Search

Purpose To compare Thais’ health-related quality of life (HRQOL) and severity grading, efficacy and safety in daily-life-affected benign essential blepharospasm (BEB) patients at baseline and after Botulinum toxin type A (BTX-A) treatment. Design Prospective-observational study. Participants BEB patients with Jankovic rating scale (JRS) at least 3 in both severity and frequency graded from 14 institutes nationwide were included from August 2020 to June 2021. Methods Demographic data, HRQOL evaluated by the Thai version of EQ-5D-5L and NEI-VFQ-25 questionnaires, and severity grading score evaluated by Jankovic rating scale (JRS) at baseline, 1, and 3 months after the treatment were collected. The impact of the BTX-A injections and their complications were recorded. Results 184 daily-life-affected BEB patients were enrolled; 159 patients (86.4%) had complete data with a mean age of 61.40±10.09 years. About 88.05% were female, and 10.1% were newly diagnosed. Most of the patients had bilateral involvement (96.9%) and 12.6% had history of BEB-related accident. After BTX-A treatment, HRQOL improved significantly in 4 dimensions of EQ-5D-5L, except self-care. The EQ_VAS (mean±SD) was 64.54±19.27, 75.13±15.37, 73.8±15.85 (pConclusion Daily-life-affected BEB impacted HRQOL in most dimensions from both generic and visual-specific questionnaires. BTX-A treatment not only decreased disease severity, but also improved quality of life.

PurposeTo compare Thais' health-related quality of life (HRQOL) and severity grading, efficacy and safety in daily-life-affected benign essential blepharospasm (BEB) patients at baseline and after Botulinum toxin type A (BTX-A) treatment.DesignProspective-observational study.ParticipantsBEB patients with Jankovic rating scale (JRS) at least 3 in both severity and frequency graded from 14 institutes nationwide were included from August 2020 to June 2021.MethodsDemographic data, HRQOL evaluated by the Thai version of EQ-5D-5L and NEI-VFQ-25 questionnaires, and severity grading score evaluated by Jankovic rating scale (JRS) at baseline, 1, and 3 months after the treatment were collected. The impact of the BTX-A injections and their complications were recorded.Results184 daily-life-affected BEB patients were enrolled; 159 patients (86.4%) had complete data with a mean age of 61.40±10.09 years. About 88.05% were female, and 10.1% were newly diagnosed. Most of the patients had bilateral involvement (96.9%) and 12.6% had history of BEB-related accident. After BTX-A treatment, HRQOL improved significantly in 4 dimensions of EQ-5D-5L, except self-care. The EQ_VAS (mean±SD) was 64.54±19.27, 75.13±15.37, 73.8±15.85 (pConclusionDaily-life-affected BEB impacted HRQOL in most dimensions from both generic and visual-specific questionnaires. BTX-A treatment not only decreased disease severity, but also improved quality of life.

Influenza is a major cause of morbidity and mortality worldwide. The flu vaccine is the most important strategy to prevent influenza. Studies indicate that individuals with mental health disorders are at an increased risk of comorbid health conditions that predispose them to severe flu complications. This study examined the association between mental distress and influenza vaccine coverage among non-institutionalized adults in the United States. Data was analyzed from the 2016 Behavioral Risk Factor Surveillance System (BRFSS). The analytic sample (453,924) included those with valid information on health-related quality of life (HRQOL) and flu vaccine coverage. Bivariate analysis and logistic regression were performed. Those with infrequent mental distress had 1% (95% confidence interval [CI] 0.96,1.03) lower odds and those with frequent mental distress had 21% (95% CI 0.75,0.82) decrease odds of receiving the flu shot in comparison to those with no mental distress, given all else equal. A negative effect on influenza vaccination rates was observed with frequent mental distress when compared to those with no mental distress. Further studies are warranted to better understand this association.

