Search

In 2021 and 2022, virus-like symptoms were observed in several cultivars of industrial hemp (Cannabis sativa) in two fields in central Washington, USA. Affected plants had a range of symptoms at different developmental stages, with young plants having severe stunting with shortened internodes and reduced flower mass. Young leaves of infected plants also showed light green to total yellowing, and twirling with twisting margins (Fig. S1). Infections of older plants caused less foliar symptoms that consisted of mosaic, mottling, and mild chlorosis on a few branches with tacoing of older leaves. To assess if symptomatic hemp plants were infected with Beet curly top virus (BCTV) as reported earlier (Giladi et al., 2020; Chiginsky et al., 2021), symptomatic leaves were collected from 38 plants, and the extracted total nucleic acids tested by PCR to amplify a 496-base pair (bp) fragment specific to BCTV coat protein (CP) using primers BCTV2-F 5'-GTGGATCAATTTCCAG-ACAATTATC-3' and BCTV2-R 5'-CCCATAAGAGCCATATCA-AACTTC-3' (Strausbaugh et al. 2008). BCTV was found in 37 of the 38 plants. To further assess the virome of symptomatic hemp plants, total RNA was extracted from symptomatic leaves of four plants using Spectrum total RNA isolation kits (Sigma-Aldrich, St. Louis, MO) and subjected to high-throughput sequencing on an Illumina Novaseq platform in paired-end mode (University of Utah, Salt Lake City, UT). The raw reads (33 to 40 million per sample) were trimmed based on quality and ambiguity and resulting paired-end reads of ≈142 bp length were assembled de novo into a pool of contigs (CLC Genomics Workbench 21, Qiagen Inc.). Virus sequences were identified through BLASTn analysis in GenBank (https://www.ncbi.nlm.nih.gov/blast). One contig of 2,929 nucleotides (nt) obtained from one sample (accession no. OQ068391) showed 99.3% identity with BCTV-Wor strain reported from sugar beet in Idaho (accession no. KX867055 Strausbaugh et al., 2017). Another contig of 1,715 nt from a second sample (accession no. OQ068392) shared 97.3% identity with BCTV-CO strain (accession no. KX867022). Two contig sequences of 2,876 nt (accession no. OQ068388) and 1,399 nt (accession no. OQ068389) obtained from the 3rd and 4th samples showed 97.2% and 98.3% identity, respectively, with Citrus yellow vein-associated virus (CYVaV, accession no. MT893740.1) reported in industrial hemp from Colorado (Chiginsky et al., 2021). Contigs of 256 nt sequence (accession no. OQ068390) obtained from the 3rd and 4th samples also showed 99-100% identity with Hop Latent viroid (HLVd) sequences in GenBank (accessions OK143457 and X07397). These results indicated single infections of BCTV strains and co-infection of CYVaV and HLVd in individual plants. To confirm theagents, symptomatic leaves were collected from 28 randomly selected hemp plants and tested by PCR/RT-PCR using primers specific to BCTV (Strausbaugh et al., 2008), CYVaV (Kwon et al., 2021) and HLVd (Matoušek et al., 2001). Amplicons specific to BCTV (496 bp), CYVaV (658 bp) and HLVd (256 bp) were detected in 28, 25, and 2 samples, respectively. BCTV CP sequences obtained by Sanger sequencing from seven samples showed 100% sequence identity with BCTV-CO and BCTV-Wor strains in six and one samples, respectively. Similarly, sequences of CYVaV- and HLVd-specific amplicons showed 100% identity with corresponding sequences in GenBank. To the best of our knowledge, this is the first report of two strains of BCTV (BCTV-CO and BCTV-Wor), CYVaV, and HLVd infecting industrial hemp in Washington state.

Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43% (1 field in CA); for BLRV from 0% (2 fields in CA, 2 fields in ID, and 3 fields in OR) to 100% (2 fields in CA); for AMV from 0% (2 fields in CA and 4 fields in ID) to 100% (1 field in OR); for SRAV from 0% (2 fields in CA) to 100% (1 field in OR). Multiple samples had mixed infections of 2, 3, and even 4 viruses (1 sample from CA and 1 sample from OR). The role of each of these viruses in observed alfalfa virus-like symptoms and in an overall effect on productivity awaits further investigation. While SRAV was found before in alfalfa fields in Idaho (Dahan et al. 2022) and Washington (Postnikova et al. 2023), this is the first report of the virus presence in alfalfa crops in Oregon and in Northern California.

Acorus calamus var. angustatus Besser, a perennial herb of the Araceae family, was first reported in the Shen Nong's Herbal Classic and is widely distributed in southern China (Li 1979). It is important in traditional Chinese medicine for treating heart, stomach, and brain ailments (Lam et al. 2016). In March 2024, leaf spots were found on its leaves in a traditional Chinese medicine planting base in Yuexi County (30°91'56″ N, 116°19'24″ E), Anhui Province, with an incidence of about 35%. The symptoms began as small, light brown lesions that expanded, resulting in necrotic lesions ranging from 1 to 8 mm in diameter with brown halos. 3 × 3 mm sections, including both symptomatic and asymptomatic tissues, were cut from six infected plants. They were disinfected in 75% ethanol for 30 s, washed three times with sterile distilled water, transferred to Petri dishes containing potato dextrose agar (PDA) and incubated at 25 °C in the dark. Purified fungal isolates were obtained by the single-spore isolation method. The colonies on PDA initially appeared white, gradually became olive-green with 1 to 3 mm white margins and abundant aerial hyphae, while the reverse was greyish green to black. The conidia were light brown, ellipsoidal, obclavate, and 10.0 to 49.5 µm × 4.5 to 16.4 µm (mean 23.9 × 10.2 µm, n=50) in size, with 0 to 6 transverse septa and 0 to 6 longitudinal or oblique septa (n=50). Conidiophores were thick, dark brown, single-celled, with multiple conidial scars, measuring 12.8 to 146.8 × 2.9 to 6.1 (mean 50.6 × 4.2) µm (n=50). Based on above observations, the pathogen were identified as Alternaria spp. (Simmons 2007). Three representative isolates, SCP-1, SCP-2, and SCP-3 were selected for molecular identification. The Internal transcribed spacer (ITS), Alternaria major allergen ( Alt a 1 ), and translation elongation factor 1-alpha ( TEF1 ) genes were amplified with the primers ITS1/ITS4 (White et al. 1990), Alt-for/Alt-rev (Woudenberg et al. 2015) and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. The sequences of the three isolates were consistent, and the sequences of isolate SCP-1 were submitted to NCBI GenBank (ITS, PP723104; Alt a1 , PP708704; TEF1 , PP708703). The ITS region of isolate SCP-1 was 100% similar to A. alternata TCS3002 (MN394880, Wang et al. 2023), the Alt a 1 gene was 100% similar to A. alternata CBS 620.83 (KP123868), and the TEF1 gene was 100% similar to A. alternata CBS 916.96 ex-type (KC584634). A phylogenetic tree based on sequences of ITS, Alt a 1 and TEF1 genes was constructed using the neighbor-joining method in MEGA 7 software, confirming the fungus as A. alternata . Three healthy plants of A. calamus var. angustatus were spayed with conidial suspension (1 × 10 7 conidia/ml) of isolate SCP-1. Three additional plants sprayed only with sterile distilled water were controls. All plants were covered with plastic bags to maintain a relative humidity of 90% for 48 h and incubated at 25 °C under a 12-h light photo-period. Twelve days post-inoculation, brown necrotic lesions developed on the inoculated leaves, enlarged, and the symptoms were similar to the original ones. The control plants remained healthy. The fungus was re-isolated from the infected plants and confirmed by morphological traits and molecular methods, fulfilling Koch's postulates. To our knowledge, there are no other reports of this fungus on A. calamus var. angustatus in Anhui, China. This report will help identify the disease based on field symptoms and provide a basis for disease management strategies of A. calamus var. angustatus .

Amorphophallus konjac, commonly known as konjac, has significant economic and medicinal value, particularly in Asian countries (Gao et al. 2022). In July 2024, an outbreak of leaf blight was observed in a one-hectare field in Fuyuan (25.67°N; 104.25°E), Yunnan, China. The disease manifested as brown lesions starting at the leaf tips or edges, which rapidly darkened and expanded, leading to leaf necrosis. In severe cases, the disease affected the overall plant health, reducing corm yield and quality significantly. To isolate the causal agent, six diseased leaves from six plants were surface disinfected, and the junction region of healthy and diseased tissues was excised and homogenized in a 15-ml sterile centrifuge tube with 2 ml of sterile distilled water. The resulting bacterial suspension was serially diluted to 10-5 and 200 μl of the diluted sample was spread on LB agar plates. Three pure cultures (designated MY1, MY2, and MY3) were obtained through successive streaking. The isolated colonies were light yellow, convex, and nearly round in shape. Genomic DNA from the three pure isolates was extracted and used to amplify partial sequences of 16S ribosomal RNA (16S rRNA) with primers 27F/1492R (Brady et al. 2008), the beta-subunit of RNA polymerase (rpoB) using primers CM81-F/CM32b-R (Polz and Cavanaugh 1998), and the DNA gyrase subunit B (gyrB) with primers UP-1/UP-2r (Yamamoto and Harayama 1995). The sequences for 16S rRNA (accession nos. PQ288765-PQ288767), rpoB (PQ304887-PQ304889), and gyrB (PQ304884-PQ304886) were deposited in GenBank. Nucleotide BLAST analysis showed that the rpoB, gyrB and 16S rRNA sequences of isolate MY1 shared 99.36, 98.89 and 99.86% identity with those of K. cowanii strains (EU629168, CP107077 and OR121838), respectively. Furthermore, a multigene phylogenetic analysis revealed a strongly supported clade including strain MY1, MY2, MY3 and other K. cowanii isolates. To test pathogenicity, a greenhouse experiment was conducted using five four-month-old healthy A. konjac plants grown in pots. For each plant, three leaves were inoculated with a bacterial suspension of strain MY1 (108 CFU/ml) via leaf infiltration. Another set of three leaves were infiltrated with sterile water as controls. These plants were enclosed in plastic bags for 24 hours post-inoculation. Inoculated plants initially exhibited brown lesions with a yellow halo, which subsequently developed into dark symptoms within seven days. Control plants remained symptom-free. This experiment was repeated three times with consistent results. K. cowanii was reisolated from infected leaves and identified based on Sanger sequencing of 16S rRNA, thus fulfilling Koch's postulates. In recent years, K. cowanii has been confirmed to cause fruit blotch on Trichosanthis fructus (Chen et al. 2024), stalk rot in foxtail millet (Han et al. 2023), bacterial wilt on patchouli (Zhang et al. 2022), and bacterial blight on soybean (Krawczyk and Borodynko-Filas 2020). To our knowledge, this is the first report of K. cowanii causing leaf blight on A. konjac worldwide. This study identifies a previously unrecognized disease affecting konjac production. The identification of the causal agent provides essential information for the diagnosis and management of this disease.

Syrian rue (Peganum harmala L) belongs to the family Zygophyllaceae and is mainly distributed in arid and semi-arid areas of Xinjiang, Gansu, Ningxia, Qinghai, and Inner Mongolia in China. It serves as a pioneer species in soil and water conservation, as well as in reclamation of wastelands, playing a crucial role in soil preservation and stabilization against sand encroachment. In 2023, a disease resembling root rot and wilt affected the quality and yield of Syrian rue in Xilingol (122.67°N, 42.78°E), Inner Mongolia, China. Symptoms ranged from yellowing to wilting, accompanied by darkening of the xylem in the roots. This disease was observed in approximately 50% of Syrian rue plants in desertification-prone grassland. A total number of 45 symptomatic root samples were collected from Syrian rue plants to isolate the pahogen. Small pieces of diseased tissue were surface sterilized with 75% alcohol for five seconds, rinsed twice with sterilized water, dried, and then placed on water agar and incubated for 72 h at 25℃ in darkness. A total of 45 isolates were obtained, showing identical morphology and sequences of the internal transcribed spacer region (ITS), translation elongation factor 1-alpha (EF1-α) and RNA polymerase II second largest subunit (RPB2) genes. Therefore, the isolate LTP-5 was used as the representative for further study. On potato dextrose agar (PDA), fungal colonies of LTP-5 exhibited yellow to light brown colore with white aerial mycelia and irregular growth after 7 days of incubation at 25℃. Conidia and chlamydospre development were observed in carboxymethylcellulose sodium medium. Chlamydospores were abundant, terminal or intergrown between hyphae, rough brown walls of 5.9 to 19.82 μm in diameter (n = 75) were observed in the culture. Macroconidia had 5 to 7 septa, thick in the middle and thin at both ends, measured 28.17 to 62.81 μm in length and 1.50 to 4.19 μm in width (n = 128). Microconidia were absent. The morphological characteristics were consistent with the descriptions of Fusarium equiseti (Nelson et al., 1983). The pathogen was further confirmed to be F. equiseti by sequence analysis of the ITS, EF1-α and RPB2 genes amplified using polymerase chain reaction (PCR) with the primers ITS4/ITS5 (White et al., 1990), EF-1/EF-2 (O'Donnell et al., 1998), and RPB2-5F2 /fRPB2-7cR (Zhen et al., 2017). The sequences showed 100% similarity to the F. equiseti strain in the NCBI GenBank with accession numbers MH054914.1, KJ396323.1, and KT213286.1 for ITS, EF1-α, and RPB2, respectively. The sequences of PCR products were submitted to GenBank with accession numbers PP814863.1 (ITS), PP831628.1 (EF1-α) and PP826937.1 (RPB2). Pathogenicity tests were conducted through a pot assay. Five Syrian rue seedlings were inoculated by immersing plant roots in a suspension of 1×107 spores/mL for 30 min and transplanting to pots containing autoclaved soil. Control plants were immersed in sterile water. The inoculated plants showed yellow and root rot but no symptoms were observed on control plants. The same fungus was successfully re-isolated and identified based on the morphological characterization and sequence analyses from the infected root tissue but not from non-inoculated plants. In addition, F. equiseti has been reported to cause disease on Sugar beet (Khan et al., 2021), Watermelon (Rahman et al., 2021), potato (Cui et al., 2021), and other plants. This is the first report confirming F. equiseti as causal agent of Syrian rue wilt and root rot in China.

Stevia rebaudiana is a promising medicinal and edible plant, widely cultivated in China. In 2022-2023, a new leaf spot disease occurred in S. rebaudiana in Hongxing country (32°34'55″N, 118°2'12″E), Dingyuan city, Anhui province. Symptoms were observed on 10 to 15% of plants in three S. rebaudiana nursery beds (0.1 ha in total). The typical symptoms included dark brown spots on the leaves and foliar wilting, the development of brown stems with dieback of top buds, and occasional plant death (Fig. 1a). To identify the pathogen, twenty diseased leaves were collected, cut into small pieces, surface sterilized with 75% ethanol for 30 s, in 0.5% sodium hypochlorite for 2 min, washed three times in sterile water, placed on PDA, and incubated at 25℃ for 5 days. Pure cultures were prepared by subculturing hyphal tips. Twenty-five Stagonosporopsis-like isolates with similar morphology were obtained. After 7 days growth on PDA, colonies had a regular margin, were cottony, and formed concentric circles on the surface that were gray-green. The reverse side of the culture was dark brown with a creme-orange and white, margin. The growth rate was 9.5 mm/day on PDA. Pycnidia were mostly solitary, globose or subglobose, pale to dark brown, thin-walled, glabrous, ostiolate, 95.735~250.851×90.93~266.32 μm (n=50). Conidia were oblong, cylindrical to ellipsoidal, smooth-walled, aseptate, with rounded ends and two polar guttules and measured 3.41 to 5.83 × 1.78 to 3.07 μm (n = 50) (Fig.1 b-d). For molecular identification, the internal transcribed spacer (ITS) rDNA, large ribosomal subunit (LSU) gene, β-tubulin (TUB2) gene and RNA polymerase II (RPB2) gene sequences of two representative isolates (TYJ-SP1 and TYJ-SP2) were amplified by PCR (Woudenberg et al. 2009; Dong et al. 2021). The sequences were deposited in GenBank (accession nos.: OR506193 and OR506194 for ITS, OR533526 and OR533527 for LSU, OR545221and OR545222 for TUB; OR545223 and OR545224 for RPB2) and showed 99.60% to 99.2% similarity to ITS (502/504 bp and 507/511 bp; MZ156571), 100% similarity to LSU (857/857 bp and 857/857 bp; MZ191532), 98.67% to 99.3% similarity to TUB2 (296/300 bp and 298/300 bp; MZ203132) and 99.78% (888/890 bp and 868/870 bp; MZ203135) of S. pogostemonis strain ZHKUCC 21-0001. A maximum likelihood phylogenetic analysis based on the concatenated sequences of ITS, LSU, TUB2 and RPB2 using MEGA 11.0 showed the strains TYJ-SP1 and TYJ-SP2 formed a clade with S. pogostemonis (Fig. 2). Thus, the strains were identified as S. pogostemonis (Dong et al. 2021). To test pathogenicity, the strain TYJ-SP1 was inoculated onto 30-day-old S. rebaudiana seedlings which were surface sterilized with 70% alcohol and washed 3 times with water and air dried prior to inoculation. Ten seedlings were sprayed with a conidial suspension (105 conidia/mL) and ten seedlings were sprayed with sterile water to serve as the negative control. All seedlings were maintained in a growth chamber (25°C, 90% relative humidity) with a 16 h photoperiod. Brown spots were first observed on inoculated leaves 48 h after inoculation; typical symptoms appeared by 7 days post inoculation. All inoculated plants developed symptoms similar to naturally infected plants in the nursery beds, and the disease incidence reached 100% while control plants remained symptom free (Fig. 1 e-f). The same Stagonosporopsis isolates were reisolated from the inoculated plants and identified based on morphological and phylogenetic analyses. S. pogostemonis has been reported to cause leaf spot in Pogostemon cablin and Brassica oleracea var. botrytis (Dong et al. 2021; Habib et al. 2024). To our knowledge, this is the first report of S. pogostemonis causing leaf spot on S. rebaudiana in China. As a medicinal and economic plant, S. rebaudiana is widely planted in China and other Asian countries. The occurrence of this leaf spot disease seriously affects its medicinal and economic value. Therefore, it is crucial to establish and implement effective disease management practices to reduce the impact of the disease.

Dictyophora rubrovolvata, as an edible fungus with high medicinal value, is widely cultivated in several provinces in China (Hang et al. 2012). However, between December 2023 and March 2024, a rot disease occurred in the main production area in Fengxian District, Shanghai, China (N30°93', E121°49'). The disease incidence was 25% in the affected 1.33-ha growing area. High temperatures (>25℃) and poor ventilation provide favorable conditions for the spread of this disease. The disease mainly occurs at the stage of fruiting bodies formation of D. rubrovolvata. When the epidermis is damaged and broken, it becomes infested with mold, which then produces a layer of moldy rot with pus. The infected D. rubrovolvata tissues at the edge of the lesions were isolated, surface sterilized and cultured on potato dextrose agar (PDA) at 30 ℃ under dark conditions. Pure cultures were obtained by single-spore isolation. After 3 days, isolates were transferred to Czapek Yeast agar (CYA) (Samson et al, 2014). On CYA, the fungal colony consisted of white flocculent hyphae. Scanning electron microscopy analysis showed that the mycelium was white, and the internodes of the stolons formed characteristic pseudoroots, from which upwardly clustered erect, unbranched sporocarp peduncles expanded apically to form rounded sporocarp sacs, within which sporocarp spores were produced. (Hariprasath P, 2019). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS) and intergenic spacer (IGS) gene of the isolate were amplified by PCR (White et al. 1990; Liu XY. 2008). The resulting sequence was deposited in GenBank with accession PP951880 and PQ001670, respectively. PCR results and morphological observations indicated the isolated strain was a pure culture and the strain was designated as DIC01. Comparative results showed that the sequences with accession numbers MT603964.1 and DQ990323.1 showed high homology of 99.15% and 98.96% to the ITS and IGS sequences of Rhizopus arrhizusi DIC01, respectively. Phylogenetic analysis with ITS and IGS genes of the isolated strain and 7 Rhizopus spp. strains were performed using MEGAX with Neighbor-Joining (NJ) method. Based on the results of growth habits, morphological observations, and phylogenetic analysis, the pathogen was identified as R. arrhizusi. A spore suspension of the R. arrhizusi DIC01 (1 x107 conidia/mL) was inoculated back to healthy D. rubrovolvata. Five healthy fruit bodies of D. rubrovolvata were injected, and another five healthy morels were treated with potato dextrose broth (PDB) as controls. D. rubrovolvata was incubated at 25°C and 90% relative humidity without ventilation for 5 days. The pathogen successfully infected the D. rubrovolvata, which developed white moldy lesions similar to those of natural diseases. The controls remained healthy without any symptoms. The pathogen was reisolated from the affected lesions and identified as R. arrhizusi DIC01 based on its morphological characteristics and phylogenetic marker genes. R. arrhizusi has been reported to cause endothelial cell damage and mycelial invasion into blood vessels, leading to thrombosis and tissue necrosis. (Hariprasath P, 2019). To our knowledge, this is the first report of R. arrhizusi causing rot disease of D. rubrovolvata. This study confirmed that R. arrhizusi is the pathogenic fungus responsible for rotting disease in D. rubrovolvata farms in Fengxian, Shanghai.

