Search

Abstract Parts are often warped and deformed when they are molded using selective laser melting (SLM) technology. Thus, it is necessary to study the addition support modes of parts molded using SLM. Consequently, we designed dendritic, E-stage and conical supports, having different structural parameters and different partitions using Magics, and then, we analyzed their performances using the finite element software Abaqus. The structural parameters of the supports were optimized and finally tested using SLM molding technology. The maximum stress concentration was found for dendritic supports, followed by E-stage supports, and then conical supports. The stress concentration and deformation level of Scheme 2 were less than those of Scheme 1. The stress intensity and deformation levels for two partitions were less than those for three partitions. For parts molded by SLM, the deformation was maximum for conical supports, followed by dendritic supports, and then E-stage supports. When gradient supports of similar volumes were added, additional partitions did not effectively improve the molding quality. When supports of similar volumes were added, adding gradient supports did not effectively improve the molding quality. The results provide a basis for the application of SLM in molding high-precision parts.

Abstract Lung adenocarcinoma is the most common primary lung cancer seen in the world, and identifying genetic markers is essential for predicting the prognosis of lung adenocarcinoma and improving treatment outcomes. It is well known that alterations in circadian rhythms are associated with a higher risk of cancer. Moreover, circadian rhythms play a regulatory role in the human body. Therefore, studying the changes in circadian rhythms in cancer patients is crucial for optimizing treatment. The gene expression data and clinical data were sourced from TCGA database, and we identified the circadian clock-related genes. We used the obtained TCGA-LUAD data set to build the model, and the other 647 lung adenocarcinoma patients’ data were collected from two GEO data sets for external verification. A risk score model for circadian clock-related genes was constructed, based on the identification of 8 genetically significant genes. Based on ROC analyses, the risk model demonstrated a high level of accuracy in predicting the overall survival times of lung adenocarcinoma patients in training folds, as well as external data sets. This study has successfully constructed a risk model for lung adenocarcinoma prognosis, utilizing circadian rhythm as its foundation. This model demonstrates a dependable capacity to forecast the outcome of the disease, which can further guide the relevant mechanism of lung adenocarcinoma and combine behavioral therapy with treatment to optimize treatment decision-making.

Abstract To explore the clinical characteristics of patients infected with SARS-CoV-2 nationwide, especially the effect factors of asymptomatic infection and disappearance of clinical symptoms. A total of 66,448 COVID-19 patients in China who have been diagnosed by nucleic acid test or rapid antigen test were surveyed online (December 24, 2022 to January 16, 2023). Our cross-sectional study used descriptive analyses and binary Logistics regression model to assess the correlation between the clinical characteristics and relative factors, including age, gender, pre-existing conditions, reinfection, vaccination and treatment. A total of 64,515 valid questionnaires were collected. Among included participants, 5969 of which were asymptomatic. The symptoms were mainly upper respiratory symptoms, including dry and itchy throat (64.16%), sore throat (59.95%), hoarseness (57.90%), nasal congestion (53.39%). In binary Logistics regression model, we found that male, no pre-existing conditions, reinfection and vaccination have positive correlations with the appearance of asymptomatic COVID-19 patients. In Cox proportional-hazards regression model, considering all clinical symptoms disappeared in 14 days as outcome, we found that ≤ 60 years old, male, no pre-existing conditions, vaccination and adopted treatment have positive correlations with rapid amelioration of clinical symptoms in COVID-19 patients. The clinical symptoms of the participants were mainly upper respiratory symptoms which were according with the infection of Omicron variant. Factors including age, gender, pre-existing conditions and reinfection could influence the clinical characteristics and prognosis of COVID-19 patients. Importantly, vaccination has positive significance for the prevention and treatment of COVID-19. Lastly, the use of Chinese medicine maybe beneficial to COVID-19 patients, however, reasonable guidance is necessary.