BackgroundEarly detection of hepatocellular carcinoma (HCC), the most common primary liver malignancy, is crucial to offer patients a potentially curative treatment strategy such as surgical resection or liver transplantation (LT). However, easily accessible biomarkers facilitating an early diagnosis of HCC as well as a reliable risk prediction are currently missing. The microRNA(miR)-107 has recently been described as a driver of HCC in both murine and human HCC but data on circulating miR-107 in HCC patients are scarce. In the present study, we evaluated a potential diagnostic and/or prognostic role of circulating miR-107 in patients undergoing tumor resection or LT for early-stage HCC.MethodsThe Kmplot bioinformatic tool was used to query publicly available databases (including TCGA, GEO and EGA) in order to analyse the prognostic value of tumoral miR-107 expression in HCC patients (n = 372). Serum levels of miR-107 were measured by qPCR in n = 45 HCC patients undergoing surgical tumor resection (n = 37) or LT (n = 8) as well as n = 18 healthy control samples. Results were correlated with clinical data.ResultsA high tumoral expression of miR-107 was associated with a significantly better overall survival compared to patients with low miR-107 expression levels (HR 0.69, 95% CI 0.48-0.99, p = 0.041). In addition, serum levels of miR-107 were significantly higher in HCC patients when compared to healthy controls. However, miR-107 serum levels in HCC patients were independent of different disease etiology, tumor stage or tumor grading. HCC patients with baseline miR-107 expression levels above a calculated ideal prognostic cut-off value (9.82) showed a clear trend towards an impaired overall survival (p = 0.119).ConclusionTumoral miR-107 expression levels are a potential prognostic marker in early stage HCC. Furthermore, we describe a potential role of circulating miR-107 levels as a diagnostic biomarker in patients with early-stage HCC.

BackgroundThe optimal treatment for patients with severe coronavirus-19 disease (COVID-19) and hyper-inflammation remains debated.Material and methodsA cohort study was designed to evaluate whether a therapeutic algorithm using steroids with or without interleukin-1 antagonist (anakinra) could prevent death/invasive ventilation. Patients with a ≥5-day evolution since symptoms onset, with hyper-inflammation (CRP≥50mg/L), requiring 3-5 L/min oxygen, received methylprednisolone alone. Patients needing ≥6 L/min received methylprednisolone + subcutaneous anakinra daily either frontline or in case clinical deterioration upon corticosteroids alone. Death rate and death or intensive care unit (ICU) invasive ventilation rate at Day 15, with Odds Ratio (OR) and 95% CIs, were determined according to logistic regression and propensity scores. A Bayesian analysis estimated the treatment effects.ResultsOf 108 consecutive patients, 70 patients received glucocorticoids alone. The control group comprised 63 patients receiving standard of care. In the corticosteroid±stanakinra group (n = 108), death rate was 20.4%, versus 30.2% in the controls, indicating a 30% relative decrease in death risk and a number of 10 patients to treat to avoid a death (p = 0.15). Using propensity scores a per-protocol analysis showed an OR for COVID-19-related death of 0.9 (95%CI [0.80-1.01], p = 0.067). On Bayesian analysis, the posterior probability of any mortality benefit with corticosteroids+/-anakinra was 87.5%, with a 7.8% probability of treatment-related harm. Pre-existing diabetes exacerbation occurred in 29 of 108 patients (26.9%).ConclusionIn COVID-19 non-ICU inpatients at the cytokine release phase, corticosteroids with or without anakinra were associated with a 30% decrease of death risk on Day 15.

Previous research shows that there is a correlation between attitudes and academic achievement. In this article, we analyze for the first time the impact of interactive groups (IG) and dialogic literary gatherings (DLG) on the attitudes that students show towards learning. A quantitative approach has been performed using attitude tests validated by previous research. The data suggest that in both cases, the participants show positive attitudes. The social context has an important influence on students' attitudes. The items with higher correlations include group work, mutual support, and distributed cognition. In the case of IGs, group work is much more appreciated, while in the case of DLGs, self-image and self-confidence are the two most clearly valued attitudes. The positive impact of IGs and DLGs on students' attitudes may have potential for teachers in transforming their practices and decision-making within the classroom.