Halo blight of hop, caused by Diaporthe humulicola, has increased in eastern North America since 2018. When left untreated, the disease can cause yield loss ranging from 17-56%. Currently, there are no fungicides registered for use on halo blight of hop. From 2020 to 2022 field trials were conducted using 10 fungicides registered for use on powdery and downy mildew of hop to determine their efficacy against halo blight. To validate field results, the EC50 value was determined for each active ingredient including flutriafol, tebuconazole + fluopyram, cyflufenamid, and trifloxystrobin + salicylhydroxamic acid (SHAM). Each fungicide tested had an EC50 value less than 50 ppm. A discriminatory dose was used to test the sensitivity of 206 D. humulicola isolates collected from the eastern U.S. and Canada in a poison agar assay. Results showed that tebuconazole + fluopyram decreased the incidence and severity of halo blight in the field. Also, this fungicide combination had EC50 values of 2.26 x 10-1 ppm and significantly reduced the growth of most of the isolates tested. Trifloxystrobin + SHAM decreased the presence of halo blight in the field tiral, but some isolates were less sensitive in discriminatory dose testing. Our results show that fungicides in FRAC groups 3, 7, and 11 were the most effective to control halo blight. Analyses of field trials showed a positive correlation between the severity of early season downy mildew infections and late season halo blight infections.

Common lambsquarters ( Chenopodium album Linn.) is one of the most problematic weeds associated with crops worldwide due to its fast-growing, high fecundity, and wide tolerance to various conditions. Meanwhile, C. album is also an herbaceous vegetable plant, and the leaves and young shoots of this plant are considered nutritious in the human diet (Aman et al. 2016). In September 2023, C. album plants exhibiting yellowing, stunted growth, and extensive galled root symptoms were collected from a yam field in Fengqiu (34°54'24"N; 114°34'57"E), Henan Province, China. At the selected sampling site, we randomly selected 100 C. album plants, and the disease incidence was 73% on a 0.67-ha field. A RKN species belonging to the genus Meloidogyne was found, comprising an average of 550 second-stage juveniles (J2s) from 100 g of the 10 to 30 cm soil layer. The J2s were isolated from fresh soil with a Baermann funnel. C. album roots were thoroughly washed with tap water and dissected. Nematodes at different stages were collected and morphologically identified. Females and egg masses were obtained by dissecting galls. Females were white with a protruding neck, globular to pear-shaped. The perineal patterns of females predominantly exhibited a pronounced dorsal arch, characterized by either a square or trapezoid shape, lacking obvious lateral lines. Males isolated from root galls were vermiform, annulated, and showed a trapezoidal labial region, including a high head cap that was concaved at the center of the top end in lateral view. J2s were distinguished by the conspicuous, round stylet knobs, and they had wrinkled tails with a hyaline region and an obtuse tip. Morphological measurements are described in the supplementary material. All features were consistent with the morphological characteristics of Meloidogyne incognita (Eisenback and Hirschmann 1981). Identification was accomplished with subsequent species-specific PCR and sequencing analysis. The genomic DNA of 10 individual females was extracted, and the molecular identification was carried out with M. incognita -specific primers Mi-F/Mi-R, and Inc-K14-F/Inc-K14-R (Meng et al. 2004; Randig et al. 2002). PCR amplification generated 955 and 399 bp fragments for the analyzed samples, respectively, and the amplicons were confirmed by sequence analyses. The sequences were deposited in GenBank under accession number PP836070 and PP836071. BLASTn searches showed 100% identity with available GenBank M. incognita sequences (accession no. MK410954, OQ427638). To verify reproduction on C. album , 10 healthy plants (30 days old) grown in pots with sterilized soil were inoculated with 1,000 M. incognita J2s under greenhouse conditions (light/dark: 16 h/8 h, temperature: 25-28°C). Five uninoculated plants were used as negative control. Two months after inoculation, stunted growth and root-galling symptoms were observed similar to those in field, whereas control plants remained symptomless. Many root galls and egg masses were observed in all inoculated plants. The root galling index (scale of 0 to 10; Poudyal et al. 2005) was ~7 and nematode reproduction factor (final population density/initial population density) was 5.3. The morphological features of the nematodes reisolated from root tissue closely match the description of M. incognita , fulfilling Koch's postulates. The pathogenicity test was carried out twice with similar results. M. incognita is an emerging disease of economic importance in many crop plants worldwide, and may cause serious economic losses (Phani et al. 2021). This widely distributed C. album plant is likely a reservoir for the pathogen and serves as an alternate host for nematodes. The findings are significant for the integrated management practices of RKNs, particularly for crops that are infested with C. album . To our knowledge, this is the first report of the nematode parasitizing C. album in China. The development of effective short- and long-term control procedures is urgently needed for managing M. incognita .

Fritillaria unibracteata Hsiao et K. C. Hsia is a recognized source of 'Chuanbeimu' in the 'Chinese Pharmacopoeia'. In China, its bulbs have been used as a traditional herbal cough remedy for about 2,000 years. Surveys for fungal diseases were conducted in Xiaojin and Songpan, Sichuan Province, the primary cultivation region of F. unibracteata, with an area of 150 acres, in May and July 2022. Rust was found in almost all areas and incidence ranged from 5% to 80% in all study areas. Diseased leaves displayed yellow spots on the upper side, and raised buff, golden, or fuscous waxy pustules on the lower side. In severe cases, the infection extended to the stems and petioles, leading to wilting and death of plant. Spermogonia, aecia, and telia were mainly found on the underside of leaves. Spermogonia were scattered among the aecia and exhibited a range of colors from honey-yellow to chestnut-brown. They had a cross-sectional diameter of 94.4 to 214.3 µm height and 94.2 to 197.5 µm in width (n=30). They were nearly spherical, embedded in the host tissue, and had distinct periphysis at the pores. Aecia were hemispherical, initially white, with the peridium later turning yellowish-brown and opening via a central pore. Aeciospores were pale yellow, finely and closely verrucose, measuring 20.6 to 34.1 × 18.4 to 30.1 µm with a cell wall thickness of 1.5 to 2.4 µm (n=51). Prior to plants wilting, elongated telia were observed, gradually exposed, then finally opening through longitudinal cracks in the epidermis. Teliospores were unicellular, dark brown, oblong to oval, and solitary on stems, measuring 24.7 to 38.2 × 19.2 to 27.8 µm (n=130) with a wall thickness of 1.6 to 3.1 µm, with a low hyaline papilla at the apex and were moderately rugose with longitudinal parallel ridges. The characteristics align with previous descriptions of Uromyces aecidiiformi (Rees, 1917, Zhuang, 2005). The primer pair LR0R (Moncalvo et al., 1995)/LR5 (Vilgalys & Hester, 1990) was utilized for amplifying and sequencing the large subunit of the nuclear ribosomal RNA genes from strains IS909-3 and IS1816 (GenBank PQ008482, PQ008483). The obtained sequences showed a high similarity of 99.9% to 100% similarity to strains U1023 and UBC19 of U. aecidiiformis in RustHubb (KR0014142 and PUN23000)( Kaishian et al., 2024). Through examination of morphology, host range, and sequence similarity, we determined the rust species to be U. aecidiiformis. Pathogenicity testing was conducted by spraying a suspension of aeciospores (1×105 spores/mL in 0.05% Tween 20 solution) on six healthy four-year-old F. unibracteata plants indoors in May 2023. The plants were allowed to grow under natural conditions, where the diurnal temperature ranged from 9 to 20℃, with an average temperature of 14℃, which is conducive to the growth of F. unibracteata. Another six seedlings were sprayed with 0.05% Tween 20 solution as controls. After three weeks, all infected plants showed symptoms similar to those seen in the field, while control plants remained symptom-free. Microscopic examination and sequencing confirmed that the pathogen morphology was consistent between the field and the inoculation, meeting Koch's postulates. Although U. aecidiiformis has been previously reported to cause rust of F. pallidiflora and F. ussuriensis(Zhuang, 1989, Zhuang, 2005), this is the first report of U. aecidiiformis causing rust on F. unibracteata in China. This pathogen significantly reduces the yield and quality of Chuanbeimu, highlighting the importance of effectively identifying and controlling it.

Artemisia argyi is a perennial herb native to East Asia. It is an important traditional Chinese medicinal plant known for its strong flavor and medicinal effects. It is rich in active ingredients and has a wide range of biological activities, including anti-inflammatory, antioxidant, and immune regulation properties. From May to July in 2023, a serious leaf rot outbreak occurred on A. argyi in several farms (approximately 200 acres) in Tanghe county (32°46'44" N, 112°43'13" E), Henan Province, China. The incidence rate reached 65% (n=200). Pale yellow spots (1-2 cm in diameter) first appeared on the leaves, then expanded to form irregular yellowish-brown lesions, eventually causing the entire leaves to wither. Diseased leaves (30) were collected and cut into 5 x 5 mm2 pieces in the areas between infected and healthy tissues. The excised plant tissues were sterilized in 75% ethanol and 1% sodium hypochlorite solution for 30 seconds and one minute, respectively. The tissues were then rinsed with sterile water and placed on potato dextrose agar (PDA) followed by incubating at 25 °C for 3 days. The isolated strains belonged to the genera Fusarium and Alternaria. After pathogenicity verification, 25 purified Fusarium strains were obtained. Three representative strains (AC-Q, AC-X, AC-Y) from different regions were used for further studies. Each strain formed abundant aerial mycelium that was initially white and later developed into purple pigments. Aerial conidiophores were sparsely branched, terminating with verticillate phialides. Macroconidia were slender, straight, and measured 21.8 to 47.5 × 3.1 to 4.4 μm, with two to four septa. Microconidia were clavate and measured 8.31 to 11.6 × 2.1 to 3.5 μm. Morphological characteristics were consistent with the species description of Fusarium verticillioides (Sacc.) Nirenberg 1976 (Leslie and Summerell, 2006). The rDNA internal transcribed spacer (ITS), β-tubulin gene (tub2), translation elongation factor 1-alpha gene (tef1), calmodulin (cmdA), RNA polymerase II largest subunit (rpb1) and RNA polymerase II second largest subunit (rpb2) were amplified for molecular identification (O'Donnell et al., 2022). The sequences were deposited in GenBank with accession Nos. OR960548, OR960552, OR960555 (ITS), OR972413, OR972414, OR972415 (tub2), OR797685, OR797686, OR797687 (tef1), OR972410, OR972411, OR972412 (cmdA), PP035106, PP035107, PP035108 (rpb1), and PP035109, PP035110, PP035111 (rpb2). BLASTn analysis of AC-Q sequences exhibited 99 to 100% similarity with F. verticillioides sequences (strains CBS 576.78) MT010888 of cmdA, MT0109566 of rpb1, and MT010972 of rpb2. A phylogenetic tree was constructed with concatenated sequences (tub2, tef1, cmdA, rpb1, rpb2), alongside the sequences of the type strains using the neighbor-joining method. The three strains formed a clade with the type strain CBS 576.78 of F. verticillioides, and were separated from other Fusarium spp. These morphological and molecular identifications indicated that the pathogen was F. verticillioides. Pathogenicity was tested on 10 healthy 2-month-old potted seedlings by spraying them with a conidial suspension (106 conidia ml-1), and 5 seedlings were sprayed with sterilized water as a control. The plants were placed in a climate incubator at 28°C and a relative humidity of approximately 90%. Ten days after seedling inoculation, typical lesions were observed on the treated plants, except in the control group. The reisolated strains were identified as F. verticillioides by morphological and molecular characterization, fulfilling Koch's postulates. F. verticillioides is known to cause Fusarium ear rot on maize, as well as diseases on other plants in China such as Brassica rapa (Akram et al., 2020) and Schizonepeta tenuifolia (Li et al., 2024). This is the first report of F. verticillioides causing leaf rot on A. argyi worldwide. Identification of the pathogen is crucial for implementing management approaches to reduce yield losses.

Trichosanthes kirilowii Maxim. ( Cucurbitaceae ), one of the Chinese herbal medicines, is an economically important crop in Anhui Province, China. In recent years, gummy stem blight disease, a major disease of cucurbits, was widespread in many T. kirilowii plantations. The initial symptoms on the naturally infected stems appeared as dark brown water-soaked lesions, and as the disease progressed, vines of T. kirilowii gradually withered. On leaves, brown water-soaked lesions were visible initially, and then lesions enlarged and coalesced, resulting in extensive necrosis of leaves. On fruit, lesions covered with the white mycelium were nearly circular and tan to brown initially. Subsequently, the diseased fruit turned black and rotten commonly known as fruit rot or black rot. A Stagonosporopsis -like organism was consistently isolated from symptomatic stems, leaves and fruits. Fungal isolates were initially white and later turned dark grey or black with woolly to floccose aerial mycelium on PDA medium. Twenty-four isolates from different plantations were selected for further morphological studies. Pycnidia and conidia were formed after inoculating on cucumber fruit for 3 days. Pycnidia were globose to sub-globose, brown, ostiolate and 106.7 to 213.6 μm (average 160.1 μm, n = 50) in diameter. Conidia were hyaline, ellipsoidal, aseptate or one-septate, slightly constricted at the septa, 6.1 to 13.6 × 3.5 to 4.8 μm (average 9.9 × 4.1 μm, n = 50), and contained two or more oil drops. Three different loci of the genomic DNA, including the nuclear ribosome DNA internal transcribed spacer ( ITS ), RNA polymerase II second-largest subunit ( RPB2 ), and β-tubulin ( TUB2 ) genes., were amplified using primers ITS1/ITS4 (White et al. 1990), RBP2DF/RBP2DR (Lawrence et al. 2013), and T1/β-Sandy-R (O' Donnell and Cigelnik 1997; Stukenbrock et al. 2012), respectively and sequenced. A phylogenetic tree was built based on analysis of ITS , RPB2 , and TUB2 sequences that deposited in GenBank (MW485497-MW485502 for ITS, MW531661-MW531666 for RPB2, and MW531667-MW531672 for TUB2), using the maximum likelihood method. The phylogenetic tree showed that the isolates fell into a single clade with S. cucurbitacearum . On the basis of morphological and molecular characteristics, the isolates obtained from T. kirilowii were identified as Stagonosporopsis cucurbitacearum . Pathogenicity tests were carried out on stems and leaves of 4-week-old T. kirilowii seedlings and on immature fruit collected from adult T. kirilowii plants. The epidermis, previously injured with a syringe needle, was inoculated with 5-mm-diameter mycelial plugs, and the inoculated areas were then wrapped in water-soaked cotton. Controls were similarly inoculated with agar plugs. The diameters of lesions were measured in two perpendicular directions. Re-isolations from the stem and leaf lesions were performed on the PDA medium. Stagonosporopsis cucurbitacearum , was re-identified based on its colony and conidial characteristics and, therefore, completed Koch's postulates. Gummy stem blight caused by S. cucurbitacearum has been reported in a wide range of hosts, including cucumber, luffa, pumpkin, gourd, muskmelon, cantaloupe, and watermelon (Jiang et al. 2015; Keinath 2011; Zhao et al. 2019). To our knowledge, this is the first report of gummy Stem blight disease on T. kirilowii caused by S. cucurbitacearum in China. The research provides a basis for the development and implementation of effective management strategies. Pathogenicity tests were carried out on stems and leaves of 4-week-old T. kirilowii seedlings and on immature fruits collected from adult T. kirilowii plants. The epidermis, previously injured with a syringe needle, was inoculated with 5-mm-diameter mycelial plugs, and the inoculated areas were then wrapped in water-soaked cotton. Controls were treated similarly but inoculated with agar plugs. Diameters of lesions were measured in two mutually perpendicular directions. Reisolations from the lesions were performed on PDA medium, and was re-identified based on its colony and conidial characteristics to complete Koch's postulates. Gummy stem blight caused by S. cucurbitacearum have been reported in a wide range of hosts, including cucumber, luffa, pumpkin, gourd, muskmelon, cantaloupe, and watermelon (Jiang et al. 2015; Keinath 2011; Zhao et al. 2019). To our knowledge, this is the first report of gummy Stem blight disease on T. kirilowii caused by S. cucurbitacearum in China. The research provides a basis for the development and implementation of effective management strategies.

Taibai Beimu (Fritillaria taipaiensis) is a species of Fritillaria commonly used in traditional Chinese medicine for its antitussive, expectorant, and antihypertensive properties. In April of 2021 and 2022, an incidence 10-30% of yellowing or purpling, wilting, and dying symptoms was observed on Taibai Beimu in Wanyuan, Sichuan province. Infected roots and bulbs displayed spots ranging from brown to black, along with necrotic rot. In severe cases, the entire bulbs rotted. Fifteen symptomatic bulbs were cut into 0.5 × 0.5 cm pieces, surface sterilized in 75% ethanol for 30 s and 1% sodium hypochlorite for 3 min under aseptic conditions, rinsed with sterile water 3 times, and air-dried. The segments were placed on potato dextrose agar (PDA) and incubated at 25℃ for 7 days in the dark. Six Clonostachys-like monospore isolates were obtained. Colonies on PDA reached 32 to 43 mm in diameter in 7 days at 25℃ in the dark, felty to tomentose to granulose aerial mycelia with a white or light yellow appearance, and reverse colors matching. On cornmeal-dextrose agar, primary conidiophores had a Verticillium-like structure with 1 to 3 levels. Stipes were 36.1 to 236.3μm long. Phialides formed in whorls of 2 to 5, 15.3 to 45.7μm long, 1.1 to 3.4μm wide at the base, and 1.03 to 2.41μm wide near opening (n=95). Each producing a small hyaline drop of conidia. Conidia were 3.7 to 11.3μm × 2.1 to 4.1μm (n=110). Secondary conidiophores displayed Penicillium-like structures, and stipes were 23.1 to 142.3μm long. Phialides formed in compressed whorls of 4 to 8 per metula, 7.0 to 16.0μm in length, 1.3 to 3.1μm in width at the base, 1.8 to 3.6μm at the widest point, and 0.8 to 1.8μm near opening (n=50). Conidia were 3.0 to 6.4μm ×1.6 to 3.4μm (n=65). The morphology was consistent with the previous description of Clonostachys rosea (Hans-Josef et al. 1999). The ATP citrate lyase (ACL1), β-tubulin (TUB2), translation elongation factor 1-α (tef1α), and the nuclear ribosomal internal transcribed spacer (ITS) of three strains were amplified and sequenced using primers acl1-230up/acl1-1220low (Gräfenhan et al. 2011), T1/CYLTUB1R (Crous et al. 2004; O'Donnell and Cigelnik 1997), EF1-728F/EF2 (Carbone and Kohn 1999; O'Donnell et al. 1998), and ITS1/ITS4 (White et al. 1990), respectively. Blastn homology search showed a > 97% similarity to the ex-type strains of C. rosea (CBS710.86). All sequences have been deposited in GenBank (PP394342 to PP394350, and PP396901 to PP396903). A phylogenetic tree was constructed using Bayesian analysis based on the alignment of the combined ACL1, TUB2, tef1α, and ITS sequences through IQ-TREE. The tree displayed clustering with known strains of C. rosea. Pathogenicity was confirmed by inoculating five healthy five-year-old Taibai beimu plants with a spore suspension (1.0 × 106 spores mL-1) of the strain WYEB1101, while sterilized water was used as a control. The inoculation process involved pouring the spore suspension over the wounded bulbs and covering with them sterile soil. Subsequently, all plants were cultivated in sterile soil indoors under natural conditions suitable for Taibai beimu. The pathogenicity assays were repeated twice. After 20 days of cultivation, the infected plants displayed symptoms similar to those observed in the field, while all control plants remained asymptomatic. Sequencing confirmed the re-isolation of C. rosea from the inoculated plants, satisfying Koch's hypothesis. Clonostachys rosea has been previously reported to cause root rot of Chinese medicine herb, such as Astragalus membranaceus and Gastrodia elata (Lee et al. 2020; Qi et al. 2022). To our knowledge, this is the first report of C. rosea infecting Taibai Beimu in China, highlighting a potential risk to this crop.