Abstract Differentially methylated CpG sites (dmCpGs) that distinguish prostate tumour from adjacent benign tissue could aid in the diagnosis and prognosis of prostate cancer. Previously, the identification of such dmCpGs has only been undertaken in radical prostatectomy (RP) samples and not primary diagnostic tumour samples (needle biopsy or transurethral resection of the prostate). We interrogated an Australian dataset comprising 125 tumour and 43 adjacent histologically benign diagnostic tissue samples, including 41 paired samples, using the Infinium Human Methylation450 BeadChip. Regression analyses of paired tumour and adjacent benign samples identified 2,386 significant dmCpGs (Bonferroni p

Abstract Detecting roads in automatic driving environments poses a challenge due to issues such as boundary fuzziness, occlusion, and glare from light. We believe that two factors are instrumental in addressing these challenges and enhancing detection performance: global context dependency and effective feature representation that prioritizes important feature channels. To tackle these issues, we introduce DTRoadseg, a novel duplex Transformer-based heterogeneous feature fusion network designed for road segmentation. DTRoadseg leverages a duplex encoder architecture to extract heterogeneous features from both RGB images and point-cloud depth images. Subsequently, we introduce a multi-source Heterogeneous Feature Reinforcement Block (HFRB) for fusion of the encoded features, comprising a Heterogeneous Feature Fusion Module (HFFM) and a Reinforcement Fusion Module (RFM). The HFFM leverages the self-attention mechanisms of Transformers to achieve effective fusion through token interactions, while the RFM focuses on emphasizing informative features while downplaying less important ones, thereby reinforcing feature fusion. Finally, a Transformer decoder is utilized to produce the final semantic prediction. Furthermore, we employ a boundary loss function to optimize the segmentation structure area, reduce false detection areas, and improve model accuracy. Extensive experiments are carried out on the KITTI road dataset. The results demonstrate that, compared with state-of-the-art methods, DTRoadseg exhibits superior performance, achieving an average accuracy of 97.01%, a Recall of 96.35%, and runs at a speed of 0.09 s per picture.

Abstract The RATIONALE-306 study revealed that patients with advanced or metastatic oesophageal squamous cell carcinoma (OSCC) could benefit from treatment with tislelizumab plus chemotherapy. This study aimed to evaluate the cost-effectiveness of tislelizumab plus chemotherapy for treating OSCC from the perspective of the Chinese healthcare system. Partitioned survival model estimated the cost-effectiveness of tislelizumab plus chemotherapy compared with chemotherapy alone for treating OSCC using RATIONALE-306 data. Costs and utilities were obtained from local databases and published studies. Costs, quality-adjusted life-years (QALYs), life-years, incremental cost-effectiveness ratios (ICER), incremental net health benefits (INHB), and incremental net monetary benefits (INMB) were outcomes. Price simulation were conducted at the willingness-to-pay (WTP) threshold. Sensitivity and subgroup analyses were performed to assess model robustness. Compared with chemotherapy alone, tislelizumab plus chemotherapy yielded an ICER of USD 27,896/QALY, gained an additional 0.414 QALYs and 0.751 life-years, and increased the cost by USD 11,560. Probabilistic sensitivity analysis revealed that tislelizumab plus chemotherapy was cost-effective at the WTP of USD 38,258/QALY with probability of 94.43%. When the price in China was less than USD 3.714 per mg, the price simulation results indicated that tislelizumab plus chemotherapy was cost-effective at a WTP threshold of USD 38,258. Tislelizumab plus chemotherapy yielded an INHB of 0.112 QALYs and an INMB of USD 4,279 compared with chemotherapy alone at a WTP threshold of USD 38,258. Based on the sensitivity analyses, the above results were stable. A general trend was observed for subgroups with better survival benefits related to a higher probability of cost-effectiveness. From the Chinese healthcare perspective, tislelizumab plus chemotherapy is more cost-effective than chemotherapy alone as a first-line therapy for OSCC. These findings can help clinicians make optimal clinical decisions and assist decision-makers in evaluating the cost-effectiveness of tislelizumab in clinical practice.

