaceae and Chenopodiaceae. Two strains of PVS have been described: PVSO (ordinary) and PVSA (Andean), depending on the symptoms induced on Chenopodium quinoa. In potato, PVS can cause yield losses of up to 20% (Stevenson et al., 2001). Arracacha (Arracacia xanthorrhiza) is an Andean root crop grown mainly in Peru, Colombia, Ecuador, Brazil and Bolivia (Hermann, 1997). Using newly designed universal primers (e-Xtra 1), confirmed to amplify fragments of the RdRp region of carlaviruses from potato and sweet potato, we could amplify a band of 340 bp from an asymptomatic arracacha plant collected on August 2011 from a smallholder in Cajamarca, Peru. The fragment was sequenced, revealing closest nt similarity of 76% with a sequence of PVS (JQ647830.1) available in GenBank. We then tested 20 arracacha accessions ...

Grapevine fanleaf virus (GFLV) was detected in samples of Bermuda grass (BG) from Iran by reverse transcription-polymerase chain reaction (RT-PCR) using two different pairs of GFLV-specific primers, and also by enzyme-linked immunosorbent assay (ELISA) using antiserum specific for a North American isolate of the virus. RT-PCR detected GFLV in both fresh and dried BG tissues and in virus preparations purified from these plants. Cloning and sequencing of the RT-PCR products confirmed that the amplified sequences were sections of the GFLV coat protein gene. Similar results were obtained when random and oligo(dT) primers were used on viral RNA templates recovered from BG to synthesize cDNA for cloning and sequencing. The virus induced few or no symptoms in BG, but could nonetheless be transmitted from BG to Chenopodium quinoa by mechanical inoculation. Some isolates induced systemic chlorotic spots and leaf deformation; others remained symptomless in this plant. Both symptomatic and symptomless C. quinoa plants were found to be infected with GFLV, giving positive ELISA and RT-PCR tests. A North American isolate of GFLV was found to be mechanically transmissible to BG as indicated by positive RT-PCR results from root samples of inoculated plants. GFLV-infected BG was widely distributed in the Fars province of Iran.