Xanthomonas phaseoli pv. manihotis ( Xpm ) is a plant pathogenic bacterium known as the causal agent of cassava bacterial blight (CBB). CBB is the most limiting bacterial disease affecting cassava ( Manihot esculenta Crantz), characterized by diverse symptoms including angular water-soaked leaf lesions, blight, wilting, stem exudates, stem cankers and dieback. CBB has been reported in most cassava-growing regions around the world, and, under conducive conditions, crop yield losses can reach up to 100% (Zárate-Chaves et al. 2021). While Xpm genetic diversity is remarkably high in South America (Bart et al. 2012) and cassava originates and was domesticated in the Amazon basin (Allem 2002), reports of CBB in the Amazonian region are missing. To fill this gap, in October 2018 we surveyed for CBB symptoms in cassava fields of the Orellana Province, located in the Amazon forest of the Republic of Ecuador. Adult cassava plants exhibiting typical angular, water-soaked leaf lesions were found in polyculture plots, i.e. intercrops of cassava with other species such as plantains and fruit trees ( a.k.a. chakras ). After surface disinfection with 5% sodium hypochlorite followed by 70% ethanol, white Xpm -like colonies were isolated from diseased leaf tissues of four plants on YPGA medium (yeast extract, 5 g/l; peptone, 5 g/l; glucose, 5 g/l; agar-agar, 15 g/l) supplemented with cephalexin (40 mg/l) and cycloheximide (50 mg/l). Pathogenicity tests were performed on peat-potted, 2-month-old cassava plants of the cultivar 60444. Bacterial suspensions were adjusted to an OD 600 of 0.2 (2 × 10 8 CFU/ml) in sterile 10-mM MgCl2 and syringe infiltrated in fully-expanded leaves. In parallel, 20 µl of each bacterial suspension adjusted to an OD 600 of 0.02 (2 × 10 7 CFU/ml) were inoculated on stems inside a hole previously punched with a sterile needle in the junction of the third-top petiole. Sterile 10-mM MgCl 2 was used for mock inoculations in both leaves and stems, and experiments were replicated in three plants. Plants were incubated in a greenhouse at 28 ± 1°C with a 12-h photoperiod. Infiltrated leaves developed watersoaking 3 days post inoculation, while wilted leaves, stem exudates, and dieback were observed 21 days after stem inoculation. Control plants remained symptomless. White Xpm -like colonies were re-isolated from symptomatic leaves (Fig S1). One colony of each of the four Xpm isolates (before and after re-isolation) was assessed using diagnostic PCRs (Bernal-Galeano et al. 2018; Flores et al. 2019), using strain Xam668 as positive control. All four candidates were positive for both diagnostic tools. The sequences of the housekeeping genes atpD , dnaK , efp , glnA , gyrB and rpoD of our isolates were extracted from full genome sequences obtained through Oxford Nanopore Technologies (ONT) (GenBank OR288194 to OR288217) and compared to their homologs in four close Xanthomonas species and a reference Xpm strain (Table S1). The sequences of the tested strains aligned with that of Xpm CIO151 (GCA_004025275.1) (Arrieta-Ortiz et al. 2013) with nucleotide identity above 99.92% (Fig S2). The four strains were named CIX4169, CIX4170, CIX4171 and CIX4172, stored in the IRD Collection of Xanthomonas, where they are available upon request. To our knowledge, this is the first report of CBB in the Amazonian region and in Ecuador, where cassava is a central element for local culture and economy. Further surveys will be necessary to evaluate the distribution and prevalence of CBB in other ecozones of Ecuador where cassava is cultivated.

In 2022, virus-like symptoms were observed in a field of diverse hemp (Cannabis sativa L.) germplasm in Ontario County, New York. Less than 1% of plants exhibited stunting and curled leaves (Figure S1), consistent with tobacco streak virus (TSV) symptoms on other plants (Liu et al. 2022). Most typically, the plants were considerably reduced in overall size, with upwards, adaxial curling along the leaf margin with newer leaves appearing to be the most affected. Fifteen symptomatic plants representing nine accessions were tested for 12 viruses and viroids through Agdia Testing Services (Elkhart, IN). Of these, eight plants representing five accessions including: G 33204 21UO SD ('Cherry Wine S1'), G 33211 21UO SD ('Wife'), G 33225 22CL01 CL ('Candida #2'), G 33270 22UO SD ('Falkowski CBD Mix'), and G 33365 22UO SD ('Queen Dream'), were positive for TSV, a type of Ilarvirus in the Bromoviridae family. Presence of TSV was confirmed through enzyme-linked immunosorbent assay testing. TSV is a positive-sense, single-stranded RNA virus with a wide host range that can be transmitted by thrips, mechanical injury, seed, and pollen (Zambrana-Echevarría et al. 2021). To confirm the presence of TSV, two putatively TSV-infected samples were subjected to RNA-Seq analysis. RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Aarhus, Denmark) per manufacturer's direction. Stranded RNA libraries were prepared using the Illumina TruSeq Stranded Total RNA with Ribo-Zero Plant kit (San Diego, California, USA). Paired-end 2x150bp sequencing was performed on an Illumina NovaSeq6000 sequencer. RNA-Seq data was trimmed using the fastp program (Chen et al. 2018) with default parameters to remove adapter sequences and low-quality bases. After filtering, 49,696,041 and 56,126,804 paired-end reads were retained from 'Wife' and 'Falkowski CBD Mix' samples, respectively. Filtered RNA-seq reads were mapped to TSV genome accession GCF_000865505.1 using the bowtie2 (Langmead & Salzberg 2012) aligner with default parameters. From 'Wife' and 'Falkowski CBD Mix' samples, 153 and 139 reads mapped to the TSV reference genome. To further validate the presence of TSV reads, RNA-Seq data was analyzed using the Kraken2 pipeline (Wood et al. 2019). Using the Kraken2 virus database, reads associated with TSV (NCBI taxonomy ID: 12317) were identified. This analysis identified 172 and 151 TSV reads from 'Wife' and 'Falkowski CBD Mix,' respectively. Higher numbers of reads identified using the Kraken2 analysis is due to the more permissive k-mer matching approach implemented in Kraken2. Furthermore, we identified several other virus taxa in the samples. Of note, both samples had a high number of reads associated with Amazon lily mild mottle virus with 254,493 and 116,150 reads from 'Wife' and 'Falkowski CBD Mix,' respectively. Among other virus species belonging to Ilarviruses, Cassava Ivorian bacilliform virus and Cowpea chlorotic mottle viruses were detected from both samples. To further validate infection by TSV, samples from both ELISA-positive and ELISA-negative plants were subjected to PCR using the primers and protocol described in Zambrana-Echevarría et al. 2021. Amplification of an approximately 700 base-pair product was observed in the putatively ELISA-positive samples, but not in the ELISA-negative samples. The amplicons were further cloned into the pGEM-T Easy vector (Promega, Madison, WI, U.S.A) using the manufacturer's protocol and sequenced using M13 forward and M13 reverse primers (Functional Biosciences, Madison, WI, U.S.A). Sequencing results indicated considerable similarity to TSV genomes available in GenBank, between 88% and 99%. Raw sequence data generated from this study was deposited in NCBI under the bioproject ID PRJNA1009441. Though it cannot be ruled out that the observed symptoms were caused exclusively by TSV infection due to the high number of other viral reads, the results contribute to the literature that indicates hemp can host TSV and should be considered a potential source of TSV inoculum (Chiginsky et al. 2021). This new inoculum source could cause significant crop damage and economic loss when grown with TSV susceptible row and specialty crops.

Macleaya cordata (Willd.) R. Br. is a perennial herbaceous medicinal plant (Papaveraceae) commercially cultivated in China which has been studied for detumescence, detoxification, and insecticidal effect (Lin et al. 2018). In August 2021, anthracnose was observed in 2-year-old M. cordata plants in Benxi county, northeast China (41°45'48″N, 123°69'15″E). Dozens of irregular reddish-brown spots (3-11 mm) were observed on each diseased leaf. The lesions were covered with a layer of gray-white mycelia. As the disease progressed, the spots became necrosis and perforation or they would merged into large lesions, ultimately resulting in wilted leaves (Fig. 1). More than 33% of the plants in a 16-ha field were infected in 2021. The diseased leaves were collected and cut into 3-8 mm pieces, surface-disinfested by immersing them into 1% NaOCl for 2 min, and rinsed three times with sterile distilled water. They were then dried with sterilized absorbent paper, placed on PDA medium amended with chloramphenicol (40 mg/L), and incubated in darkness at 25°C with a 12-h photoperiod. Twenty isolates (BLH1 to 20) were obtained and purified using a single-spore method. Isolate BLH12 was identified and used for the pathogenicity test. Colonies were sparsely fluffy with smooth edges, and gradually became gray to pale orange from the initial white. The underside of the colonies was pale orange towards the center. Conidia were single-celled, cylindrical, and transparent with broadly blunt ends, measuring (15.13 ± 1.14) × (5.80 ± 0.60) μm (n=50). Appressoria were single-celled, brown-to-dark brown, usually elliptical or irregular, and sometimes lobed. Setae were not observed. The isolate was initially identified as Colletotrichum gloeosporioides complex (Prihastuti et al. 2009). The identification was confirmed as described previously (Weir et al. 2012). The rDNA internal transcribed spacer region (OP415560), the glyceraldehyde-3-phosphate dehydrogenase (OP433642), chitin synthase (OP433643), calmodulin (OP433644), actin (OP433645), glutamine synthetase (OP433646), β-tubulin (OP433647), and superoxide dismutase (OP433648) gene sequences were obtained (Carbone & Kohn 1999; Weir et al. 2012), and BLAST searches revealed 99-100% homology with the type culture ICMP 18608 (JX010244, JX010044, JX009683, JX009443, JX009744, JX010078, JX010389, and JX010311). A phylogenetic analysis of combining all loci indicated BLH12 and the type strain of C. aenigma were clustered in one group (Fig. 2). Based on the basis of morphological characteristics and phylogenetic relationships, BLH12 was identified as C. aenigma . For the pathogenicity test, healthy 2-year-old plants were sprayed with a BLH12 spore suspension (1 × 10 5 /mL). Control plants were sprayed with sterile water.There were three replicates (five plants each) per treatment. All plants were incubated at 25°C (12-h photoperiod and 86% relative humidity) and examined after 7 days. The experiment was repeated twice. The inoculated plants showed lesions on the leaf surface, similar to those in the field, whereas the control plants were asymptomatic. The pathogen was successfully reisolated and identified as the methods mentioned above. This fungus reportedly infects the leaves of many woody plants in China (Wang et al. 2020; Zhang et al. 2021). This is the first report of C. aenigma causing anthracnose on M. cordata , which will provide an guideline for developing effective field control practices for the disease.

Hypericum chinensis is growing in popularity amongst consumers in cut-flower and pop-flower market as an ornamental woody plant for its florid berry and colorful flower. In August 2019, a new leaf spot disease was observed on  H. chinensis in three commercial nurseries in Kunming (25°05'N, 102°72'E), Yunnian province, China. Disease symptoms were observed on approximately 40% of the plants one year after planting and 30% of the leaves were infected. Leaf symptoms began as small, water-soaked lesions on young leaves which later became larger, dark brown and necrotic. The lesion size ranged from 0.2 to 2.8 cm in diameter. For pathogen isolation, three samples of symptomatic leaves were collected from four different nurseries. The leaves were cut into 0.5 mm pieces, surface sterilized using 70% ethanol for 30 s, and 3% NaOCl for 5 min, rinsed three times in sterilized distilled water and plated on potato dextrose agar (PDA) (Zhou et al. 2023). The plates were incubated at 26°C in the dark for 3 days. Eight isolates with comparable morphological characteristics were obtained. Initially, colonies produced pale gray to white aerial mycelia, turning dark gray after 5 days. The isolates produced hyaline, single celled, straight and cylindrical conidia, with mean size 9.7 to 14.8 μm long × 3.7 to 5.6 μm wide ( n = 100). Morphological characteristics were consistent with Colletotrichum sp. (Bailey and Jeger 1992). For molecular analysis, genomic DNA was extracted from three representative isolates (XSD1, XSD3 and XSD5), amplified using the primers ITS1/ITS4 (Yin et al. 2012) and T1/Bt2b (Glass and Donaldson 1995) and submitted to sequencing (Weir et al. 2012). DNA sequences of the isolates XSD2, XSD3 and XSD8 were identical. DNA sequences of a representative isolate XSD2 were deposited in GenBank (accession no. MW202334 for ITS, and OR347007 for TUB 2 ). MegaBLAST analysis of the ITS and TUB2 sequences showed 99.5% and 99.3% similarity with C. kahawae strain ICMP 18539 (accession no. NR_120138.1 for ITS) and strain IMI319418 (JX145227.1 for TUB 2 ). Pathogenicity tests were conducted by inoculating the pathogen on healthy mature leaves of H. chinensis in the field. Ten leaves (two leaves/plant) were inoculated by spraying conidial suspension (10 6  spores/ml) of isolates XSD1, XSD3 and XSD5, and covered with plastic bags to maintain high humidity for 48 hours, respectively. Leaves treated with sterile distilled water served as a control. All inoculated leaves showed symptoms similar to those observed in the field at 23±5°C 10 days after inoculation. No symptoms developed on non-inoculated leaves. The pathogen was re-isolated from inoculated diseased leaves and identified as C. kahawae based on morphological and molecular characters. C. kahawae has been reported to cause leaf spot on cultivated rocket in Italy (Garibaldi et al. 2016), and anthracnose disease on tree tomato in Colombia (Rojas et al. 2018), to our knowledge, this is the first report of C. kahawae causing anthracnose on H. chinensis worldwide. Due to important ornamental and economic value of H. chinensis , the distribution of C. kahawae needs to be investigated and monitored for effective disease management strategies to be developed.

Stachys byzantina belongs to the Labiatae and is known by the names "peixinho-da-horta" (Brazil) and "lamb's ear" (USA). Its importance is associated with its medicinal properties (Bahadori et al. 2020) and nutritional aspects (Milião et al. 2022). Root-knot nematodes cause severe damage to plants and suppress production. In January 2021, plants of S. byzantina in the municipality of Jaboticabal (21°14'38.7"S, 48°17'10.6"W) showed symptoms of reduced growth, yellowed leaves and the presence of galls in the roots. Initially, samples of roots from a S. byzantina were analyzed at the Nematology Laboratory (LabNema/UNESP), Jaboticabal, Brazil, estimating 20,000 eggs and juveniles of Meloidogyne sp. in 10 g of roots. To confirm the host ability of the species, a pathogenicity test was performed using Koch's postulate. For this purpose, the test was conducted in a greenhouse where 3,000 eggs and second-stage juveniles (J2) were inoculated onto three plants (n=3) of S. byzantina. After 90 days, the inoculated plants showed the same symptoms as those observed in the field. No symptom or nematode was detected in the uninoculated plant (control). Nematodes were extracted from the roots of inoculated plants and quantified. The perineal pattern of females (n=10) (Netscher and Taylor, 1974) and the labial region of males (n=10) (Eisenback and Hirschmann, 1981) were analyzed and compared with the morphological characteristics of the original description of the species (Chitwood, 1949). For analysis based on esterase isozyme phenotype, the α-method of Esbenshade and Triantaphyllou (1990) was used, and females (n=7) were examined. To confirm identification, whole genomic DNA from an adult female (n=1) was extracted using the Qiagen DNeasy® Blood & Tissue Kit and this sample was used for both genetic sequencing and the sequence-characterized amplified region techniques (SCAR). PCR amplifications were performed for the 18s rRNA gene using primers 988F and 1912R from Holterman et al (2006). Our sequence was deposited in GenBank (NCBI) under the identifier OP422209. Finally, species-specific SCAR primers (Fjav/Rjav, Me-F/Me-R, and Finc-F/Finc-R) designed by Zijlstra (2000) were used to identify Meloidogyne spp. Koch's postulate analysis yielded the following results: (n=1) 9,280 eggs and J2 (Reproduction factor, RF = 33.09); (n=2) 111,720 eggs and J2 (RF = 37.24); (n=3) 59,700 eggs and J2 (RF = 19.9) (RF mean = 30.08). The following characteristics were observed in the perineal region of females: Low and rounded trapezoidal dorsal arch with two distinct lateral lines clearly separating the dorsal and ventral arch regions, similar to the morphological features of the species description by Chitwood (1949). Males had a convex labial plate with a non-raised labial disk joining the submedial labia, a non-rugged labial region, the basal tubercles were usually wider than high, and a rounded tail tip (Eisenback and Hirschmann 1981). The α-esterase enzyme profile showed the J3 phenotype typical of M. javanica (Rm [×100] = 46.0, 54.5, and 58.9). The 18s rRNA sequences grouped Meloidogyne sp. with species such as M. enterolobii, M. incognita, and M. javanica. A DNA fragment of about 700 bp was amplified with Mj (Fjav/Rjav) primers, but not with Me (Me-F/Me-R) and Mi (Finc-F/Finc-R) primers, which confirmed the identification of M. javanica. Accurate identification and characterization of the occurrence of new hosts of M. javanica will allow us to determine the range and geographic distribution of the species. This is the first report on the occurrence of M. javanica on S. byzantina in Brazil. This report is important so that management strategies can be applied to prevent the spread of the pest to other areas.

Ligularia fischeri (Ledeb.) is a perennial herbal plant of Compositae that is cultivated commercially in China as a medicinal, ornamental, and edible plant. Leaf spots were observed in 2-year-old L. fischeri in Benxi County of northeast China, in August 2021. Irregular reddish brown spots ranging from 3 to 11 mm were observed on infected leaves, and each leaf had dozens of spots (Fig. 1). As the disease progressed, the diseased spots withered and the centers fell out, and multiple lesions merge into large diseased spots, causing leaf wilting. The roots and stem bases were not infected during the reproductive stage. More than 37% of the plants in a 18 ha field were infected in 2021. The ten diseased leaves were collected and cut into small (3-5 mm) pieces, which were surface-disinfested by immersing into 1% NaOCl for 2 min and rinsing with sterile distilled water three times. The leaf pieces were then placed on acidified potato dextrose agar (PDA) in petri plates and incubated in the dark at 25°C. Twenty isolates with the same morphological characteristics were obtained. Isolates were further purified by starting a new colony for each isolate from a single spore collected from water agar. Isolate TYTW7 was randomly selected for identification and pathogenicity testing. It grew rapidly and produced profuse aerial mycelia with a carmine red underside. The conidiophores had many fertile branches and formed an elongated stipe with a sphaeropedunculate vesicle at the tip. The one-septate conidia were cylindrical and almost straight with parallel walls and rounded ends. Their sizes ranged from 30.35 to 51.76 × 2.93 to 5.01 μm (n = 100) and the pathogens were initially identified as Calonectria sp. (Crous 2002; Crous et al. 2004; Lombard et al. 2015, 2016). Further confirmation of the identification was determined according to published method (Liu and Chen 2017; Shao and Li 2021). The partial gene regions including the translation elongation factor 1-alpha (GenBank accession no. OP290551), histone H3 (OP290552), calmodulin (OP290553) and β-tubulin (OP290554) were obtained, and BLAST searches showed 99-100% homology with the ex-type culture CERC 8952 (MF527049, MF527065, MF527081 and MF527107) and phylogenetic analysis combining all loci revealed that the isolate TYTW7 and the type strain of Ca. montana clustered in one group (Fig. 2). Based on morphological characteristics and phylogenetic analysis, isolate TYTW7 was identified as Ca. Montana . Healthy 2-year-old plants were used for the pathogenicity test. A spore suspension (1×10 5 spores/mL water) was used to inoculate three host plants; sterile water was sprayed on the same number plants serving as a control. The experiment was repeated three times. All plants were incubated at 27±2°C (12h photoperiod) and were evaluated after seven days. The inoculated plants showed lesions on the leaf surface, similar to those in the field, and the control remained symptomless. The pathogens were successfully reisolated and identified by sequencing, and no pathogens were isolated from symptomless control plants. To our knowledge, this is the first report of Ca. montana causing L. fischeri leaf spot. The disease poses a threat to the production and more control strategies are needed on management options to minimize losses.