Photorhabdus luminescens is an enterobacterium establishing a mutualistic symbiosis with nematodes, that also kills insects after septicaemia and connective tissue colonization. The role of the bacterial mdtABC genes encoding a putative multidrug efflux system from the resistance/nodulation/cell division family was investigated. We showed that a mdtA mutant and the wild type had similar levels of resistance to antibiotics, antimicrobial peptides, metals, detergents and bile salts. The mdtA mutant was also as pathogenic as the wild-type following intrahaemocoel injection in Locusta migratoria, but had a slightly attenuated phenotype in Spodoptera littoralis. A transcriptional fusion of the mdtA promoter (PmdtA) and the green fluorescent protein (gfp) encoding gene was induced by copper in bacteria cultured in vitro. The PmdtA-gfp fusion was strongly induced within bacterial aggregates in the haematopoietic organ during late stages of infection in L. migratoria, whereas it was only weakly expressed in insect plasma throughout infection. A medium supplemented with haematopoietic organ extracts induced the PmdtA-gfp fusion ex vivo, suggesting that site-specific mdtABC expression resulted from insect signals from the haematopoietic organ. Finally, we showed that protease inhibitors abolished ex vivo activity of the PmdtA-gfp fusion in the presence of haematopoietic organ extracts, suggesting that proteolysis by-products play a key role in upregulating the putative MdtABC efflux pump during insect infection with P. luminescens.

Undifferentiated human embryonic stem cells have a distinct morphology (hESC). Changes in cell morphology during culture can be indicative of differentiation. hESC, maintained in diverse medias, demonstrated alterations in morphological parameters and subsequent alterations in underlying transcript expression and lineage differentiation. Analysis of morphological parameters showed distinct and significant differences between the undefined, less defined and Xeno-free medias while still maintaining pluripotency markers. This suggested that the less defined media may be creating dynamic instability in the cytoskeleton, with the cytoskeleton becoming more stabilised in the Xeno-free media as demonstrated by smaller and rounder cells. Examination of early lineage markers during undirected differentiation using d5 embryoid bodies demonstrated increased mesodermal lineage preference as compared to endodermal or ectoderm in cells originally cultured in Xeno-free media. Undefined media showed preference for mesoderm and ectoderm lineages, while less defined media (BSA present) demonstrated no preference. These data reveal that culture media may produce fundamental changes in cell morphology which are reflected in early lineage differentiation choice.

BACKGROUND:Adjuvant endocrine treatment improves survival after estrogen receptor (ER) positive breast cancer. Recurrences occur, and most patients with metastatic breast cancer develop treatment resistance and incurable disease. An influential factor in relation to endocrine treatment resistance is tumor hypoxia and the hypoxia inducible transcription factors (HIFs). Poor perfusion makes tumors hypoxic and induces the HIFs, which promote cell survival. We previously showed that hypoxic breast cancer cells are tamoxifen-resistant, and that HIF-inhibition restored tamoxifen-sensitivity. We found that HIF-induced tamoxifen-resistance involve cross-talk with epithelial growth factor receptor (EGFR), which itself is linked to tamoxifen resistance. Contralateral breast cancer (CBC), i.e. development of a second breast cancer in the contralateral breast despite adjuvant tamoxifen treatment is in essence a human in vivo-model for tamoxifen-resistance that we explore here to find molecular pathways of tamoxifen-resistance. METHODS:We constructed a tissue-microarray including tumor-tissue from a large well-defined cohort of CBC-patients, a proportion of which got their second breast cancer despite ongoing adjuvant therapy. Using immunohistochemistry >500 patients were evaluable for HIF-1α and EGFR in both tumors, and correlations to treatment, patient outcome, prognostic and predictive factors were analyzed. RESULTS:We found an increased proportion of HIF-1α-positive tumors in tamoxifen-resistant (CBC during adjuvant tamoxifen) compared to naïve tumors (CBC without prior tamoxifen). Tumor HIF-1α-positivity correlated to increased breast cancer mortality, and negative prognostic factors including low age at diagnosis and ER-negativity. There was a covariance of HIF-1α- and EGFR-expression and also EGFR-expression correlated to poor prognosis. CONCLUSIONS:The increased percentage of HIF-1α-positive tumors formed during adjuvant tamoxifen suggests a role for HIF-1α in escaping tamoxifen's restraining effects on breast cancer. Implicating a potential benefit of HIF-inhibitors in targeting breast cancers resistant to endocrine therapy.