Abstract Observational studies have reported an association between inflammatory bowel disease (IBD), which includes Crohn’s disease (CD) and ulcerative colitis (UC), and hemorrhoids (HEM). However, the presence of a causal relationship within this observed association remains to be confirmed. Consequently, we utilized the Mendelian randomization (MR) method to assess the causal effects of IBD on hemorrhoids. We validated the association between IBD and hemorrhoids in humans based on genome-wide association studies (GWAS) data. To investigate the causal relationship between IBD and hemorrhoids, we performed a two-sample Mendelian randomization study using training and validation sets. The genetic variation data for IBD, CD, UC, and hemorrhoids were derived from published genome-wide association studies (GWAS) of individuals of European. Two-sample Mendelian randomization and Multivariable Mendelian randomization (MVMR) were employed to determine the causal relationship between IBD (CD or UC) and hemorrhoids. Genetically predicted overall IBD was positively associated with hemorrhoids risk, with ORs of 1.02 (95% CIs 1.01–1.03, P = 4.39 × 10−4) and 1.02 (95% CIs 1.01–1.03, P = 4.99 × 10−5) in the training and validation sets, respectively. Furthermore, we found that CD was positively associated with hemorrhoids risk, with ORs of 1.02 (95% CIs 1.01–1.03, P = 4.12 × 10−6) and 1.02 (95% CIs 1.01–1.02, P = 3.78 × 10−5) for CD in the training and validation sets, respectively. In addition, we found that UC in the training set was positively associated with hemorrhoids risk (ORs 1.02, 95% CIs 1.01–1.03, P = 4.65 × 10−3), while no significant causal relationship between UC and hemorrhoids was shown in the validation set (P > 0.05). However, after MVMR adjustment, UC in the training set was not associated with an increased risk of hemorrhoids. Our study showed that there is a causal relationship between CD and hemorrhoids, which may suggest that clinicians need to prevent the occurrence of hemorrhoids in CD patients.

Abstract The influence of precipitated nanophases on the mechanical properties of Fe-based amorphous nanocrystalline alloys is an urgent issue to be explored. Two amorphous nanocrystalline alloys, i.e., (Fe0.9Ni0.1)86B14 and (Fe0.7Ni0.3)86B14 containing nanophase of the body-centered cubic and face-centered cubic structures, respectively, were selected to investigate the effect of the structure and volume fraction of nanophase on their mechanical properties. The results of nanoindentation experiments and the calculation of the volume and size of the shear transition zone reveal that the two alloys show different mechanical properties. When the volume fraction of the nanophase in (Fe0.9Ni0.1)86B14 is larger than 50%, the elastic modulus is increased suddenly and the volume and size of the shear transition zone is decreased dramatically, while no dramatic change occurs in (Fe0.7Ni0.3)86B14. Moreover, it was found by using molecular dynamics simulations that the main reason for these abnormal mechanical properties is the change of cluster type in the system due to the incorporation of nanophases with different structures.

Abstract Patients with PD-L1-positive esophageal squamous-cell carcinoma (ESCC) were significantly more likely to survive when treated with serplulimab plus cisplatin plus 5-fluorouracil (serplulimab-CF). At this point, it is unknown whether this expensive therapy is cost-effective. From the Chinese healthcare system's perspective, we aimed to evaluate serplulimab-CF versus CF alone for cost-effectiveness. A partitioned survival model was constructed based on the ASTRUM-007 trial. Quality-adjusted life-years (QALYs) and incremental cost-effectiveness ratio (ICER) were calculated. A further analysis of subgroups and scenarios was conducted. The willingness to pay (WTP) threshold of $38,258/QALY or $84,866/QALY is defined as three times the per capita gross domestic product value of the general region or affluent region. Compared with CF alone, in the overall (scenario 1), patients with PD-L1 expression level of 1 ≤ CPS