Brachybotrys paridiformis Maxim. ex Oliv. (Boraginaceae) is a perennial medicinal plant and vegetable that is cultivated commercially in China. Anthracnose is a devastating disease of B. paridiformis , with annual production losses exceeding 33% based on our survey. In July 2021, anthracnose of B. paridiformis was observed on 2-year-old plants in Shenyang city, Northeast China, which is the most important region for B. paridiformis cultivation. Round or irregular-shaped black spots were exhibited on leaves, with the leaf edges most commonly infected. As the necrosis expanded, the leaves withered and dropped; young leaves were generally not infected (Fig. 1). More than 40% of the plants in a 21-ha sampling field were infected in 2021. Symptomatic leaves (n = 20) were collected and the diseased tissue was cut into small pieces, immersed in 1% NaOCl for 2 min, rinsed three times with sterile water, and placed on acidified potato dextrose agar (PDA) in Petri dishes. After a 3-day incubation in darkness at 25 °C, 18 suspected single-pure morphologically identical Colletotrichum isolates were obtained and sequenced. Isolate SQZ9 was randomly selected and identified. Colonies on PDA were initially white, but gradually became pale brownish with a reverse side that was pale yellowish to pinkish. Aerial mycelia were grayish-white, dense, and cottony, with microsclerotia detected on some aging mycelia. The detected single-celled conidia (11.65-17.25 × 4.25-6.15 µm; n = 50) were fusiform to cylindrical with obtuse to slightly rounded ends. Appressoria were ovoid to clavate and medium brown. Setae were not observed. The morphological characteristics were similar to those of Colletotrichum spp. (Prihastuti et al. 2009; Weir et al. 2012). Initial BLAST searches of the GenBank database revealed the SQZ9 rDNA internal transcribed spacer region (OP389109, 566 bp), glyceraldehyde-3-phosphate dehydrogenase (OP407730, 260 bp), chitin synthase (OP407731, 301 bp), calmodulin (OP407732, 712 bp), actin (OP407733, 282 bp), glutamine synthetase (OP407734, 909 bp), β-tublin (OP407735, 498 bp), and superoxide dismutase (OP407736, 396 bp) sequences were respectively 99%-100% similar to the C. siamense type strain JX010278, JX010019, JX009709, GQ856775, GQ856730, JX010100, JX010410, and JX010332 sequences (Carbone & Kohn 1999; Moriwaki & Tsukiboshi 2009; Stephenson et al. 1997). The SQZ9 identity was confirmed by constructing a phylogenetic tree combining all loci, which grouped the isolate and the C. siamense type strain in the same clade (Fig. 2). For pathogenicity tests, 15 healthy 2-year-old plants (3 plants per pot) were spray-inoculated with SQZ9 conidial suspension (1 × 105 conidia/mL) at 2 mL per plant. Same number of plants sprayed with water were used as control. This experiment was repeated twice. All plants were covered with clear plastic bags for 72 h to maintain high humidity and then placed in a greenhouse (29 °C, natural light, and 85% relative humidity). After six days, the inoculated leaves exhibited symptoms that were similar to those observed in the field, but the controls were symptomless. The same fungus was recovered from inoculated symptomatic leaves, and its identity was confirmed by sequencing and a phylogenetic analysis. This is the first report of C. siamense causing anthracnose on B. paridiformis in China. Future studies should assess the effectiveness of chemical and biological control measures for managing this disease.

Jasminum sambac L. is a species of jasmine native to a small region in the eastern Himalayas and is cultivated worldwide as an ornamental plant (USDA-ARS 2016). In Pakistan, it is cultivated for ornamental purposes throughout the country. The flowers of this plant are traditionally used in the preparation of essential oils and for making jasmine tea. The flowers and leaves also have been used in folk medicine to treat breast cancer, epilepsy, ulcers and promote wound healing (Al-Snafi 2018). In December, 2017, almost 10 leaves of 3 plants of J. sambac growing plant nursery of Gehlan, Pattoki, Punjab a province of Pakistan were observed with leaf spot disease. Infected leaves exhibited circular to sub-circular spots with indistinct margins and grey papery centers delimited by dark brown rims. For further microscopic study, the infected leaves were examined under a stereomicroscope. For the isolation and cultural studies of infecting fungus, infected parts of leaves were surface sterilized in 1% NaOCl for about 10 seconds, washed twice in sterilized distilled water, plated on potato dextrose agar (PDA) medium and incubated at 25°C for 4 days. Pure cultures were obtained having colonies of light to dark brown color. Conidia (n=20) were light brown to pale olivaceous brown, smooth, obclavate to cylindrical in shape, 99.5-118.5 μm in length and 12.5-15.0 μm in width, with mostly 3 to 14 pseudosepta. Conidiophores (n=20) were straight to slightly curved, unbranched, and pale to light brown in color. Based on the morphological characteristics of the colonies and conidiophores and conidia, the pathogen was identified as Corynespora cassiicola (Berk and M.A. Curtis) C.T. Wei. (Berkeley & Curtis 1968; Lu et al. 2021; Wei 1950). Genomic DNA was extracted following using modified CTAB method (Gardes and Bruns 1993) and internal transcribed spacer (ITS) region was amplified with ITS1 and ITS4 primers (White et al. 1990). The ITS sequence generated of about 553 bp and deposited in GenBank (accession no. MN954556), was found more than 99% similar to previously deposited sequences of C. cassiicola (GenBank accession nos. MN339671, EU364535, FJ852574, MK139711, EU131374) as verified through BLASTn and phylogenetic tree construction. A pathogenicity test was performed for fulfilling Koch'spostulates. Conidial suspension (105 conidia/ml) of the recovered isolate was sprayed on the 5 healthy leaves of 2-month-old seedling of J. sambac. Mock inoculated plants sprayed sterile distilled water were used as a control. The seedlings were covered with plastic bags to maintain high humidity at 24 to 28°C for a week. Identical disease symptoms to those observed in nursery plants were observed on the leaves of the inoculated plants in 7 days but not mock inoculated plants and results were reconfirmed. The reoccurred fungus was isolated from the diseased spots of the inoculated leaves to complete Koch's postulates and identified microscopically. A representative sample of leaves with lesions was deposited in the LAH herbarium, Department of Botany University of the Punjab, Pakistan (LAH35691). Previously, C. cassicola has been found infecting Jasminum mesnyi in China and Jasminum sp. in Florida (Alfieri et al. 1984; Zhang et al. 2018). The best of our knowledge, this is the first report of leaf spot caused by C. cassiicola on J. sambac in Pakistan. It will establish a foundation for future studies of management strategies for this plant disease caused by C. cassiicola.

Tobacco (Nicotiana tabacum L.) is an important economic crop that is widely grown around the world. Its annual production in China is estimated at 2.2 million tons (Berbeć and Matyka 2020). Since 2022, a root rot disease was sporadically observed on tobacco seedlings on cultivar Yunyan 87 in cultivated tobacco fields in the Hunan province of China. A disease incidence of about 10% occurred across 48 ha of tobacco fields. The affected tobacco plants had slow and stunted growth with yellowing leaves. The roots turned grayish brown, decayed, and died. Diseased roots were collected from six fields and cut into small pieces (5 mm ×5 mm) from the edge of the rotted portions, and then sterilized with 70% ethanol for 10 s, 0.1% HgCl2 for 1 min, and washed in sterilized water three times. All the sterilized tissue were placed on potato dextrose agar (PDA) medium and cultured at 26 ℃ in the dark. About 3 days later, colonies with similar morphology were removed and sub-cultured on fresh PDA. A total of six strains were obtained from six tobacco samples. Strains were white and had radial growth on PDA. Hyphae were aseptate and the sporangia were filamentous. The oogonia were subglobose, smooth, 16.04 ± 0.25 µm (n=50) in diameter, and developed on unbranched stalks. The antheridia were barrel shaped and clavate. Oospores were globose, aplerotic or nearly plerotic, measuring 6.62 ± 0.33 µm (n=50). These morphological characteristics were consistent with the description of Pythium spp. (van der Plaats-Niterink 1981). For molecular identification, the internal transcribed spacer (ITS) region of rDNA and cytochrome c oxidase subunit I (Cox I) of a representative isolate, GF-3, were amplified and sequenced (GenBank accession nos. OR228424 for ITS and OR237556 for Cox I) using universal primers ITS1/ITS4 (White et al. 1990) and FM58/FM66, respectively (Villa et al. 2006). BLASTn analysis revealed that the ITS and Cox I sequences were 99.76 % (838/840 bp) and 99.85% (671/672 bp) identical to the corresponding sequences of P. dissotocum strain CBS 166.68 (AY598634.2) and UM982 (MT981147.1), respectively. A neighbor-joining phylogenetic tree based on the Cox I sequence showed that GF-3 grouped in the P. dissotocum branch. Based on morphological and molecular characteristics, GF-3 was identified to be P. dissotocum. For pathogenicity testing, four- to five-leaf-old healthy potted tobacco seedlings of the Yunyan 87 cultivar were inoculated with a zoospore suspension (1 × 105 zoospores/ml), which was induced on V8-juice medium. The zoospore suspension was introduced into the soil around plant roots and 10 mL of inoculum was used for each plant. In the control group, plants were inoculated with sterilized water. All of the treated plants were kept in humid chambers at 26°C under a 12 h/12 h photoperiod. The pathogenicity assays were performed twice, with each treatment having three replicated plants. After 5 days, tobacco seedlings inoculated with P. dissotocum showed symptoms resembling that observed in the field. However, the control plants remained healthy. Pythium dissotocum was re-isolated from the infected plants and identified by morphological and molecular methods, thus confirming Koch's postulates. Pythium dissotocum has been reported causing root rot in other plants, including hydroponic lettuce (McGehee et al. 2018) and spinach (Huo et al. 2020). Also, many Pythium species have recently been recovered from float-bed tobacco transplant production greenhouses (Zhang et al. 2022). However, to our knowledge, this is the first report of root rot on tobacco caused by P. dissotocum in China. Since this disease could greatly affect tobacco seedling establishment in the field, appropriate management strategies need to be developed to reduce further losses in tobacco planting fields.

Brachiaria Griseb is an important gramineous forage grown in tropical regions, and also a main grass species uses to restore grasslands in tropical and subtropical regions of China. In August 2022, symptoms of leaf blight were observed on nearly 30% of the Brachiaria forage grass in the base of the Chinese Academy of Tropical Agricultural Sciences, Hainan, China. Symptomatic leaves initially exhibited small, reddish-brown, round or oval spots on their tips, subsequently expanding in size along the leaf margin, and gradually becoming wilted and dry. Twenty leaves showing typical symptoms were randomly collected and pieces (5×5 mm) from the junction of diseased and healthy region were cut, sterilized with 75% alcohol for 30 s, followed by 5% sodium hypochlorite for 30 s. Rinsed three times with sterile water and dried with sterile filter paper. Leaf pieces were placed on potato dextrose agar (PDA) and incubated at 28℃. The colonies were white on the surface and gray on the reverse side. The conidiogenous cells were monoblastic, hyaline, globose or ampulliform, and 6 to 8.7(13.1) ×5 to 7.2 (9) m (n=200). Conidia is single celled, smooth, black, spherical, or ellipsoidal, and (11)13 to 16.5 × (8.2) 10.3 to16.1 m (n=100). Setae were not observed. The morphological characteristics of the isolates were consistent with Nigrospora species. A representative isolate (LNH-5) was selected for genomic DNA extraction. Sequences of the transcribed spacer region of rDNA (ITS), partial translation elongation factor (TEF1), and beta-tubulin fragment (TUB) were amplified using primer pairs ITS1/ITS4(White et al. 1990), EF-728F and EF-986R (Carbone et al. 1999) and Bt2a and Bt2b (Glass et al. 1995), respectively. The sequences of ITS (OQ473493), TEF1 (OQ506059) and TUB gene (OQ506055) were submitted to GenBank. They were 99 to 100% identical to the Nigrospora hainanensis ITS(OM283581.1)(538 out of 519 bp),TEF1(YK019415.1)(274 out of 276 bp),and TUB (OK086377.1)(405 out of 405 bp) sequences. The phylogenetic maximum likelihood analysis using the combined ITS, TEF1 and TUB sequences indicated that the isolate was part of the N. hainanensis clade (100% bootstrap value) that also contained the type isolate LC6979 of this species. Pathogenicity was tested on 15 healthy Brachiaria plants. Fungal conidia were harvested by flooding two-week-old single conidial cultures with sterile water, centrifuging, and adjusting the concentration to 107 spores/mL. Then 10 μL of conidial suspension was dropped onto the surfaces of leaves wounded with a sterile needle. Sterile distilled water was used for control treatment. The test was repeated three times. After inoculation, the plants were kept at 90~100% relative humidity at 25 to 28°C in a greenhouse for two weeks, and monitored daily for lesion development. Seven days post inoculation, all the inoculated leaves presented symptoms similar to those observed under natural conditions, while the control leaves showed no symptoms. The fungus was re-isolated from the diseased tissues by the single spore isolation method (Choi et al. 1999) to complete Koch's postulates. This pathogen has been reported on sugarcane in China (Raza et al., 2019; Zheng et al., 2022). To our knowledge, this is the first report of N. hainanensis causing leaf blight on Brachiaria plants in China.

Bletilla striata (named "Bai Ji" in Chinese) is a plant from the Orchidaceae family that has been employed in traditional Chinese medicine for thousands of years in China. Polysaccharides extracted from B. striata have been shown to have an effect on Alzheimer's disease (Lin et al. 2021). Since 2021, leaf spots have been observed in the B. striata plantation in Chongqing, China. Out of 200 plants, the disease incidence was estimated at 56%, and the disease index was estimated at 32%. The symptoms were necrotic lesions with brown edges and yellow halos; severe infection caused the infected leaves to become blighted, dry and fall off. To identify the causal agent, eighteen leaves with typical symptoms were collected from the B. striata plantation (30.60°N, 108.64°E). The margins of infected tissue areas were cut into small pieces (5×5 mm), surface sterilized with 70% ethanol for 1 min, and rinsed twice with sterile distilled water. The tissue was then surface sterilized in 3% sodium hypochlorite for 2 min, followed by three rinses with sterile water. The tissue was then placed onto potato dextrose agar (PDA) plates and incubated at 25°C for 3 days, pure cultures of fungal isolates were obtained by single-spore isolation, stored on PDA slants and maintained at 4°C. Colonies of the fungal isolates showed three color types, ranging from grayish white to green above with olive green on the reverse, but conidial characteristics were more similar and indicated this was a single fungus. Conidiophores were single, lateral from hyphae or terminal; straight or curved; smooth-walled with 1 to 8 septa; pale brown; usually with only one pigmented terminal conidiogenous site, sometimes with one additional lateral conidiogenous locus; sometimes slightly swollen at the apex; and 15 to 170 μm long, 2.5 to 4.5 μm wide. Conidia were in short or moderately long chains of 2-8 conidia normally, sometimes with more; rarely branched; normally 14.07 to 50 × 5.24 to 10 μm in size; ellipsoid, fusiform, long ellipsoid, obclavate or ovoid with 1 to 11 transverse septa and 2 to 4 longitudinal septa; beakless or with subcylindric or cylindric secondary conidiophores, analogous to the beak 4.25 to 58.6 μm long, 3.2 to 4.8 μm wide. The fungal isolates were tentatively identified as Alternaria sp. The representative isolate BJ8 was selected for the pathogenicity test. The leaves of six healthy plants of B. striata (two years old) grown in pots were washed with sterile water. Ten mL of conidial suspension (1×10 6 conidia mL -1 ) contained in 0.05% Tween 80 buffer was brushed onto upper and lower surfaces of all the leaves on three plants, while other plants were brushed with 10 mL 0.05% Tween 80 buffer to serve as controls. Plants were placed in a greenhouse at 25°C and 95±1% relative humidity after inoculation and observed for symptoms. The symptoms initially developed as irregular brown necrotic lesions on the inoculated leaves after 7 days, with a yellow halo around the lesions, consistent with the symptoms in the field. Leaves on the control plants did not produce any symptoms. For molecular identification, the genomic DNAs of representative isolates BJ5, BJ6, and BJ8 were extracted. The internal transcribed spacer (ITS) region and RNA polymerase II second largest subunit ( RPB2 ), translation elongation factor 1-alpha ( TEF1 ), and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) genes were used for polymerase chain reaction (PCR), using primers ITS5/ITS4, GPD1/GPD2, EF-1F/EF-1B and RPB27cR/RPB25F2, respectively (White et al. 1990; Berbee and Pirseyedi et al. 1999; Carbone and Kohn 1999; Liu et al. 1999). The neighbor-joining tree revealed that these isolates are clustered together with the reference strain of A. burnsii . The sequences were deposited in NCBI GenBank BJ5 [ITS: OP897263; GAPDH : OQ544937; TEF1 : OQ544941; RPB2 : OQ544939], BJ6 [ITS: OP897262; GAPDH : OQ544938; TEF1 : OQ544942; RPB2 : OQ544940], and BJ8 [ITS: OK285209; GAPDH : OK340046; TEF1 : OK340047; RPB2 : OQ544936]. All three isolates showed 100% similarity with A. burnsii CBS 107.38 [ITS: KP124420; GAPDH : JQ646305; TEF1 : KP125198; RPB2 : JQ646457] ex-type sequence, thus the pathogen causing the leaf spot on B. striata was identified as A. burnsii . A. burnsii is an important pathogenic fungus causing blight of cumin (Shekhawat et al. 2013). Furthermore, Al-Nadabi et al. (2018) found that A. burnsii can cause leaf spots on wheat and date palms, and Sunapao et al. (2022) reported that A. burnsii can infect coconuts ( Cocos nucifera ), causing dirty panicle disease. This is the first report of A. burnsii causing leaf spot on B. striata in China. The new discovery shows that since A. burnsii can readily adapt to a variety of climatic conditions, controlling the fungus is crucial for the healthy growth of B. striata in the future. This study will provide a basis for further elucidating the pathogenic mechanism and development of effective control measures for this disease.