AIMS:This research aimed to assess the application to the gambling industry, of Corporate Political Activity (CPA) analysis previously developed from public health research on tobacco industry interactions with political institutions and previously applied to the alcohol industry, but not the gambling industry. BACKGROUND:A growing body of literature has confirmed how public interest outcomes are frequently opposed by vested interests. This research focused on gambling industry submissions to a 2013 Australian Parliamentary inquiry into sports betting advertising. Gambling advertising became highly controversial following deregulation of sports betting advertising in Australia subsequent to the 2008 Australian High Court Betfair challenge. The dramatic increase in gambling advertising during sporting event broadcasts at children's viewing times and on new interactive technology, sparked public concerns. A series of national regulatory reviews followed and the gambling industry was actively involved in opposing further regulation. METHOD:The research used a corporate political activity (CPA) framework of analysis developed by UK tobacco public health researchers, which identified strategies and tactics used internationally by the tobacco industry, to broker pro-tobacco public policy outcomes. Testing the application of this CPA framework to gambling pro-industry strategies/tactics, this research focused on gambling industry submissions to the 2013 Australian Parliamentary Committee Inquiry. RESULTS:Like the tobacco industry, the research found the gambling industry used identified strategies and tactics, some new tactics and a new strategy of 'Corporate Social Responsibility', promoting 'responsible' industry practices and pre-emptive establishment of internal 'responsibility' units/practices. Despite public concerns regarding sports betting advertising, the gambling industry reinforced individual choice/blame for harms and claimed it acted responsibly. It did this using strategies identified in the tobacco industry CPA framework: information strategy (and shaping the evidence base); financial incentive strategy; constituency building strategy; policy substitution strategy; legal strategy; and constituency fragmentation and destabilization strategy. CONCLUSION:Similar to the CPA analysis applied to tobacco and alcohol industries, the research demonstrated the usefulness of the CPA taxonomy for analyzing and documenting pre-emptive industry policy strategies and tactics, exposing gambling industry efforts to maintain industry self-regulation via voluntary codes and avoid more government regulation. Cross-sectoral application of the framework signals great potential for use of CPA by policymakers and public health advocates as a tool in the analysis of corporate industry arguments/discourses.

Kava is regaining its popularity with detailed characterizations warranted. We developed an ultraperformance liquid chromatography high-resolution tandem mass spectrometry (UPLC-MS/MS) method for major kavalactones (kavain, dihydrokavain, methysticin, dihydromethysticin and desmethoxyyangonin) with excellent selectivity and specificity. The method has been validated for different matrices following the Food and Drug Administration guidance of analytical procedures and methods validation. The scope of this method has been demonstrated by quantifying these kavalactones in two kava products, characterizing their tissue distribution and pharmacokinetics in mice, and detecting their presence in human urines and plasmas upon kava intake. As expected, the abundances of these kavalactones differed significantly in kava products. All of them exhibited a large volume of distribution with extensive tissue affinity and adequate mean residence time (MRT) in mice. This method also successfully quantified these kavalactones in human body fluids upon kava consumption at the recommended human dose. This UPLC-MS/MS method therefore can be used to characterize kava products and its pharmacokinetics in animals and in humans.