Abstract Cervical cancer (CC) is a prevalent gynecological cancer worldwide that significantly impacts the quality of life and the physical and mental well-being of women. However, there have been limited studies utilizing Mendelian randomization (MR) analysis to investigate the connection between immune cells and CC. This study is to investigate the causal effects of immune traits on CC and non-neoplastic conditions of the cervix. The GWAS data for 731 immunophenotypes and six GWAS data for CC from the FinnGen database were downloaded. Subsequently, a two-sample MR analysis was conducted using the MR Egger, Weighted median, Inverse variance weighted (IVW), Simple mode, and Weighted mode methods. Our study has identified the potential causal effects of immune traits on inflammatory diseases of the cervix, other noninflammatory disorders of the cervix uteri, carcinoma in situ of cervix uteri, adenocarcinomas of cervix, squamous cell neoplasms and carcinoma of cervix, as well as malignant neoplasm of the cervix uteri, with the respective numbers being 8, 6, 11, 8, 23, and 12, respectively. A strong correlation between classic monocytes and various cervical diseases was revealed. Furthermore, we discovered that B cells expressing BAFF-R have the ability to impede the advancement of malignant CC, specifically squamous cell neoplasms and carcinoma of cervix. Our study has demonstrated a significant association between immune traits and both CC and non-neoplastic conditions of the cervix through two-sample Mendelian randomization, providing valuable insights for future clinical research.

Abstract To achieve high-efficiency combustion of heavy fuel oil (HFO), this study investigated the combustion characteristics of methanol/HFO droplets with methanol content from 10 to 30% using the suspension method under ambient temperature from 923 to 1023 K. The combustion of methanol/HFO droplets was summarized as a two-phase process consisting of six typical stages, emphasizing liquid phase. Especially, the fluctuation evaporation stage, induced by frequent and intense puffing, was identified as prominent character. Both the ignition delay and lifetime of HFO and methanol/HFO droplets decreased with increasing ambient temperatures. For the methanol/HFO droplet, the ignition delay and droplet lifetime increased with the increasing methanol content. Prominently, compared to HFO, HM10 had the most significant reduction in droplet lifetime and TINL under the same operating conditions, which indicated that the addition of 10% methanol accelerated the combustion process and reduced soot generation. Additionally, the thermos-dynamic characteristics of methanol/HFO droplets were investigated. Puffing was primarily attributed to superheating of methanol and pyrolysis of heavy components in HFO, which resulted in active and passive rupture of bubbles. Similarity and maximum deformation were employed to qualitatively distinguish between them. The obtained findings aimed to develop a promising alternative fuel to reduce emissions and preserve energy.

Abstract Serine/threonine protein kinase 19 (STK19) has been reported to phosphorylate and activate oncogenic NRAS to promote melanomagenesis. However, concerns have been raised about whether STK19 is a kinase. STK19 has also been identified as a putative factor involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway. In this study, we determined the 1.32 Å crystal structure of human STK19. The structure reveals that STK19 is a winged helix (WH) protein consisting of three tandem WH domains. STK19 binds more strongly to double-stranded DNA and RNA (dsDNA/dsRNA) than to ssDNA. A positively charged patch centered on helix WH3-H1 contributes to dsDNA binding, which is unusual because the WH domain typically uses helix H3 as the recognition helix. Importantly, mutations of the conserved residues in the basic patch, K186N, R200W, and R215W, are found in cancer patients, and these mutations compromise STK19 DNA binding. Other mutations have been predicted to produce a similar effect, including two mutations that disrupt the nuclear localization signal (NLS) motif. These mutations may indirectly impact the DNA binding capacity of STK19 by interfering with its nuclear localization.