Several viruses have been described to infect sugar beet ( Beta vulgaris var. saccharifera L.), but virus yellows disease is one of the most important diseases in many sugar beet growing areas. It is caused by four viruses either in single or mixed infection, including the poleroviruses beet western yellows virus (BWYV), beet mild yellowing virus (BMYV), and beet chlorosis virus (BChV), and a closterovirus beet yellows virus (BYV) (Stevens et al. 2005; Hossain et al. 2021). In August 2019, five samples of sugar beet plants showing yellowing on interveinal leaf tissue were collected in a sugar beet crop in the Novi Sad locality (Vojvodina Province, Serbia). Double-antibody sandwich (DAS)-ELISA commercial antisera (DSMZ, Braunschweig, Germany) were used to test the collected samples for the presence of the most common sugar beet viruses: beet necrotic yellow vein virus (BNYVV), BWYV, BMYV, BChV, and BYV. Commercial positive and negative controls were included in each ELISA test. BYV was serologically detected in all sugar beet samples, but no other viruses tested were found. The presence of BYV in sugar beet plants was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions, and used as template in the RT-PCR. Total RNAs extracted from healthy sugar beet leaves and molecular-grade water were included as negative controls in the RT-PCR analysis. RT-PCR confirmed the presence of BYV in all naturally infected plants using four sets of specific primers (Kundu and Ryšánek 2004), whereas no amplification products were obtained in the negative controls. The RT-PCR products derived from isolate 209-19 were purified and directly sequenced in both directions using the same primer pairs as in RT-PCR (accession numbers OQ686792 to OQ686794). Multiple sequence alignment of the L-Pro and N-terminal part of the MET genes showed that the Serbian BYV isolate had the highest nucleotide identity (99.01% and 100%, respectively) with several BYV isolates in GenBank originating from different parts of the world. Sequence analysis of the HSP70 gene showed the highest similarity (99.79%) with the BYV-Cro-L isolate found in Croatia. In a semi-persistent type of transmission test, aphids ( Myzus persicae Sulzer) were allowed to feed on BYV-infected leaves of an ELISA-positive sample (209-19) for 48 hours, and then the aphids were transferred to five plants each of Spinacia oleracea cv. Matador and B. vulgaris ssp. vulgaris cv. Eduarda for a three-day inoculation access period. All test plants were successfully infected and exhibited symptoms in the form of interveinal yellowing up to three weeks postinoculation. RT-PCR confirmed the presence of BYV in all inoculated plants. A study by Nikolić (1951) suggested a possible presence of BYV based on symptoms observed on sugar beet plants in fields, but to our knowledge this is the first report of BYV in sugar beet in Serbia. As sugar beet is one of the most important industrial crops in Serbia, the presence of BYV could lead to significant losses, considering that aphid vectors are widespread under Serbian environmental conditions. The discovery of BYV on sugar beet should prompt a more detailed survey and subsequent testing of susceptible hosts to determine the distribution and incidence of BYV in Serbia.

Peppermint (Lamiaceae) is an aromatic herb with culinary, medicinal, and industrial properties. In June 2022, symptoms and signs of foliar rust were observed in four commercial fields of peppermint (Mentha × piperita) in San Buenaventura Tecalzingo, San Martín Texmelucan, Puebla, Mexico (19°14'34.0"N 98°27'25.4"W; 19°14'16.7"N 98°27'21.4"W; 19°14'37.0"N 98°27'07.7"W; 19°15'00.6"N 98°26'54.7"W). Two diseased plants were collected at each site. The disease was present in 50% of the plants and the damaged foliar tissue was under 17%. Initial symptoms included small chlorotic spots on the adaxial surface of the leaves, which later spread to form a necrotic area surrounded by a broad chlorotic halo. Necrosis developed only in the presence of abundant reddish-brown pustules on the abaxial surface of the leaf, while smaller pustules were observed on the adaxial surface. The signs were detected as numerous reddish-brown pustules on the abaxial surface of the leaves. The infected leaves of all samples showed subepidermal uredinia, erumpent, with hyaline and cylindrical paraphyses. Urediniospores (n = 50) were hyaline to light brown, echinulate, with two germinative pores, obovoid (16.5-26.5 × 11.5-25.5 μm, mean ± SD = 22 ± 1.6 × 19 ± 0.4 μm and 0.6 μm of wall thickness), individually supported on pedicels. Morphological characteristics aligned most closely with the description of Puccinia menthae by Kabaktepe et al. (2017) and Solano-Báez et al. (2022). A voucher specimen was deposited in the Herbarium of the Department of Plant-Insect Interactions at the Biotic Products Development Center of the National Polytechnic Institute under accession no. IPN 10.0115. From one sample, genomic DNA was extracted, and the 28S gene region of rDNA was amplified by a nested PCR using the primer sets Rust2inv (Aime, 2006) and LR6 (Vilgalys and Hester, 1990), and Rust28SF (Aime et al., 2018), and LR5 (Vilgalys and Hester, 1990) for the first and second reactions, respectively. The obtained sequence (GenBank accession No. OQ552847) showed 100% homology (902/1304bp) with the type-specimen sequence of P. menthae (DQ354513) from Cunila origanoides from USA (Aime, 2006). A phylogenetic analysis using Maximum Likelihood including a published 28S dataset for Puccinia species was executed and the isolate IPN 10.0115 was grouped into a clade of P. menthae with bootstrap support value of 100%. Pathogenicity was assessed by spraying a suspension of urediniospores (1×104 spores/ml) of the isolate IPN 10.0115 onto six healthy peppermint plants (Mentha × piperita) that were 30 days old, while six other plants were sprayed with sterile distilled water. All plants were kept in a wet chamber for 48 h at temperatures from 28±2°C and relative humidity of 95%, after which the plastic bag was removed. All inoculated plants developed disease symptoms after 15 days, whereas the control plants remained symptomless. The pathogenicity assay was conducted twice with similar results. The morphology of the pathogen recovered from the pustules of the inoculated plants was identical to that originally recollected, thus fulfilling Koch'postulates. To our knowledge, this is the first report of Puccinia menthae causing leaf rust on Mentha × piperita in Mexico. This species has been previously identified using morphological characteristics in Brazil, Canada, Poland, and USA on Mentha × piperita (Farr and Rossman, 2023). Since the disease defoliates peppermint plants reducing yield, further information on disease management is needed.

Dioscorea opposita is an annual twining plant in China that is used for consumption and medicinal purposes. The planting area of D. opposita is near 500,000 hectares in China, mainly in Shangdong, Hebei, Henan, Jiangxi and Yunnan provinces. In August 2021, we observed that some D. opposita plants grew poorly with smaller and chlorotic leaves in Changyuan (35°8'12"N; 114°43'52"E), Henan Province, China. Galls with hook-shaped roots and tuber damage were also observed, typical of root-knot nematode. Thirty tubers were randomly collected and 60% were infested with root-knot nematodes. During a disease survey in Changyuan, the incidences of root-knot nematode damage were 31.5%, 21%, and 18% in three fields (0.33, 0.67, and 4 ha, respectively) at harvest. The average tuber length of infected plants was decreased by 65.8%, and the average weight was decreased by 70.1% compared to the healthy plants. Males, females, second-stage juveniles (J2s), and eggs were extracted from individual diseased tubers from the three fields for morphological identification. Females were white, pear-shaped with a projecting neck. Males showed a trapezoidal labial region with prominent stylet knobs, including a high head cap which had a stepped outline and was centrally concave in lateral view. Morphological measurements are described in the supplementary material. All data and descriptions conformed to the morphological characteristics of Meloidogyne incognita . Genomic DNA was extracted from J2s (n=9) using PCR lysis buffer, and used for PCR amplification of the sequence characterized amplified region (SCAR) markers specific for M. incognita . Two pairs of the SCAR primers, Mi-F/Mi-R, and Inc-K14-F/Inc-K14-R, were used to diagnose whether these nematodes from D. opposita were M. incognita (Meng et al. 2004; Randig et al. 2002). The PCR produced expected amplification products of 955 and 399 bp, confirming the nematode to be M. incognita . Primers specific for M. arenaria (Far/Rar) and M. javanica (Fjav/Rjav) were used but failed to amplify fragments (Randig et al. 2002; Zijlstra et al. 2000). The obtained PCR fragments were sequenced and deposited in GenBank (accession no. OQ420602.1, OQ427638.1). They showed 99.9 and 100% identity to the available GenBank M. incognita sequence (accession no. MK410954.1, ON861825.1), respectively. A pathogenicity test was conducted in greenhouse conditions. Bulbils of D. opposita were sown in the pots filled with 2,000 ml of autoclaved soil mixture (loamy soil/sand, 1:1). One month later, 15 seedlings (five to six leaf stage) were inoculated with 1,000 M. incognita J2s individually. Five plants without nematode inoculation were used as the control. Two months after inoculation, all of the inoculated roots had galling symptoms similar to those observed in the field, and 100% of root system tissues had galls. The root gall index was ~6 according to a 0 to 10 RKN damage rating scale (Poudyal et al. 2005). No symptoms were found on the control plants. The nematodes were reisolated from root tissue and identified. M. incognita has a broad host range in many species of economic importance including Salvia miltiorrhiza (Wen et al. 2023), Ipomoea batatas (Maleita et al. 2022), and Zea mays (López-Robles et al. 2013). So far, M. incognita has been reported in D. alata and D. rotundata in Africa (Onkendi et al. 2014). To our best knowledge, this is the first record of M. incognita on D. opposita in Henan Province, China. With the increased planting area of D. opposita in China, root-knot nematodes are becoming more serious and reducing tuber production, with yield losses more than 60%. This identification is a preliminary step in developing effective disease management schemes. Declaration of interest The authors declare no conflict of interest. Funding This work was financially supported by the Key Scientific Research Projects of Higher Education Institutions of Henan Province (21A180013), China Agriculture Research System (CARS-21), The Zhongyuan high level talents special support plan-Science and Technology Innovation Leading Talents (224200510011) and Science and Technology Research Project of Henan Province (222102310211). References López-Robles, J., et al. 2013. Plant Dis. 97:694. https://doi.org/10.1094/PDIS-07-12-0674-PDN. Maleita, C., et al. 2022. Plant Dis. 106:2536. https://doi.org/10.1094/PDIS-12-21-2680-PDN. Meng, Q. P., et al. 2004. Acta Phytopathol. Sinica 34:204. https://doi.org/10.13926/j.cnki.apps.2004.03.003. Onkendi, E. M., et al. 2014. Plant Pathol. 63:727. https://doi.org/10.1111/ppa.12202. Poudyal, D. S., et al. 2005. Australas. Plant Pathol. 34:181. https://doi.org/10.1071/AP05011. Randig, O., et al. 2002. Genome 45:862. https://doi.org/10.1139/g02-054. Wen, Y., et al. 2023. Plant Dis. Accepted. https://doi.org/10.1094/PDIS-05-22-0997-PDN. Zijlstra, C., et al. 2000. Nematology 2:847. https://doi.org/10.1163/156854100750112798.

Red clover ( Trifolium pratense ) is becoming increasingly important in grassland systems (sheep and beef) due to its high productivity, protein content and nitrogen-fixing ability which allows lower N fertilizer use (Murray et al. 2007). In June 2021, an unidentified foliar disease occurred seriously in experimental fields of red clover (25.61°N, 102.48°E) in Kunming city, Yunnan Province, China. Disease incidence was approximately 55% with an average disease severity of 41.1% in the fields (about 1.5 ha). Initially, the symptoms consisted of cicular to oval leaf spots with dark brown edges. In severely diseased plots, the diseased spots continued to expand and fuse along the leaf veins, forming long and narrow leaf spots, and the middle of the leaves were decayed and hollow. To isolate the pathogen, small pieces (3×3 mm) from the margin of infected lesions were surface-sterilized in 75% ethanol solution for 30 s, 1% NaClO solution for 90 s, rinsed three times with sterilized distilled water, air dried, and plated onto potato dextrose agar (PDA). The same fungus was isolated in 90% of the samples and purified by transferring the hyphal tip from the edge of colonies to fresh PDA plates. The colonies produced relatively dense light-grayish aerial mycelium in the early stage, which turned grayish upon mature, and then dark brown on the back of the colonies with dense small black patches. Conidiophores were unbranched, straight or flexuous, accompanied by slight or obvious swelling of its apical cells. Conidia were olive brown, irregularly round, 1 to 3 transverse septa, 0 to 2 longitudinal or oblique septa, and measured 16.0 - (24.8)- 30.1 × 13.9 - (21.4) - 28.6 µm (n = 50). Morphological characteristics were consistent with those described for Stemphylium vesicarium (Simmons, 1967). For molecular identification, total genomic DNA was isolated from mycelia collected from 6 day-old colonies of three representative isolates LZQF-1-LZQF-3 using the Omega D3195 fungal genomic DNA extraction kit. Fragments of three genes, including those encoding the ITS region of rDNA, calmodulin gene (cmdA), and glyceraldehyde-3-phosphate dehydrogenase (gpd) regions of isolates LZQF-1-LZQF-3 were amplified by the primers described previously (Woudenberg et al. 2017) and sequenced. Resulting sequences of representative strain LZQF-1 were deposited in GenBank with accession numbers of OL615093 (ITS), OL624541 (cmdA) and OL624538 (gpd), respectively. A nucleotide BLAST search revealed ITS, cmdA and gpd sequences to be 100%, 100% and 99.0% similar to the corresponding sequences (accessions numbers KU850563.1, KU850853.1 and KU850710.1) of ex-type strain CBS 370.51 of S. vesicarium . The three locus datasets were combined by SequenceMatrix 1.8 (Vaidya et al. 2011), and the strain LZQF-1-LZQF-3 and S. vesicarium (CBS 192.86, CBS 370.51 and CBS 205.82) formed a subclade with 99% bootstrap support. Pathogenicity tests were performed on LZQF-1 in a greenhouse at 18 °C-26 °C with 75% relative humidity. Three pots each containing three 50-day-old red clover were sprayed with the conidial suspension (3 × 105 conidia/ml) while another three pots were sprayed with sterile water as a control. Two weeks later, the inoculated leaves showed oval leaf spots with dark brown edges, distinctive symptoms of S. vesicarium infection. S. vesicarium was reisolated and confirmed by morphological and molecular features. There were no symptoms on the control leaves. S. vesicarium as a pathogen causing leaf spot disease has been reported on red clover in Canada (Jasalavich et al. 1995) and in Russia (Babuschkina et al. 1995). To our knowledge, this is the first report of leaf spot of red clover caused by S. vesicarium in China. The identification of Stemphylium leaf spot lays the groundwork for future investigations into epidemiology and management of S. vesicarium on red clover.

Aconitum carmichaelii Debeaux is used as a traditional Chinese medicine with antiarrhythmic, antiinflammatory and other pharmacological functions. It is widely cultivated in China. According to our survey, about 60% of A. carmichaelii in Qingchuan, Sichuan, suffered from root rot, reducing yields by 30% in the past five years. Symptomatic plants exhibited stunted growth, dark brown roots, reduced root biomass, and fewer root hairs. The disease caused root rot and plant death in 50% of the infected plants. In October 2019, ten symptomatic 6-month-old plants were collected from fields in Qingchuan. Diseased pieces of the roots were surface sterilized with sodium hypochlorite solution (2%), rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in the dark. Six single-spore isolates of a Cylindrocarpon-like anamorp were obtained. The colonies on PDA were 35 to 37 mm diam after seven days with regular margins. The plates were covered with felty aerial mycelium, white to buff, and the reverse side chestnut near center with a ochre to yellowish leading edge. On spezieller nährstoffarmer agar (SNA), macroconidia were 1 to 3 septate, straight or slightly curved, cylindrical, with rounded ends, and varied in size: 1-septate 15.1 to 33.5 × 3.7 to 7.3 μm (n=250), 2-septate 16.5 to 48.5 × 3.7 to 7.6 μm (n=85), and 3-septate 22.0 to 50.6 × 4.9 to 7.4 μm (n=115). Microconidia were ellipsoid to ovoid, and 0 to 1 septate; aseptate spores were 4.5 to 16.8 × 1.6 to 4.9 μm (n=200), and 1-septate spores were 7.4 to 20.0 × 2.4 to 5.1 μm (n=200). The chlamydospores were brown, thick-walled, globose to subglobose, 7.9 to 15.9 μm (n=50). The morphology of these isolates was consistent with the previous description of Ilyonectria robusta (Cabral et al. 2012). Isolate QW1901 was characterized by sequencing the ITS, TUB, H3, and tef1α loci using previously reported primer pairs: ITS1/ITS4 (White et al. 1990), T1/Bt-2b (O'Donnell and Cigelnik 1997), CYLH3F/CYLH3R (Crous et al. 2004), and EF1/EF2 (O'Donnell et al. 1998). A Blastn search of the sequences of ITS, TUB, H3, and tef1α showed that QW1901 shared 99.26, 97.89, 97.79, and 99.17 % identities, respectively, with the ex-type strain of I. robusta (CBS308.35). The ITS, TUB, H3, and tef1α sequences were deposited in GenBank under accession nos. MW534715, and MW880180 to MW880182, respectively. A phylogenetic tree was constructed from a neighbor-joining analysis on the alignment of the combined ITS, TUB, H3, and tef1α sequence. QW1901 was clustered with the ex-type strain of I. robusta. To confirm the pathogenicity of I. robusta, bare roots of healthy 6-month-old A. carmichaelii were inoculated with mycelial plugs of 7-day-old QW1901 colonies selected randomly (Lu et al. 2015). Five needle-wound lateral roots and five intact roots were inoculated as replicates with pathogen-free agar plugs as a control. Then, all plants were grown in sterile soil in a growth chamber at 20±1°C and watered regularly. Pathogenicity assays were repeated twice. After 20 days of cultivation, infected plants exhibited symptoms similar to those observed in the field. All control plants remained asymptomatic. Sequencing confirmed the re-isolation of I. robusta from the inoculated plants, satisfying Koch's hypothesis. Ilyonectria robusta has been reported to cause root rot of plants such as Codonopsis tangshen and Panax ginseng ( Lu et al. 2015; Zheng et al. 2021), and has also been reported to be isolated from Aconitum kongboense in China (Wang et al. 2015). However, this is the first report of the pathogen causing root rot of A. carmichaelii. Management measures, such as growing disease-free seedlings in sterile soil, should be used to minimize the risk of this pathogen.

Polygonatum cyrtonema Hua., is one of the cultivated varieties of Polygonatum sibiricum Redouté., which also an important cash crop in China (Chen, J., et al. 2021). From 2021 to 2022, symptoms resembling gray mold were observed on P. cyrtonema leaves with 30 to 45% disease incidence in Wanzhou District (30°38'1″N, 108°42'27″E) of Chongqing. The symptoms started to occur from April to June and more than 39% of leaves were infected from July to September. Symptoms started as irregular brown spots and progressed to the leaf edges or tips and stems. In dry conditions, the infected tissue appeared dry and thin, light brown in color, and became dry and cracked in the later stages of disease development. When the relative humidity was high, infected leaves developed water-soaked decay with a brown stripe around the lesion, and a gray mold layer appeared. To identify the causal agent, 8 typical diseased leaves were collected, leaf tissues were chopped into small pieces (3×5 mm), surface sterilized for 1 min in 70% ethanol and 5 minutes in 3% sodium hypochlorite, rinsed three times using sterile water, placed onto potato dextrose agar (PDA) amended with streptomycin sulfate (50 μg/ml) and incubated at 25°C for 3 days in dark conditions. Then 6 colonies (3.5 to 4 cm diameter) with similar morphology were transferred onto new plates. In the initial stage of growth of isolates, all hyphal colonies were white, dense, and clustered, and dispersed in all directions. After 21 days, brown to black-colored sclerotia (2.3 to 5.8 mm diameter) were observed embedded on the bottom of the medium. The six colonies were confirmed to be Botrytis sp. based on the morphological characteristics. The conidia were attached in branches on the conidiophores in grape-like clusters. Conidiophores were straight and 150 to 500 μm in length, and the conidia were single-celled, long ellipsoidal, or oval-like, with no septa and 7.5 to 20 × 3.5 to 14 μm (n=50). For molecular identification, DNA was extracted from representative strains 4-2 and 1-5. The internal transcribed spacer (ITS) region and sequences from the RNA polymerase II second largest subunit ( RPB2 ), and the heat-shock protein 60 ( HSP60 ) genes were amplified using primers ITS1/ITS4, RPB2for / RPB2rev , and HSP60for / HSP60rev , respectively (White T.J., et al.1990; Staats, M., et al. 2005). The sequences were deposited in GenBank: 4-2 [ITS; OM655229: RPB2 ; OM960678: HSP60 ; OM960679] and 1-5 [ITS; OQ160236: RPB2 ; OQ164790: HSP60 ; OQ164791]. These sequences from isolates 4-2 and 1-5 had 100% similarity to the B. deweyae CBS 134649/ MK-2013 [ITS; HG799538.1: RPB2 ; HG799518.1: HSP60 ; HG799519.1] ex-type sequences, and phylogenetic analyses based on multi-locus alignment demonstrated strains 4-2 and 1-5 as B. deweyae . Isolate 4-2 was used to verify whether B. deweyae can cause gray mold on P. cyrtonema , by conducting Koch's postulates experiments (Gradmann, C., 2014). The leaves of P. cyrtonema planted in pots were washed with sterile water, and brushed with 10 mL of hyphal tissue in 55% glycerin. Leaves of another plant were brushed with 10 mL 55% glycerin as control, and Kochs' postulates experiments were conducted three times. Inoculated plants were kept in a chamber with 80% relative humidity at 20 ± 1°C. Seven days after inoculation, disease symptoms similar to those in the field were observed on leaves, whereas control plants remained asymptomatic. The fungus was reisolated from inoculated plants and identified as B. deweyae based on multi-locus phylogenetic analysis. To our knowledge, B. deweyae is mostly found on Hemerocallis , is likely to be an important contributor to the development of 'spring sickness' symptoms (Grant-Downton, R.T., et al. 2014.), and this is the first report of B. deweyae causing gray mold on P. cyrtonema in China. Although B. deweyae has a limited host range, it might also become a potential threat to P. cyrtonema . This work will provide a basis for the prevention and treatment of the disease in the future.