BACKGROUND:There is no available training programme with standard elements for health workers treating clubfoot in Africa. Standardised training with continued mentorship has the potential to improve management of clubfoot. We aimed to evaluate the feasibility of such a training programme among clubfoot providers in Africa, and assess implications for training effectiveness and scale up. METHOD:We used participatory research with trainers from 18 countries in Africa over two years to devise, pilot and refine a 2-day basic and a 2-day advanced clubfoot treatment course. (The Africa Clubfoot Training or 'ACT' Course.) The pilots involved training 113 participants. Mixed methods (both qualitative and quantitative) were used for evaluation. We describe and synthesise the results using the eight elements proposed by Bowen et al (2010) to assess feasibility. All participants completed feedback questionnaires, and interviews were conducted with a subset of participants. We undertook a narrative description of themes raised in the participant questionnaires and interviews. Descriptive statistics were used to compare pre- and post-course scores for confidence and knowledge. RESULTS:113 participants completed pre and post-course measures (response rate = 100%). Mean participant confidence increased from 64% (95%CI: 59-69%) to 88% (95%CI: 86-91%) post course. Mean participant knowledge increased from 55% (95%CI: 51-60%) to 78% (95%CI: 76-81%) post course. No difference was found in mean for either subscale of cadre or sex. The qualitative analysis generated themes under four domains: 'practical learning in groups', 'interactive learning', 'relationship with the trainer' and 'ongoing supervision and mentorship'. CONCLUSION:The Africa Clubfoot Training package to teach health care workers to manage clubfoot is likely to be feasible in Africa. Future work should evaluate its impact on short and long term treatment outcomes and a process evaluation of implementation is required.

Background and purposeTechniques to stratify subgroups of patients with asymptomatic carotid artery disease are urgently needed to guide decisions on optimal treatment. Reliance on estimates of % luminal stenosis has not been effective, perhaps because that approach entirely disregards potentially important information on the pathological process in the wall of the artery.MethodsSince plaque lipid is a key determinant of plaque behaviour we used a newly validated, high-sensitivity T2-mapping MR technique for a systematic survey of the quantity and distribution of plaque lipid in patients undergoing endarterectomy. Lipid percentage was quantified in 50 carotid endarterectomy patients. Lipid distribution was tested, using two imaging indices (contribution of the largest lipid deposit towards total lipid (LLD %) and a newly-developed LAI 'lipid aggregation index').ResultsThe bifurcation contained maximal lipid volume. Lipid percentage was higher in symptomatic vs. asymptomatic patients with degree of stenosis (DS ≥ 50%) and in the total cohort (P = 0.013 and P = 0.005, respectively). Both LLD % and LAI was higher in symptomatic patients (P = 0.028 and P = 0.018, respectively), suggesting that for a given plaque lipid volume, coalesced deposits were more likely to be associated with symptomatic events. There was no correlation between plaque volume or lipid content and degree of luminal stenosis measured on ultrasound duplex (r = -0.09, P = 0.53 and r = -0.05, P = 0.75), respectively. However, there was a strong correlation in lipid between left and right carotid arteries (r = 0.5, P ConclusionsPlaque lipid content and distribution is associated with symptomatic status of the carotid plaque. Importantly, plaque lipid content was not related to the degree of luminal stenosis assessed by ultrasound. Determination of plaque lipid content may prove useful for stratification of asymptomatic patients, including selection of optimal invasive treatments.

[This corrects the article DOI: 10.1371/journal.pone.0170366.].

A growing body of literature points to the role of vested interests as a barrier to the implementation of effective public health policies. Corporate political activity by the alcohol industry is commonly used to influence policy and regulation. It is important for policy makers to be able to critique alcohol industry claims opposed to improved alcohol marketing regulation. The Australian National Preventive Health Agency reviewed alcohol marketing regulations in 2012 and stakeholders were invited to comment on them. In this study we used thematic analysis to examine submissions from the Australian alcohol industry, based on a system previously developed in relation to tobacco industry corporate political activity. The results show that submissions were a direct lobbying tactic, making claims to government that were contrary to the evidence-base. Five main frames were identified, in which the alcohol industry claimed that increased regulation: (1) is unnecessary; (2) is not backed up by sufficient evidence; (3) will lead to unintended negative consequences; and (4) faces legal barriers to implementation; underpinned by the view (5) that the industry consists of socially responsible companies working toward reducing harmful drinking. In contrast with tobacco industry submissions on public policy, which often focused on legal and economic barriers, the Australian alcohol industry placed a heavier emphasis on notions of regulatory redundancy and insufficient evidence. This may reflect differences in where these industries sit on the 'regulatory pyramid', alcohol being less regulated than tobacco.