Smooth bromegrass (Bromus inermis Leyss.) is an excellent forage species widely distributed in Gansu, Qinghai, Inner Mongolia, and other provinces of China (Gong et al. 2019). In July 2021, typical leaf spot symptoms were observed on the leaves of smooth bromegrass plants in Ewenki Banner of Hulun Buir, China (49°5'8″N, 119°44'28″E, alt. 622.5 m). Approximately 90% of plants were affected, with symptoms apparent throughout the plant but mainly concentrated on the lower middle leaves. We collected 11 plants to identify the causal pathogen of leaf spot on smooth bromegrass. Samples (5×5 mm) of symptomatic leaves were excised and surface-sanitized with 75% ethanol for 3 min, rinsed three times with sterile distilled water, and incubated on water agar (WA) at 25℃ for three days. The lumps were cut along the edges and transplanted to potato dextrose agar (PDA) for subculture. After two purification cultures, ten strains, termed HE2 to HE11, were collected. The front side of the colony morphology was cottony or woolly, the center was greyish-green, circled with greyish-white color, with reddish pigmentation on the reverse. The conidia were globose or subglobose, yellow-brown or dark brown, with surface verrucae, and 23.89±3.76×20.28±3.23 μm (n = 50) in size. The morphological characteristics of the mycelia and conidia of the strains mtched those of Epicoccum nigrum (El-Sayed et al. 2020). The primers ITS1/ITS4 (White et al. 1991), LROR/LR7 (Rehner and Samuels 1994), 5F2/7cR (Sung et al. 2007), and TUB2Fd/TUB4Rd (Woudenberg et al. 2009) were used to amplify and sequence four phylogenic loci (ITS, LSU, RPB2 and β-tubulin), respectively. The sequences of ten strains have been deposited in GenBank, and the detailed accession numbers were shown in Table S1. BLAST analysis of these sequences showed 99-100%, 96-98%, 97-99% and 99-100% homology with the E. nigrum strain in the ITS, LSU, RPB2 and TUB sequenced regions, respectively. The sequences of ten test strains and other Epicoccum spp. strains obtained from GenBank were aligned by ClustalW by MEGA (version 11.0) software. After a series of alignment, cutting and splicing, the phylogenetic tree was constructed by the neighbor-joining method with 1000 bootstrap replicates based on the ITS, LSU, RPB2, and TUB sequences. The test strains were clustered together with E. nigrum, with branch support rate of 100%. Combined with morphological and molecular biological characteristics, ten strains were identified as E. nigrum. For the pathogenicity test, the seeds of smooth bromegrass were soaked for four days and then sown into six pots (10 cm diameter × 15 cm height) and kept in a greenhouse under a 16-h photoperiod with temperatures of 20-25°C and 60% relative humidity. Microconidia of the strain produced on wheat bran medium after 10 days were washed with sterile deionized water, filtered through three layers of sterile cheese cloth, quantified, and the concentration adjusted to 1 × 106 microconidia/ml with a hemocytometer. When the plants had grown to a height of about 20 cm, the leaves of plants in three pots were sprayed with the spore suspension, 10 mL per pot, while the remaining three pots were inoculated with sterile water and served as controls (LeBoldus and Jared 2010). The inoculated plants were cultured in an artificial climate box under a 16-h photoperiod with temperatures of 24°C and 60% relative humidity. Brown spots were apparent on the leaves of the treated plants after five days, whereas the leaves of the controls remained healthy. The same E. nigum strain were re-isolated from the inoculated plants and identified by the morphological and molecular techniques described above. To our knowledge, this is the first report of leaf spot disease caused by E. nigrum on smooth bromegrass in China, as well as in the world. Infection with this pathogen could reduce the yield and quality of smooth bromegrass production. For this reason, strategies for the management and control of this disease should be developed and implemented.

Pyrethrum ( Tanacetum cinerariifolium (Trevir.) Sch. Bip.) is grown to extract pyrethrins which are active ingredients for insecticides (Greenhill 2007). The Australian pyrethrum industry supplies over 50% of the world market. Surveys of Tasmanian crops in spring 2013, detected the presence of a fungus putatively identified as Itersonilia perplexans Derx. on foliage in 54 of 86 surveyed fields (Hay et al. 2015). This fungus was associated with necrotic leaf tips often spreading to encompass whole leaves. However, pathogenicity to pyrethrum was not confirmed. To isolate, tissue was excised from foliar lesions, surface sterilised using 0.4% NaClO, placed onto 2% water agar and incubated at 20°C for 5 days. Colonies were pure-cultured by hyphal-tip transfer onto potato-dextrose agar. Eleven isolates were cultured onto yeast mold agar (YMA) for 14 days at 15°C in the dark (Horita and Yasuoka 2002). Colonies were slow growing (1.9 to 2.3 mm/day) white to buff on both surfaces, with a darker center visible on lower surfaces. Mycelia were straight and hyaline with clamp connections at the septa. Squares transferred from the edge of YMA colonies onto microscope slides produced ballistoconidia that were aseptate, granular and lunate, kidney or lemon-shaped after 24 h. Ballistoconidia lengths and widths (n = 50/isolate) ranged from 14.6 to 20.4 µm and 10.0 to 13.6 µm. Chlamydospores were not observed. These observations were consistent with descriptions of I. perplexans (Koike and Tjosvold 2001; Liu et al. 2015). All 11 isolates were sequenced across the internal transcribed spacer (ITS) region of rDNA (ITS; primers V9G/ITS4; de Hoog and van den Ende 1998; White et al. 1990), and large (LSU; primers LROR/LR7; Rehner and Samuels 1995), and small (SSU; NS1/NS4; White et al. 1990) subunits of rDNA (Genbank accession nos. KU563626 to KU563658). The ITS (673 bp), SSU (1,047 bp) and LSU (1,318 bp) differed by 3, 1 and 0 bp, respectively, across isolates. Maximum parsimony and maximum likelihood analyses of a concatenated 3 loci alignment with Cystofilobasidiales representatives (Liu et al. 2015) placed all isolates and the I. perplexans ex-neotype strain CBS 363.85 within a single monophyletic clade with 100% bootstrap support. Two representative isolates are stored at the Plant Pathology Herbarium (accession nos. BRIP 57986 and 57987). Leaves of 46-day-old pyrethrum plants (n = 45), generated from surface sterilised seed, were inoculated with a 1.5 × 105 ballistoconidia/ml suspension (equal mix of eight isolates) and maintained between 10 and 22°C under a 12-h photoperiod for 14 days. Brown necrotic leaf tips, consistent with reported field symptoms were observed on 71% of plants and I. perplexans was recovered from 69% of symptomatic plants. For flower inoculations, pyrethrum plants were removed from fields as vegetative plants in spring and maintained in a greenhouse set at 20:14°C and 14:10 h day:night. Open flowers (10 per plant) were dipped into a 1.2 × 104 ballistoconidia/ml suspension mix of three isolates. Brown withered ray florets were observed on 10/12 plants 18 days post-inoculation, matching those described in petal blight of chrysanthemum (McRitchie et al. 1973). I. perplexans was re-isolated from 11/12 inoculated plants and 1 control plant (of 12) which exhibited the same symptoms. In both experiments, I. perplexans was identified based on its distinctive morphology. This confirms the pathogenicity of I. perplexans to both pyrethrum leaves and flowers.

Cocculus orbiculatus (L.) DC. (Menispermaceae) is a vine traditionally used as a medicinal herb in Asia and grows primarily in wet tropical biomes (POWO 2022). In late April 2022, typical symptoms of powdery mildew were observed on leaves of C. orbiculatus on the campus of Nanjing Forestry University, China. Approximately 90% of the plants were infected. Superficial mycelia and conidia were amphigenous on the leaves, pale yellow, and severe infections caused necrotic discoloration of the leaves. Infected leaves were collected to identify the pathogen. Hyphae were hyaline and branched. Conidiophores were solidary, unbranched, straight, cylindrical, smooth, hyaline, 69.3 ± 11.1 × 7.9 ± 0.6 µm, (n = 50). Foot cells were mostly cylindrical, straight, rarely curved, smooth, hyaline, 53.2 ± 6.2 × 7.5 ± 0.4 µm, (n = 50). Appressoria were lobulate, solitary or in opposite pairs, hyaline to pale yellow. Conidia were single, ellipsoid, oval or doliform, hyaline or pale yellow, 38.6 ± 2.3 × 20.9 ± 0.8 µm, (n = 50). Conidial germ tubes developed at a subterminal position. No chasmothecia were observed. Representative specimens were deposited in the NJFU Herbarium (NF50000010). Based on these morphological characteristics, this fungus (MFJ 1-1) was provisionally identified as Erysiphe alphitoides (Takamatsu et al. 2007). To verify the identification of the pathogen, mycelia and conidia were obtained from diseased leaves and genomic DNA of the fungus (MFJ 1-1) was extracted. The internal transcribed spacer region (ITS) and large subunit (LSU) gene were amplified with primers ITS1/ITS4 and LR0R/LR5, respectively (White et al. 1990, Rehner and Samuels 1994). The sequences were deposited in GenBank (ON612134 for ITS, ON620080 for LSU). BLAST results showed that the ITS and LSU sequences were highly similar to E. alphitoides [ITS: KF734882, identities = 632/633 (99%) LSU: MK357414, identities = 890/893 (99%)]. Phylogenetic analyses with the concatenated sequences using Bayesian inference and maximum likelihood placed the isolate in the clade of Erysiphe alphitoides . Pathogenicity was confirmed by gently pressing the infected leaves onto five leaves per plant, and three healthy plants were inoculated. Three uninoculated plants served as controls. The plants were placed in a growth chamber with a 16 h photoperiod at 22 ± 2°C, 70% of relative humidity. Symptoms developed 10 days after inoculation, whereas the control leaves remained symptomless. The powdery mildew developing on the inoculated plants was identified to be E. alphitoides based on morphological characters and ITS sequences. This fungus has a worldwide distribution and a broad host range. Recently, Ipomoea obscura (Pan et al. 2020) and Aegle marmelos (Banerjee et al. 2020) have been found to be additional hosts. To our knowledge, this is the first report of powdery mildew caused by E. alphitoides on C. orbiculatus in the world. This finding provides crucial information for developing effective strategies to monitor and manage this disease.

At present, chayote (Sechium edule (Jacq.) Swartz) have been widely planted in Guizhou Province, southwestern China, and the cultivation area in Huishui county ranks first among all the counties or cities in Guizhou Province. Chayote leaf spot was firstly observed in Huishui County (25.99°N, 106.64°E) from April to June in 2019. The disease incidence ranged from 52% to 58%, and the severity of leaf symptoms ranged from 34 to 41% across nine chayote plantations. Such levels disease development lead to considerable enocomic losses. Leaf lesions initially occurred at the leaf margins, and the lesions expanded gradually, becoming dark brown and irregularly shaped. To identify the leaf spot-associated pathogen, the samples were cut from lesion margins, sterilized with 75% ethanol followed by 0.5% sodium hypochlorite for 30 s, rinsed with sterile water three times, and transferred onto potato dextrose agar (PDA). They were then incubated at 25°C in darkness for 5 days. The hyphal tips from the margins of growing colonies were successively transferred to fresh PDA plates for obtaining isolates. All strains grew with a similar morphology on PDA, malt extract agar (MEA), and oatmeal agar (OA) plates, and the colonies presented smooth margins and abundant mycelia on all three media. The colonies were gray to light green on PDA and gray on MEA and OA at 5 days post-inoculation. At 11 days post-inoculation on 10% V8 medium at 25oC with a cycle of 14 h/ultraviolet light and 10 h/night, sexual morph was observed, ascomata pseudothecioid, subglobose, 121 × 142 μm, ostiolate, walls of brown textura angularis, and smooth. Asci were bitunicate, cylindrical to clavate, 7 × 90 μm, 8-spored, ascospores elliptical, straight to slightly curved, 5 × 17 μm, 1-septate, constricted at the septum, sub-hyaline, and smooth. Conidiomata were pycnidial, subglobose, 166 × 258 μm, ostiolate, wall of dark brown to black textura angularis, smooth. Conidia were short, cylindrical or slightly reniform, 6.18 ± 0.67 × 3.51 ± 0.33 μm (n = 50), 0-1 septate, hyaline, smooth. Chlamydospores were subhyaline to dark brown, verruculose or incidentally tuberculate, and solitary or in chains, and 14.16 ± 1.23 × 5.92 ± 0.49 μm (n = 50). The morphological characteristics of the strains were identical to those of Stagonosporopsis caricae (Aveskamp et al. 2010; Sivanesan 1990). The genes or DNA sequences of the partial 28S large subunit rDNA, the internal transcribed spacer, RNA polymerase II second largest subunit, and beta-tubulin were amplified (Liu et al. 1999; Rehner and Samuels 1994; Sung et al. 2007; Vilgalys and Hester, 1990; White et al. 1990; Woudenberg et al. 2009). The sequences were further deposited in GenBank (ITS: MZ619042-MZ619044, LSU: MZ620651-MZ620653, RPB2: MZ673652-MZ673654, and TUB: MZ673649-MZ673651). A phylogenetic analysis confirmed these strains to be identical to S. caricae reference strains CBS 248.90, CBS 282.76, and PD 06/03082531. Pathogenicity tests were performed on potted chayote and five-year-old chayote in the field. Mycelial plugs (6 mm diameter) were applied on wounded chayote leaves. Brown spots appeared on the wounded sites of chayote leaves after inoculation with mycelial plugs. No symptoms were observed on the leaves inoculated with PDA plugs lacking mycelia. The re-isolated pathogen from diseased plants was identical to the representative strains used for inoculation. To our knowledge, this is the first report of S. caricae causing leaf spot on chayote in China, and our findings will be useful for its management and further research.

Tribulus terrestris L. is an annual herbaceous medicinal plant of Zygophyllaceae, which is cultivated commercially in China. Subrotund or irregular gray, sunken, necrotic spots ranging from 2 to 9 mm were observed on diseased leaves of T. terrestris landrace in Fushun County, Liaoning Province of northeast China in July 2021, with more than 32% of the plants being infected in a 18-ha field. The symptoms first appeared on older leaves and gradually spread to younger leaves. The lesions developed a white center gradually and became perforated; multiple lesions could coalesce (Fig. 1). Ten symptomatic leaves were collected and the diseased tissues were cut into small pieces, immersed in 1% NaOCl for 2 min, rinsed three times with sterile water, and placed on acidified potato dextrose agar (PDA) in Petri dishes at 25°C in darkness. Fifteen suspected Colletotrichum single-spore fungal isolates (JL1 to JL15) with consistent morphological characteristics were obtained, and isolate JL6 was selected for identification and pathogenicity testing. Colonies on PDA were flat with an entire margin, dense and white at first, then became dark gray with numerous black microsclerotia and formed a concentric circular pattern with aging. Conidia were single-celled, sickle-curved with a tapered tip and truncate base, ranging from 16.46 to 20.26 μm in length and 2.81 to 3.96 μm in width (n=100). Setae were dark brown, septate, straight with a slightly acute tip, 75.45 to 135.63×3.19 to 4.95 μm in size. Appressoria were dark brown, round or irregular, mostly in groups. All characteristics were consistent with the descriptions of C. truncatum (Damm et al. 2009). Further confirmation of the identification was determined according to methods described previously (Damm et al. 2009). The rDNA internal transcribed spacer region (OP364400, 585 bp), and actin (OP380867, 290 bp), beta-tubulin (OP380868, 498 bp), chitin synthase 1 (OP380869, 277 bp), glyceraldehyde-3-phosphate dehydrogenase (OP380870, 280 bp), and histone (OP380871, 411 bp) genes were amplified by PCR and sequenced (Carbone and Kohn 1999; Glass and& Donaldson 1995; Guerber et al. 2003; O'Donnell and Cigelnik 1997). BLAST results showed 98-100% similarity at 85-97% coverage compared to the corresponding sequences of the type strain CBS 151.35 (GU227862, GU227960, GU228156, GU228352, GU228254, and GU228058). Phylogenetic analysis combining all loci revealed that the isolate JL6 and the type strains of C. truncatum clustered in one group (Fig. 2). One-year-old healthy seedlings of T. terrestris (cultivar: landrace) were used for pathogenicity test. Suspension (1×10 5 conidia/mL) of isolate JL6 was sprayed on ten seedlings, and ten seedlings sprayed with sterilized distilled water were used as the control. Three replicates were performed on each treatment. All plants were kept at 28±1°C (12 h photoperiod), and were evaluated after 7 days. The inoculated plants showed lesions on the leaf surface, similar to those in the field, and the control remained symptomless. The pathogen was successfully reisolated and identified using the methods mentioned above. To our knowledge, this is the first report of C. truncatum causing anthracnose on T. terrestris , which will provide valuable information for designing strategies to manage anthracnose on T. terrestris .

China is considered as the main producer of kiwifruit (Actinidia spp.) in the world. During 2020-2021, root rot (~8000 plants, ~5% disease incidence) of 3-year-old kiwifruit (cv. Xuxiang) was observed in Lujiang County (117°24'E, 31°15'N), Anhui, China. This disease usually occurred in fields with poor drainage in hot and humid summers. Symptoms started on leaves showing dehydration and curling, the last root of diseased plant turned black and died. Dig out the skin on rotten root was cracking and flaking and white mycelium covered on surface. Twenty rotten tissues from ten plants were cut and surface disinfected with 1% NaOCl for 5 min, rinsed in sterile water, and cultured on potato dextrose agar (PDA) at 25 ± 2°C in the dark. Fifteen fungal isolates were obtained. The first type (KWRR1, 3-10) was cotton-like, reverse with white outer margin, and light brown inner region on PDA. The second type (KWRR2, 11-15) was cotton-like on PDA but appeared pale yellow in reverse. On oatmeal agar, the KWRR1 colony was flat with little aerial hyphae and was red, while KWRR2 was hyaline. On carnation leaf agar (CLA), microconidia of the KWRR1 and KWRR2 isolates were reniform, fusiform or oblong, 0-1 septate, and measuring 1.9-4.3×8.4-15.7 µm and 3.0-3.8×8.2-16.7 µm, respectively (n=50). The macroconidia of KWRR1 were straight or moderately curved, 3-5 septa (2.7-4.6×21.5-52.6 µm in size, n=50). For KWRR2, the macroconidia were straight or slightly curved and with 3-4 septate, 4.1-4.8×26.1-30.8 µm (n=50). Chlamydospores of the KWRR1 and KWRR2 isolates were 1-2 celled, irregular globose, measuring 4.5-8.5 µm and 7.6-9.0 µm diam, respectively (n=50). To identify the isolates, four DNA fragments (RPB1, RPB2, ITS and TEF-1α) were amplified and sequenced from all isolates (O'Donnell, et al. 2012; White et al. 1990; O'Donnell et al. 2022). BLAST analysis of the RPB1, RPB2, ITS and TEF-1α sequences of the KWRR1 isolates (OL474057, OL474055, OL468550, OP382187) showed highest identity with F. solani (NRRL66304; MW218134, KT313623, KT313633, KT313611) at 98.2%-99.8%, while KWRR2 (OL505579, OL474056, OL468551, OP382188) showed that their homology with F. breve (NRRL28009; HM347149, EF470136, DQ094351, DQ246869) at 98.2%-99.4%. F. solani and F. breve belong to clade 3 of the F. solani species complex (FSSC) (Geiser et al. 2021). Phylogenetic analysis based on RPB2, ITS and TEF-1α sequences with MEGA7 software (Šišić et al. 2018), placed the KWRR1 sequences with F. solani (FSSC5), while there of KWRR2 nested with F. breve (FSSC15). One-year-old seedlings (n=6) of 'Xu Xiang', growing in a greenhouse (at 28℃, relative humidity 80%), were inoculated by drenching the soil with a conidial suspension with one of the two isolates (30 ml, 106 conidia/ml). Control plants (n=6) were inoculated with sterilized water and the pathogenicity assay was repeated three times. One month post-inoculation, the leaves of inoculated plants became chlorotic, wilted and died, whereas the controls were disease-free. F. solani and F. breve were successfully reisolated from diseased samples (n=6) and verified based on morphology and sequencing as described above, fulfilling Koch's postulates. Members of the FSSC cause root rot on many hosts (Coleman. 2016; Schroers et al. 2016), but this is the first report of F. solani and F. breve causing root rot disease on kiwifruit in China. The result will serve as the foundation for management of root rot of kiwifruit.

Fox nut also known as Gorgon nut, Makhana (Euryale ferox Salisb.) is a high value aquatic crop belonging to the family Nymphaeaceae. In India, it is generally grown in flood prone areas of North Bihar, lower Assam, parts of West Bengal, Odisha, Manipur and Tripura (Jana et al., 2018). India contributes nearly 70-80% of the global fox nut production. During September 2021, a phytoplasma like symptom was noticed on fox nut leaves at Basudeopur Farm of Research Centre for Makhana, Darbhanga, Bihar, India (23° 9' N and 65° 53' E). The characteristic symptom was that some portion of leaf lamina deformed along the veins with wrinkled and raised overgrowth or hypertrophy. The veins were thickened and reddened in the infected leaf area. The infection occurs in petiole as well as in flower stalk. The disease incidence was found as high as 30% which caused severe yield loss which was calculated to be 40% in that particular field. Total of 20 sampled fox nut plants, 10 symptomatic and 10 asymptomatic ones, were collected and tested for the presence of phytoplasma. A nested PCR assay using the phytoplasma universal 16S rRNA primer pairs: P1/P7 followed by R16F2n/R16R2 (J. Jović et al. 2011) amplified the expected ~1.2-kb 16S rDNA fragment in all 10 symptomatic samples. No amplification was detected from asymptomatic samples. One of the ten 1.2-kb nested 16S rDNA PCR products was gel purified, cloned into the pGEM-T-easy plasmid vector (Promega, Madison, WI), and sequenced and was deposited in NCBI under the Accession no.OL873590. BLAST analysis showed that the sequence of the PCR 16S rDNA product was 100% identical to several GenBank sequences of Ca. P. solani (16SrXII Stolbur group) viz. KF907506. Furthermore, analysis by iPhyClassifier software showed that the virtual restriction fragment length polymorphism (RFLP) pattern of the sequenced PCR 16S rDNA product is identical (similarity coefficient 1.00) to the reference pattern of the 16SrXII-A subgroup. Identification of 'Ca. P. solani' was conducted following the STOL11 stolbur-specific protocol (Radonjić et al. 2009). Sequencing of tuf gene (Elongation factor Tu) was performed by using tuf marker genes (Cvrković et al. 2014) from 10 symptomatic and 10 asymptomatic samples. Sequence of the amplified gene (896 bp) was deposited in GenBank under Accession number OM174272. The presence of 'Ca. P. solani' was detected in all symptomatic samples, while all control plants tested negative. The RFLP analysis of tuf gene nested PCR products using HpaII endonuclease (Fermentas) revealed uniform tuf-b type in all positive samples. Nucleotide blast analyses showed that the tuf gene was 100% identical to STOL11 strain of C. P. solani subgroup 16SrXII-A (Accession No JQ797670). For developing a suitable management strategy, identification of the vector is essential. Leaf hoppers visiting the infected plants as well as nearby crop fields will be tested for presence of the phytoplasma. To the best of our knowledge, this is the first report of Candidatus Phytoplasma solani' (16SrXII-A) infecting Fox nut (Euryale ferox Salisb.) in India. References Cvrković et al. 2014. Plant Pathol. 63:42. https://doi.org/10.1111/ppa.12080 Jana, B. R., et al. 2018. Int. J. Curr. Microbiol. App. Sci. 7(12): 578-587. https://doi.org/10.20546/ijcmas.2018.712.072 Jović, J. et al. 2011. B. Insectol. 64:S83. ISI Radonjić, S. et al. 2009. J. Phytopathol. 157:682. https://doi.org/10.1111/j.1439- 0434.2009.01560.

Kiwifruit (Actinidia spp.) is one of the most important fruit crops in China. Post-harvest anthracnose symptoms were observed on kiwifruit in October 2021. Kiwifruits 'Longcheng 2' (n=200) were obtained from an orchard in Kuandian city of Liaoning province, China (124°32'E, 40°20'N). And cultivar 'Cuiyu' (n=100) were harvested from orchards in Mianzhu city, Sichuan Province, China (104°03'E, 31°15'N). After storage at 24 °C and 80% relative humidity (RH) for 8 days, the disease incidence of 'Longcheng 2' and 'Cuiyu' was 30% and 15%, respectively. Symptoms of diseased fruits appeared as water-soaked, irregular and light brown lesions. Orangish conidial masses were observed on some fruits. Ten lesion margins (5×5 mm) from 'Longcheng2' or 'Cuiyu' were respectively excised, surface sterilized by 70% ethanol (1 min), 1% NaOCl (5 min), washed, dried, plated on potato dextrose agar (PDA), and incubated at 25 °C for 5 days. Eight isolates were obtained from 'Longcheng 2' (LC1-3 to LC1-10) and nine strains from 'Cuiyu' (CY1-2 to CY1-10). The representative isolates LC1-3 and CY1-2 were put on PDA, and appeared white to pale gray on the upper side. However, isolate LC1-3 secreted red pigments after 7 days of culture. Conidia of LC1-3 were hyaline, smooth-walled, single-celled, cylindrical (3.0 to 4.9×7.2 to 14.7 µm, n=50). Ellipsoidal single cell conidia of CY1-2 were hyaline, and ranged in size from 3.2 to 5.0×8.5 to 13.9 µm (n=50) born on conidiophores. Appressorium of isolates LC1-3 and CY1-2 were globose to ellipsoid with 4.2 to 7.4×7.3 to 10.8 µm and 3.0 to 4.9×6.3 to 10.3 µm in size, respectively (n=50) (Fu et al. 2019 ). Four genes (ACT, CHS, GAPDH, TUB2) and the ITS region were successfully amplified and sequenced from all isolates (Weir et al. 2012). Based on sequence alignment, the isolates from 'Longcheng 2' or 'Cuiyu' were identical. BLAST analysis of the ACT, CHS, GAPDH, ITS and TUB2 sequences of LC1-3 (ON018724, ON018722, ON018720, OM980324, ON018718) or CY1-2 (ON018725, ON018723, ON018721, OM980325, ON018719) showed high similarity with C. fioriniae (CBS 128517; JQ949613, JQ948953, JQ948622, MH865005, JQ949943) were 97.1% to 99.7% or 98.1% to 99.7%, respectively. Phylogenetic analysis using concatenated sequences (maximum likelihood method) with MEGA 11 showed LC1-3 and CY1-2 were located within the same clade with C. fioriniae. Previous studies showed that C. fioriniae was classified into three subclades (Damm et al. 2012; Fu et al. 2019). However, LC1-3 and CY1-2 were located within a new subclade, namely the subclade IV. To test pathogenicity, healthy and mature kiwifruits 'Donghong', 'Cuiyu', 'Xuxiang', 'Hayward' and 'Jinyan' were surface sterilized. Each un-wounded fruit was dropped with 10 μl conidial suspension (105 conidia/ml) on the fruit surface. All fruits were placed into a plastic box and stored at 24 °C under 80% RH. Each treatment consisted of 10 fruits and were repeated three times. After 8 days, typical anthracnose lesions were observed on all inoculated fruits. Whereas, the controls treated with sterile distilled water remained asymptomatic. The pathogens re-isolated from diseased fruits were similar morphological and identical to the original isolates, fulfilling Koch's postulates. Anthracnose caused by C. fioriniae has been reported on many fruits (Ling et al. 2020; Waller et al. 2021), but to our knowledge, this is the first report of anthracnose on kiwifruit caused by C. fioriniae. The results will provide valuable information for avoiding post-harvest anthracnose on kiwifruit.

Elymus nutans is an important feed and forage resource in alpine region of northwestern China, and helps to maintain the ecological balance on Qinghai-Tibetan plateau (Fei et al. 2010). In September 2021, brown leaf spots were observed in Shandan Horse Farm (38.3061°N, 101.2453°E), Gansu province of China.Disease severity of leaves was estimated to be 38% based on a random sample of 100 leaves from each of 10 arbitrarily placed quadrats on the farm.The typical symptoms on leaves appeared as brown to dark brown spots with grayish white in the center, surrounded by a yellow halo. A total of twenty diseased leaves were collected from five different plants in the field. The lesions (about 5 mm) from these samples were initially soaked in 75% ethanol for 30 s followed by soaking in 1% NaClO solution for 1 min, repeatedly rinsed with sterilized water, air dried, and put on potato dextrose agar (PDA). After 7 days of incubation at 25°C in the dark, the same fungus was consistently isolated; the pure isolates were obtained by single-spore cultures (Cai et al. 2009). The colonies were irregular in shape and black in color with white margins. Conidia were spindle-shaped, dark brown, 5 to 9 septa (7 septa in general), and a size range of 21.74 to 78.97 × 7.95 to 21.12 µm (avg. 57.25 × 17.76 µm, n = 50),morphologically similar to B. sorokiniana reported on Avena nuda in China (Li et al. 2019). The ITS region of rDNA and partial glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) gene of the representative isolate PJC5 were amplified using the primers ITS1/ITS4 and gpd1/gpd2, respectively (Manamgoda et al. 2014). After sequencing sequences were deposited into GenBank with accession numbers OM419194 (ITS) and OM718009 ( GAPDH ). BLAST analysis showed 99% and 100% identity with the corresponding sequences (accession numbers MH855159.1 and HG779088.1) of known strain CBS 140.31 of B. sorokiniana (Manamgoda et al. 2014). For pathogenicity tests, ten 8-week-old healthy plants obtained by growing E. nutans in pots were spray-inoculated separately with a conidia suspension of 1 × 106 conidia/ml of isolate PJC5. Ten plants were also sprayed with sterilized distilled water as controls. Then all plants were individually covered with transparent polyethylene bags for three days to maintain high relative humidity and placed in greenhouse at 25°C. Seven days after inoculation, symptoms of leaf infection were similar to those observed in the field, while no symptoms appeared on leaves of control plants. The experiments were conducted three times and the pathogen was re-isolated from inoculated leaves and was confirmed as B. sorokiniana based on morphological and molecular analyses.  B. sorokiniana has been reported to cause leaf spot of E. riparius in the United States (Roane et al. 2005) and E. breviaristatus (Zhuang, 2005) and A. nuda (Li et al. 2019) in China. To our knowledge, this is the first report of  B. sorokiniana  causing leaf spot on  E. nutans  in China. Identifying this pathogen provides a foundation to prevent this complex disease and to reduce economic loss.

Bajra Napier hybrid (Pennisetum glaucum x Pennisetum purpureum) is a perennial, high yielding grass and is widely grown for fodder in India. During August-2021, Bajra Napier hybrid germplasm line (NBN 15-2) showed severe leaf blight symptoms at ICAR-Indian Grassland and fodder research institute, Jhansi (25.527890 N, 78.5451400 E). Symptoms were initial irregular yellow spots on the leaf lamina, which later became brownish, coalesced and gave blighted appearance to the leaf surface. Disease severity recorded was 55 to 60 percent. To isolate the pathogen, 10 symptomatic leaf samples were cut into small pieces (~4 mm2), surface-sterilized with 70% ethanol for 30 seconds and rinsed with sterile water. Sterilized leaf pieces were transferred to potato dextrose agar (PDA) and incubated at 28°C for 7 days. Four similar fungal isolates (BNHCP-1 to BNHCP-4) were obtained from the affected portions. The colonies were grayish-brown with dark brown margins. Conidia were mostly clavate, elongated, straight or bent at the terminal cell, with 2-3 septa with dimensions of 17.5 to 30 μm × 10 to 12.5 μm (avg. 24 μm × 12 μm; n=40). The third cell from the base was broader and darker. These morphological characteristics were consistent with previous descriptions of Curvularia penniseti (Mitra) Boedijn (Ellis, 1971). To confirm the species, BNHCP-1 was chosen as representative isolate for further studies. Internal transcribed spacer (ITS) region and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene of isolate BNHCP-1 was amplified with primers ITS1F/ITS4R (White et al. 1990) and GDF/GDR (Templeton et al. 1992), and sequenced. The sequences were deposited in GenBank (ITS: OM073980; GAPDH: OM103702.2). BLASTn analysis showed 99.6% and 98% similarity of ITS and GAPDH gene respectively with GenBank accession numbers MH859833.1 (548 bp/550 bp) and MN688838.1 (130 bp/133 bp) of C. penniseti. A maximum-likelihood phylogenetic analysis based on concatenated sequences of ITS and GAPDH gene using MEGA X placed the isolate BNHCP-1 within a clade comprising C. penniseti. Pure culture of BNHCP-1 was deposited in National Agriculturally Important Microbial Culture Collection (NAIMCC), Maunath Bhanjan (Uttar Pradesh) with accession number NAIMCC-F-04251. For pathogenicity, root slips of Bajra Napier hybrid germplasm line NBN 15-2 were transplanted in pots (6 pots; 2 root slips per pot) and kept for fresh growth in a growth chamber at 25 0C for 21 days. Bajra-Napier hybrid plants were sprayed until runoff with conidial suspension (5 × 105 conidia/ml) made from 2-week old fungal colony grown on PDA petri dish. The pots were covered with plastic bag for 48 h to maintain humidity. Inoculated plants displayed small, brown, oval-shaped lesions within seven days on the lamina and edges of the leaf which later enlarged and gave blighted appearance to the leaf. Control plants were asymptomatic. The pathogen was re-isolated from the inoculated leaves and confirmed morphologically, fulfilling Koch's postulates. C. penniseti has been reported earlier from Pennisetum americanum, P. clandestinum, Sorghum and Triticum sp. from different parts of the world (Sivanesan, 1987). However, there is no report of C. penniseti in Bajra Napier hybrid. Thus, to the best of our knowledge, this is the first report of C. penniseti from Bajra-Napier hybrid grass in India. Further studies on economic impact of this disease on Bajra-Napier hybrid production and its presence on commercial cultivars are needed.

Dendrobium , the second largest genus of Orchidacea, are mainly distributed in Asia, Oceania and Europe (Ding et al., 2008). An emerging disease on D. huoshanense with symptoms resembling southern blight Sclerotium rolfsii Sacc. occurred during June to September from 2017 to 2020 in Huoshan, Lu'an, China. The yield and quality of D. huoshanense were seriously affected especially under greenhouse conditions in July, with a disease incidence of 42%. Early symptoms consisted of water-soaked lesions on the lower stem tissue. Then leaves turned pale green and withered, a dense white mycelial mat were formed on the lower stem along with 1- to 2-mm-diameter, white round sclerotia. Subsequently, infected stems collapsed with the whole stem yellow and withered, and with many dark brown sclerotia on withered stems. Sclerotia from 5 diseased plants were disinfected in 1% mercury bichloride for 10 s, rinsed in 75% ethanol for 30 s and then rinsed 4 times with sterile water, dried, and transferred to potato dextrose agar (PDA) with the cross section and incubated at 27 °C in darkness. Mycelia were selected from the edge of the colony and transferred to new PDA plates for purification of cultures after 3 days. Fungal colonies with white mycelia and abundant sclerotia developed after 7 days of incubation. Isolate morphological characteristics confirmed the identity as S. rolfsii (Mordue, 1974). To further confirm the identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA region, the elongation factor-1a gene (EF1a) and the large subunit (LSU) region of one representative isolate, MB-1, was amplified using the primers ITS1/ITS4 (White et al. 1990), EF1-983F/EF1-2218R (Rehner and Buckley 2005), and NL1/NL4 (O' Donnell et al. 1997), respectively. Sequences have been deposited in GenBank (Accession No. OM946593 for ITS, OL416131 for EF1a and OL373917 for LSU). There was 100% sequence identity to Athelia rolfsii ( S. rolfsii ) with the sequences MN610008.1 (ITS) and MW322687.1 (EF1a), and 99.84% sequence identity to MT225781.1 (LSU). Pathogenicity tests were performed by wound inoculation with culture discs of mycelia ( = 5 mm) on the stem base of 10-12 cm height plants (four stems per pot, one stem inoculated with one culture disc, four replicates). Four healthy stems of the plants served as a control. The test was conducted in an artificial climate incubator at 26±1 °C with a 16h light/8h dark photoperiod and plants were enclosed for 72 h in polyethylene bags (relative humidity = 90%). Two days post-inoculation, white mycelia developed in the wound and the leaves at the upper and lower parts of the wound began to turn yellow. Then the stem softened and turned yellow. White sclerotia were formed by the sixth day. By 12 days post-inoculation, stems were atrophied and collapsed, sclerotia were yellow brown, and most leaves showed yellow discolouration and fell off. S. rolfsii was re-isolated from infected plants. Control plants remained healthy. To our knowledge, this is the first report of S. rolfsii causing southern blight on D. huoshanense in Lu'an, China. Confirmation of the causal agent provides a basis for management of S. rolfsii in cultivated D. huoshanense .

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola -specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis . To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola .

Bacterial blight of arugula ( Eruca vesicaria subsp. sativa cv. Standard) was observed in a commercial crop being grown in a high tunnel under overhead irrigation in Argyle, NY in January 2021. Approximately 80-100% of the plants were affected. Symptoms started as small, angular, water-soaked lesions visible on both sides of the leaves, then expanded, coalesced and later dried and turned tan. Fluorescent pseudomonads from five different plants were isolated on King's medium B agar amended with boric acid, chloramphenicol, and cycloheximide (Schaad et al. 2001) from surface disinfested symptomatic leaf tissues macerated in phosphate buffer (10mM, pH 7.0). Five representative isolates from each of the five plants produced levan and were negative for arginine dihydrolase and oxidase. They did not rot potatoes but were able to induce a hypersensitive reaction on tobacco ( Nicotiana tabacum L. cv Glurk) within 24 h, thus demonstrating that the isolates belonged to LOPAT group 1 (Lelliott et al. 1966). DNA fragment banding patterns of these isolates generated by repetitive extragenic palindromic sequence PCR (repPCR) with BOXA1R primers were compared to the pathotype strains of Pseudomonas cannabina pv. alisalensis and Pseudomonas syringae pv. maculicola, known fluorescent pathogens of the Brassicaceae. The repPCR banding pattern of all isolates matched the pattern of Pseudomonas cannabina pv. alisalensis . Bacterial inoculum for pathogenicity experiments was prepared from 48 h KBBC agar cultures suspended in phosphate buffer (10mM, pH 7.0) and adjusted to 0.6 optical density at 600nm yielding approximately 108 CFU/ml. Five-week-old arugula plants were sprayed until run-off with one of the three isolates from arugula, a negative control (sterile buffer), or a positive control ( P. cannabina pv. alisalensis ) that is pathogenic to crucifers and also reported to cause disease on arugula in California (Bull et al. 2004). Experiments consisted of three replications of each treatment and two independent experiments were conducted. Small water-soaked spots resembling the original symptoms developed on all plants inoculated with the three representative isolates and P. cannabina pv. alisalensis . Moreover, reisolates from the symptomatic tissues were fluorescent on KBBC and had identical repPCR banding pattern as inoculated strains, demonstrating Koch's postulates. To our knowledge, this is the first report of bacterial blight on arugula caused by Pseudomonas cannabina pv. alisalensis in the Northeastern US. It was previously reported in California, Nevada, and Minnesota (Bull and du Toit 2009; Bull et al. 2004). This report may have significance for all brassica leafy green growers in the Northeast as P. cannabina pv. alisalensis has a broad host range including members of the Brassicaceae and oats which are commonly used as cover crops in mixed vegetable production.