PURPOSE:To document the diurnal intraocular pressure (IOP) profile with rebound tonometry performed by primary glaucoma patients in non-clinic environment. PATIENTS AND METHODS:Fifty-three medically-treated eyes of 31 primary angle closure glaucoma (PACG) and 22 primary open angle glaucoma (POAG) patients with no previous eye surgery were recruited. Diurnal IOP was measured 5 times per day at four-hourly intervals from 08:00 to 24:00 for 1 week in patients' study eye using rebound tonometry in a non-clinic environment. The diurnal IOP profiles were compared between PACG and POAG eyes. RESULTS:For both PACG and POAG eyes, mean patient-measured IOP was highest in the morning, gradually decreased over the course of a day, and was lowest by midnight (p < 0.001). The diurnal IOP fluctuation ± 1 standard deviation (SD), as documented by SD in daily IOP values, was lower in PACG group (1.6 ± 1.1 mmHg) than in POAG group (2.0 ± 1.2 mmHg; p = 0.049). The mean trough IOP ± 1 SD was higher in PACG group (12.9 ± 2.8 mmHg), compared to POAG group (11.5 ± 3.8 mmHg; p = 0.041). The mean IOP level at midnight ± 1 SD in PACG group (14.0 ± 3.2 mmHg) was higher than that in POAG group (12.1 ± 3.7 mmHg; p = 0.013). CONCLUSIONS:IOP in primary glaucoma patients was highest in the morning, and decreased over the course of a day in non-clinic environment. Treated diurnal IOP fluctuation seemed to be greater in POAG than PACG eyes.

Although radiotherapy is a key component of cancer treatment, its implementation into pre-clinical in vivo models with relatively small target volumes is frequently omitted either due to technical complexity or expected side effects hampering long-term observational studies. We here demonstrate how an affordable industrial micro-CT can be converted into a small animal IGRT device at very low costs. We also demonstrate the proof of principle for the case of partial brain irradiation of mice carrying orthotopic glioblastoma implants.A commercially available micro-CT originally designed for non-destructive material analysis was used. It consists of a CNC manipulator, a transmission X-ray tube (10-160 kV) and a flat-panel detector, which was used together with custom-made steel collimators (1-5 mm aperture size). For radiation field characterization, an ionization chamber, water-equivalent slab phantoms and radiochromic films were used. A treatment planning tool was implemented using a C++ application. For proof of principle, NOD/SCID/γc(-/-) mice were orthotopically implanted with U87MG high-grade glioma cells and irradiated using the novel setup.The overall symmetry of the radiation field at 150 kV was 1.04 ± 0.02%. The flatness was 4.99 ± 0.63% and the penumbra widths were between 0.14 mm and 0.51 mm. The full width at half maximum (FWHM) ranged from 1.97 to 9.99 mm depending on the collimator aperture size. The dose depth curve along the central axis followed a typical shape of keV photons. Dose rates measured were 10.7 mGy/s in 1 mm and 7.6 mGy/s in 5 mm depth (5 mm collimator aperture size). Treatment of mice with a single dose of 10 Gy was tolerated well and resulted in central tumor necrosis consistent with therapeutic efficacy.A conventional industrial micro-CT can be easily modified to allow effective small animal IGRT even of critical target volumes such as the brain.

There is debate as to whether physical inactivity is associated with reduced kidney function. We studied the prospective association of (changes in) physical activity with estimated glomerular filtration rate (eGFR) in adult men and women. We included 3,935 participants aged 26 to 65 years from the Doetinchem Cohort study, examined every 5 years for 15 years. Physical activity was assessed at each round using the Cambridge Physical Activity Index. Using the CKD-EPI (Chronic Kidney Disease Epidemiology Collaboration) equation, GFR was estimated from routinely measured cystatin C concentrations, examining all available samples per participant in one assay run. We determined the association between 1) physical activity and eGFR and 2) 5-year changes in physical activity (becoming inactive, staying inactive, staying active, becoming active) and eGFR, using time-lagged generalized estimating equation analyses. At baseline, 3.6% of the participants were inactive, 18.5% moderately inactive, 26.0% moderately active, and 51.9% active. The mean (± SD) eGFR was 107.9 (± 14.5) mL/min per 1.73 m2. Neither physical activity nor 5-year changes in physical activity were associated with eGFR at the subsequent round. The multivariate adjusted βeGFR was 0.57 mL/min per 1.73 m2 (95% Confidence Interval (CI) -1.70, 0.56) for inactive compared to active participants. Studying changes in physical activity between rounds, the adjusted βeGFR was -1.10 mL/min per 1.73 m2 (95% CI -4.50, 2.30) for those who stayed inactive compared with participants who became active. Physical activity was not associated with eGFR in this population-based study of adults.