Cotton (Gossypium hirsutum L.) is one of the major cash crops grown in the United States (U.S.) with a total acreage of over 11.5 million acres in 2021 (NASS, 2021). In Oklahoma, cotton represents an important economic crop and was grown on 490,000 acres during the 2021 growing season (NASS, 2021). In 2021, during a survey of a cotton field in Beckham County of Oklahoma, cotton plants showed typical virus-like symptoms including mosaic, yellow ring spots, discoloration and short internodes (Supplementary Fig. 1). Thirteen symptomatic and five asymptomatic samples were collected from cotton plants and brought to the University of Tulsa for further processing. Total RNA was extracted from all samples using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). Total RNA from two symptomatic samples (named EC3 and EC4) were subjected to high-throughput sequencing (HTS) on the NextSeq 500/550 High-Output kit v2.5 (Illumina, USA) at the genomic facility, Oklahoma State University (Stillwater, OK, USA). A total of 17,542,322 and 22,572,118 trimmed pair-ends reads for both samples were assembled using CLC Genomics Workbench (v12.0.3) (Qiagen, Inc) and subjected to BLASTn analysis. Two contigs of 556 bp and 1062 bp (average coverage 2,799X) for sample EC3 showed 99% and 91% nucleotide (nt) identities with 3'-UTR, 5'-UTR and P1A gene respectively of the Tobacco ringspot virus (TRSV) RNA1 of isolates WA-AM1 (MW495243.1), and IA-1-2017 (MT563078.1) respectively. The other two contigs, 221 bp and 561 bp (average coverage 23,070X) for sample EC4 showed, 100% and 96% nt identities with 3'-UTR, protease, and RdRp genes of TRSV RNA1, isolates WA-AM1 and YW (MT042825.1) respectively. The HTS data did not reveal any other viral sequence in these two cotton samples. To further confirm the presence of TRSV in these samples, previously designed specific primers to TRSV (Forward: 5'-GGAAATTAACTGGGATGATTT-3' and Reverse: 5'-GAGCTCCAACCTTAAAACCA-3') for RNA1, targeting the P1A and helicase genes, and another primer pair (Forward: 5'-GCATCCTCCCATGTTTTCT-3' and Reverse: 5'-GGGACAAACACGACACTA-3') for RNA2, targeting the coat protein and 3'-untranslated region, of TRSV were tested by RT-PCR assay. The sizes of amplified PCR products obtained from both isolates (EC3 and EC4) on 1% agarose gel were approximately 1,000 bp for RNA1 and 1,100 bp for RNA2. The amplified PCR products were cloned and three independent recombinant clones for each primer set were analyzed by Sanger sequencing. The resulting consensus sequences were used in a BLASTn search against the Genbank and matched with TRSV sequences. Consensus nt sequences analysis specific to RNA1 of EC3 isolate (Accession no. OM563300) and EC4 isolate (Accession no OM563301) showed 97% nt identities with TRSV isolate IA-1-2017. Consensus nt sequences specific to RNA 2 of EC3 isolate (Accession no. OM630605) and EC4 isolate (Accession no OM5630606) showed 92% and 90% nt identities with the corresponding sequences of WA-AM1 and IA-1-2017 isolates respectively. Further screening of the remaining 11 symptomatic samples resulted in two more positive TRSV samples that were co-infected with Cotton leafroll dwarf virus (CLRDV), six were positive to only CLRDV, and three were negative to both viruses by RT-PCR assay using the above TRSV specific primers and CLRDV specific primers AL674F/1407R (Avelar et al. 2019). None of the asymptomatic cotton samples were positive by RT-PCR to TRSV or CLRDV. Our results confirmed the presence of TRSV infection in these symptomatic cotton plants. The presence of TRSV could pose a new threat to cotton crops in Oklahoma and the U.S. due to its wide host range (Adam and Antoniw, 2005), and transmission through many vectors including nematodes, (Keinath et al. 2017), and seed (Hill and Whitman, 2014). To the best of our knowledge, this is the first report of TRSV infecting cotton naturally in the U.S. and in the world.

Pueraria montana var. thomsonii (Hereinafter referred to as Pmt) belongs to the Leguminosae and is widely distributed in China, Laos, Thailand, Myanmar, Bhutan and other Asian countries. The plant is called "Fenge" in China, and its root is widely used in medicine and food. In recent years, an unknown leaf spot disease of Pmt has occurred in Gaoming, Zhaoqing and Yunfu districts of Guangdong Province in China, where 1,600 hectares of Pmt plants were affected. The incidence rate of plants were more than 80% and led to 10-15% death of Pmt plants in Gaoming district. . In the early stage of the disease, radiating and water-soaking lesions appeared between the main veins and side veins of Pmt leaves. After the spread of the lesions, they formed brown and short strips with yellow haloes around them, which led to leaf shedding, plant death and decline of production. To isolate bacteria, diseased leaves were surface sterilized with 0.6% sodium hypochlorite solution for 30 s, followed by three consecutive rinses in distilled water. The leaves were aseptically macerated, and the macerate streaked on PDA medium. Whitish to dull white, mucoid, raised, round, and translucent colonies were obtained. All isolates were gram-negative and had a single, polar, sheathed flagellum. Sequences (approx. 1,458 bp each) of the 16S rRNA gene amplified from five isolates (FG2, FG3, FG9, FG12 and FG17) using primer pair 27F/1492R (Lane et al,1991) (GenBank Accession Nos. OL677034, OL677351, OL677352, OL677353 and OL677354 respectively) shared 99.93% sequence identity with that of Robbsia andropogonis (Synonyms: Burkholderia andropogonis) (Lopes-Santos et al,2017) type strain LMG2129 (NR104960.1). The specific 410-bp and 704-bp target fragments were also amplified from isolates using R. andropogonis-specific primers Pf/Pr (Bagsic et al,1995) and LJ23f/LJ24R (Duan et al,2009). The four housekeeping genes atpD, lepA, gyrB and rpoD were partially sequenced for FG9 isolates using primers atpD-F3/atpD-R3, lepA-F2/lepA-R, LJ23f/LJ24R and LJ25f/LJ26r (Duan et al,2009; Estrada-De et al,2013) respectively. Multilocus sequence analyses confirmed the isolates from Pmt as R. andropogonis. Physiological and biochemical tests revealed the isolates are negative for oxidase, arginine dihydrolase, saccharose and betaine, and positive for sorbitol, lactose and galactose (Gillis et al,1995; Lopes-Santos et al,2017). In addition, all isolates caused a hypersensitive reaction on leaves of Nicotiana benthamiana and were pathogenic to some crops, including maize (Zea mays), sorghum (Sorghum bicolor), carnation (Dianthus caryophilus), common bean (Phaseolus vulgaris), tomato. Five isolates (FG2, FG3, FG9, FG12 and FG17) pathogenicity were tested twice with a total of three replications per isolate. Two young leaves each of 3-month-old Pmt plants grow in greenhouse were sprayed a bacterial suspension at 108 CFU/ml, then covered the inoculated leaves individually with plastic bags for 24 h, and incubated at 100% relative humidity with 16 h of daylight at 30°C and 8 h of darkness at 22°C in a greenhouse. Radiating and water-soaked lesions with yellow haloes were observed between the main veins and side veins of Pmt leaves 5 days after inoculation and were similar to those caused by R. andropogonis in the field. Koch's postulates were fulfilled by reisolating bacteria from typical lesions on inoculated plants. And the reisolated bacteria were identical to the inoculated ones. To our knowledge, this is the first report of R. andropogonis on Pueraria montana var. thomsonii in China.

Fig ( Ficus carica L.) is widely grown in Oman mainly for its nutritional value and health benefits. In May 2020, survey was conducted for fig trees which were showing symptoms of decline in three farms where more than 1500 fig trees were grown. The incidence of the disease was 3 to 4 % of fig trees showing symptoms of dieback of the twigs, death of entire branch and discoloration of vascular tissues were observed in Sohar, North Al-Batinah governorate of Oman. The disease severity was range between 25 to 40 % in most of the infected tree. The death of severely affected trees was observed in about 3 % of the orchards. Symptomatic samples were collected and isolation of the causal agent was performed. Infected tissues were cut into small pieces and surface-sterilized with 1 % NaOCl for 3 min. The tissues were rinsed with sterile distilled water 3-4 times, blotted dry on sterile filter paper and placed on potato dextrose agar (PDA) medium under aseptic conditions. After 2-3 days of incubation of plates at 27°C, pure culture of the fungus was obtained by hyphal tip isolation technique. Two identical isolates were grown in the PDA medium. The fungal colony was dark grey to black colored on PDA medium and the fungus produced dense aerial mycelium and numerous dark colored pycnidia in 25 days at ambient temperature range between 23-25 ℃ and nature photoperiod. Pycnidia were raptured and 20 emerged conidia were measured. The mature conidia were 1-septate, brown, ellipsoid, with thick cell wall and having longitudinal striation. The average measurement of the length of 20 conidia was 22.5-25 (24.9 µm) however the width measured was 12.5-15 (15 µm). To identify the fungus, DNA was extracted from the mycelium using phenol-chloroform-isoamyl alcohol method, following Al-Mahmooli et al. (2015). The internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) and translation elongation factor 1- α (TEF) gene were amplified using ITS-4 and ITS-5 primers for ITS (White et al. 1990), EF1-983F and EF1-2218R and EF1-728F and EF1-986R primers for TEF (Alves et al. 2008), respectively and the amplified products were sequenced. BLASTn analysis of the ITS sequence of the fungal isolate revealed 100% identity with reference sequences of Lasiodiplodia theobromae (Pat.) Griffon & Maubl (MT075438.1). The sequence of TEF gene was 99% identical to the sequences of L. theobromae (XM_035519539.1 and MN461169.1). The nucleotide sequences were submitted to GenBank and accessioned with (MW590660) for ITS and (MZ159970, MZ159971, OM654917) for TEF gene. For phylogenetic analysis, we constructed a combined ITS-TEF dataset, following (Alves et. 2008). Using Maximum Likelihood phylogenetic analysis of the combined ITS-TEF dataset, our specimen falls in a clade formed by the members of L. theobromae (Supplementary materials). Pathogenicity of the fungus of three replicates (three fig seedlings) was established by artificial inoculation of 2- to 3-month-old potted fig seedlings with the fungus by making pin prick injuries on the stem at 5 cm above the soil level with a sterile inoculation needle, placing mycelial discs containing spores and pycnidia (15 × 15 mm) from 20-days old colonies grown on PDA on the injured surface and wrapping with parafilm which removed 48 hrs after establishing of infection. The three inoculated plants showed withering and drying of leaves 14 days after inoculation (DAI) begins near to the inoculation site expend to the younger leaves. Eventually, seedlings were showing dieback and death of entire seedling occurs in 25-28 DAI. The mock-inoculated plants remained symptomless. The fungus re-isolated from the diseased plants was confirmed by sequencing of ITS regions. The prevalence of dieback could be a potential threat to cultivation of fig in Oman. To the best of our knowledge, this is the first report of dieback disease caused by L. theobromae on fig in Oman.

Spearmint (Lamiaceae) is an aromatic herb widely cultivated in Mexico for its culinary, medicinal, and industrial properties. In May 2020, symptoms and signs of rust were observed in a two-ha commercial crop of spearmint in Cuautla, Morelos (18°50'26.6"N 98°57'31.9"W), Mexico. The disease incidence was 85% and the severity was 23%. Initial symptoms included chlorotic spots on the adaxial surface of the leaves. At advanced stages of the disease, necrotic spots surrounded by chlorotic halos were developed, and later the plants were defoliated. The signs were observed as numerous orange to reddish-brown erumpent pustules primarily on the abaxial surface of the leaves. Microscopic examination of the samples revealed the presence of subepidermal uredinia, erumpent, with hyaline and cylindrical paraphyses. Urediniospores (n = 50) were hyaline to light yellow, globose to obovoid, measuring 17-27  11-25 μm, including 0.6-0.7 μm wall thickness, individually supported on pedicels, echinulate, with two germinative pores. Morphological features of the fungus correspond with previous descriptions of Puccinia mentha by Kabaktepe et al. (2017). A voucher specimen (accession no. UACH448) was deposited in the Department of Agricultural Parasitology Herbarium at the Chapingo Autonomous University. To confirm identification, the 28S gene region of rDNA was amplified from one sample by a nested PCR using the primer sets Rust2inv (Aime, 2006) and LR6 (Vilgalys and Hester, 1990), and Rust28SF primers (Aime et al., 2018), and LR5 (Vilgalys and Hester, 1990) for the first and second reactions, respectively. The sequence of our specimen (GenBank accession No. OL878354) showed 100% homology (923/1304bp) with the type-specimen sequence of P. menthae (GenBank accession No. DQ354513) from Cunila origanoides from USA (Aime, 2006). Also, a phylogenetic analysis (Bayesian inference) including a published 28S dataset for Puccinia species was performed and the isolate UACH448 was grouped into a clade with P. menthae. Pathogenicity was demonstrated by spraying five ml of a suspension of urediniospores (1104 spores/ml) recovered from infected leaves onto leaves of ten healthy spearmint plants and ten noninoculated plants served as controls. All plants were maintained at temperatures from 28 to 35°C and relative humidity ranging from 70 to 80%. All inoculated plants developed the characteristic symptoms of the disease after 14 days, whereas the control plants remained symptomless. The pathogenicity test was performed twice with similar disease response. The morphological characteristics of the pathogen recovered from all the inoculated plants were identical to that originally inoculated, thus fulfilling Koch's postulates. To our knowledge, this is the first report of Puccinia menthae causing leaf rust on Mentha spicata in Mexico. This species has been previously identified in Australia (Edwards et al. 1999), New Zealand (Beresford et al. 1982), and USA (Farr and Rossman, 2021) on Mentha spicata. This disease reduces considerably the quality of peppermint plants, so it is necessary to develop management strategies.

Hemp, Cannabis sativa, was reintroduced to the US in 2014 after 50 years of prohibition. Since then, growers have focused primarily on cannabinoid production using female plants. Thus, most modern hemp has been asexually propagated in greenhouses and transplanted into fields. In December 2019, a commercial transplant producer in Fayette County, Kentucky reported 30% dieback on 'Seagull' hemp. Plants were potted into artificial media (unknown origin) immediately upon removal from the mist bench, and symptoms developed approximately two weeks afterward. Scattered plants developed stunting, yellowing, and wilting symptoms and then died within one week of symptom development. Roots had brown to black lesions distributed along roots that progressed into necrosis. Aleuriospores (chlamydospores) were visible under the dissecting microscope. Root pieces were surface sterilized with 10% household bleach for 2 min and then plated onto cut centers of ~1 cm thick sterilized carrot cross section (Williamson 2014). Resulting colonies were single-spored and maintained on PDA plates on laboratory benchtops (23°C, fluorescent lights). Three isolates were selected for pathogenicity testing and identification. Resulting colonies initially appeared white but darkened to black within two days following the development of aleuriospores (chlamydospores). Aleuriospores were dark brown, formed in chains of 4 to 5, and measured 10.00 to 14.27 × 5.62 to 11.23 μm (n=50). Endoconidia were hyaline, cylindrical, and measured 11.63 to 34.10 × 3.95 to 5.58 μm (n=50). To confirm pathogenicity, soil was washed from three 4-week-old hemp plants (proprietary cultivar) and roots were soaked in a 1x106 spore/mL conidial suspension for 5 minutes. In addition, the roots of three control plants were mock inoculated using sterile water. Inoculated and control plants were transplanted into sterile potting media and maintained in separate trays. Inoculated plants developed leaf yellowing and wilting symptoms 14 dai. Roots examined 21 dai had scattered brown lesions throughout and were colonized by the fungus. Aleuriospores and endoconidia isolated from the symptomatic roots were identical to the inoculum. Control plants did not develop symptoms after 21 dai. For molecular analyses, DNA was extracted from an actively growing (5 d) representative isolate (19FY005) on PDA using Quick-DNA™ Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA). Fragments of commonly used diagnostic loci ITS, ACT, RPBII and Mcm7 were amplified as described by de Beer et al (2014), Fourie et al (2015) and Duong et al (2012). Amplicons were sequenced by Sanger sequencing and the consensus sequences were compared with the NCBI GenBank database by BLASTn. ACT amplicon (OK135163) top hit was B. rouxiae (MF967149.1) with 100% similarity, Mcm7 (OK135165) top hit was B. rouxiae (MF967103.1) with 100% similarity, RPBII (OK135166) top hit was B. rouxiae (MF967194.1) with 99.80% similarity, and ITS (OK135164) top hit was B. rouxiae (MF952402.1) with 99.82% similarity. Berkeleyomyces spp (syn Thielaviopsis sp.) is the causal agent of black root rot in field crops such as cotton and tobacco and in ornamentals such as holly and pansy; it is also a common disease in greenhouse production systems. Introduction of a cryptic sister species in 2017 may suggest that reports of black root rot in many crops may be either B. basicola or B. rouxiae, both species are indistinguishable by morphology (Nel et al. 2017). Although both species have wide host ranges with no host specificity, speciation may be important in terms of pathogenicity, host susceptibility, and other cultural factors. As hemp acreage increases across the US, black root rot may become a more prominent disease in greenhouse transplant production systems and in fields.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 μm, 439.72 to 659.93 μm), W (maximum body width) = (403.92 ± 57.17 μm, 311.01 to 513.34 μm), St (stylet length) = (11.28 ± 1.05 μm, 9.82 to 12.91 μm), MBW (width of the median bulb) = (31.13 ± 3.32 μm, 23.66 to 35.55 μm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 μm, 58,62 to 71.92 μm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 μm, 2.72 to 5.00 μm). Male (n=20): L= (1038.25 ± 90.34 μm, 877.28 to 1206.12 μm), St= (18.13 ± 1.48 μm, 15.10 to 20.12 μm), a (body length divided by greatest body width) = (31.77 ± 4.03 μm, 23.29 to 41.16μm), MBW= (10.97 ± 0.78 μm, 9.05 to 12.31 μm), MB= (64.81 ± 3.45 μm, 59.59 to 71.38 μm), DGO= (4.05 ± 0.47 μm, 3.11 to 5.08 μm), and Spic (spicule length) = (22.57 ± 1.91 μm, 19.26 to 26.43 μm). J2 (n=25): L= (381.73 ± 25.85μm, 336.96 to 419.98 μm), St= (10.52 ± 1.03 μm, 9.15 to 12.14 μm), a= (24.35 ± 2.10 μm, 20.45 to 28.29 μm), DGO= (3.02 ± 0.42 μm, 2.42 to 3.79 μm), c (body length divided by tail length) = (8.90 ± 0.86 μm, 7.71 to 10.48 μm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 μm, 3.47 to 5.04 μm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

Hemp reemerged in 2014 after being illegal for over 50 years and restricted for 90 years. Today, hemp is primarily grown for production of cannabidiol (CBD), with limited acreage dedicated to fiber. One of the most frequent and destructive leaf spot diseases of hemp cultivars grown for CBD is Septoria leaf spot. Symptoms are mostly observed in lower leaves and inner canopy. Leaf spots begin as small, irregular, brown to gray spots that rapidly expand to about 5.0 to 7.5 mm in diameter. Pycnidia are scattered, round, dark brown to black in color, and measure 38.8 to 145.0 μm in diameter. Conidia are hyaline, curved but occasionally straight, pointed at the apex, and contain 3 to 4 septa. Morphological characteristics were similar to those reported for Septoria cannabis . Gene sequences from seven diagnostic loci ( elongation factor , β- tubulin , RNA polymerase II , large subunit , internal transcribed spacer, actin , and calmodulin ) did not match any published accessions. There are no published sequences for S. cannabis available for comparison. Phylogenetic analysis of concatenated sequences showed that isolates from hemp grouped separately from other Septoria spp. Similarity of morphological characteristics and lack of sequence data matching other Septoria spp. led to the conclusion that isolates collected from hemp in Kentucky are S. cannabis . This new information will serve as an update for Septoria leaf spot diagnostics, especially as hemp acreage continues to increase across the United States.