The axonal cytoskeleton of neurofilament (NF) is a long-lived network of fibrous elements believed to be a stationary structure maintained by a small pool of transported cytoskeletal precursors. Accordingly, it may be predicted that NF content in axons can vary independently from the transport rate of NF. In the present report, we confirm this prediction by showing that human NFH transgenic mice and transgenic mice expressing human NFL Ser55 (Asp) develop nearly identical abnormal patterns of NF accumulation and distribution in association with opposite changes in NF slow transport rates. We also show that the rate of NF transport in wild-type mice remains constant along a length of the optic axon where NF content varies 3-fold. Moreover, knockout mice lacking NFH develop even more extreme (6-fold) proximal to distal variation in NF number, which is associated with a normal wild-type rate of NF transport. The independence of regional NF content and NF transport is consistent with previous evidence suggesting that the rate of incorporation of transported NF precursors into a metabolically stable stationary cytoskeletal network is the major determinant of axonal NF content, enabling the generation of the striking local variations in NF number seen along axons.

A major problem of allogeneic stem cell therapy is immunologically mediated graft rejection. HLA class I A, B, and Cw antigens are crucial factors, but little is known of their respective expression on stem cells and their progenies. We have recently shown that locus-specific expression (HLA-A, but not -B) is seen on some multipotent stem cells, and this raises the question how this is in other stem cells and how it changes during differentiation. In this study, we have used flow cytometry to investigate the cell surface expression of HLA-A and -B on human embryonic stem cells (hESC), human hematopoietic stem cells (hHSC), human mesenchymal stem cells (hMSC) and their fully-differentiated progenies such as lymphocytes, adipocytes and osteoblasts. hESC showed extremely low levels of HLA-A and no -B. In contrast, multipotent hMSC and hHSC generally expressed higher levels of HLA-A and clearly HLA-B though at lower levels. IFNγ induced HLA-A to very high levels on both hESC and hMSC and HLA-B on hMSC. Even on hESC, a low expression of HLA-B was achieved. Differentiation of hMSC to osteoblasts downregulated HLA-A expression (P = 0.017). Interestingly HLA class I on T lymphocytes differed between different compartments. Mature bone marrow CD4(+) and CD8(+) T cells expressed similar HLA-A and -B levels as hHSC, while in the peripheral blood they expressed significantly more HLA-B7 (P = 0.0007 and P = 0.004 for CD4(+) and CD8(+) T cells, respectively). Thus different HLA loci are differentially regulated during differentiation of stem cells.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Alternative splicing is a fundamental posttranscriptional mechanism for controlling gene expression, and splicing defects have been linked to various human disorders. The splicing factor FOX-2 is part of a main protein interaction hub in a network related to human inherited ataxias, however, its impact remains to be elucidated. Here, we focused on the reported interaction between FOX-2 and ataxin-1, the disease-causing protein in spinocerebellar ataxia type 1. In this line, we further evaluated this interaction by yeast-2-hybrid analyses and co-immunoprecipitation experiments in mammalian cells. Interestingly, we discovered that FOX-2 localization and splicing activity is affected in the presence of nuclear ataxin-1 inclusions. Moreover, we observed that FOX-2 directly interacts with ataxin-2, a protein modulating spinocerebellar ataxia type 1 pathogenesis. Finally, we provide evidence that splicing of pre-mRNA of ataxin-2 depends on FOX-2 activity, since reduction of FOX-2 levels led to increased skipping of exon 18 in ataxin-2 transcripts. Most striking, we observed that ataxin-1 overexpression has an effect on this splicing event as well. Thus, our results demonstrate that FOX-2 is involved in splicing of ataxin-2 transcripts and that this splicing event is altered by overexpression of ataxin-1.