Abstract To assess the health utility value (HUV) of Rheumatoid Arthritis (RA) patients and its influencing factors in China. A cross-sectional survey was conducted in 8 tertiary hospitals across four capital-cities. The demographic characteristics, patient-reported outcomes including the HUV got by EQ-5D-5L, clinical characteristics, and clinician-reported outcomes of 171 RA patients were collected both from themselves and their physicians. Both the univariate and multivariate analyses were used to assess the potential factors of EQ-5D-5L HUV of the patients. The mean age of the patients was 50.7 years, with female being 64.9% (n = 111). The mean HUV and EQ visual analogue scale score of all patients were 0.586 and 47.3, respectively. The univariate analysis showed that the patients who were female, older, living in rural areas, with lower education level, advanced disease stage, higher the patient's assessment of arthritis pain visual analogue scale (PtAAP-VAS), the patient's global assessment of disease activity visual analogue scale (PtGADA-VAS), and the Physician’s global assessment of disease activity visual analogue scale (PhGADA-VAS) scores had significantly lower EQ-5D-5L HUVs. The multivariate analysis further suggested that older age, female, higher body mass index and higher PtGADA-VAS score were statistically significantly related to lower HUVs. The study provided the HUVs for RA patients with different characteristics and outcomes, which could be used in the economic evaluation of interventions for the RA patients. The identified factors could also assist the health care managing and improving the health-related quality of life on RA patients.

Abstract Nowadays, what captures consumers' primary attention is how to purchase electric vehicles with long range and desirable price. Lightweight construction stands as one of the most effective approaches for prolonging range and lowering costs. As a consequence, it is particularly imperative to undertake lightweight design optimization for the battery bracket of new energy vehicles by applying 3D printing technology. To actualize this goal, Rhino software was initially employed for 3D modeling to design the battery bracket system for a pure electric vehicle in China. Subsequently, topology optimization design of the battery bracket was carried out by adopting Altair Inspire software. Last but not least, manufacturing and assembly inspection were completed using a 3D printer. The results show that the maximum displacement of the battery lower tray bracket after topology optimization is 3.20 mm, which is slightly higher than before, but still relatively small. The maximum Mises equivalent stress rose to 240.7 MPa post-optimization, but brought about a uniform stress distribution at the bottom of the bracket. In comparison, the minimum factor of safety met design requirements at 1. The mass was lessened to 0.348 kg, representing a 49.2% decrease in comparison with pre-optimization levels. The 3D-printed bracket was fabricated by employing a 3D printer, thereby achieving the aforementioned mass abatement. The battery pack parts exhibited a bright surface with low roughness and no discernible warping or deformation defects. As revealed by the assembly results, the components of the battery pack bracket are tightly coordinated with each other, with no evident assembly conflicts, revealing that the dimensional accuracy and fit of the completed parts meet production requirements. These findings lay solid groundwork for the mass production of high-performance battery pack brackets.

Abstract There are hundreds of genes typically overexpressed in breast cancer cells and it's often assumed that their overexpression contributes to cancer progression. However, the precise proportion of these overexpressed genes contributing to tumorigenicity remains unclear. To address this gap, we undertook a comprehensive screening of a diverse set of seventy-two genes overexpressed in breast cancer. This systematic screening evaluated their potential for inducing malignant transformation and, concurrently, assessed their impact on breast cancer cell proliferation and viability. Select genes including ALDH3B1, CEACAM5, IL8, PYGO2, and WWTR1, exhibited pronounced activity in promoting tumor formation and establishing gene dependencies critical for tumorigenicity. Subsequent investigations revealed that CEACAM5 overexpression triggered the activation of signaling pathways involving β-catenin, Cdk4, and mTOR. Additionally, it conferred a growth advantage independent of exogenous insulin in defined medium and facilitated spheroid expansion by inducing multiple layers of epithelial cells while preserving a hollow lumen. Furthermore, the silencing of CEACAM5 expression synergized with tamoxifen-induced growth inhibition in breast cancer cells. These findings underscore the potential of screening overexpressed genes for both oncogenic drivers and tumor dependencies to expand the repertoire of therapeutic targets for breast cancer treatment.

Abstract Traditional 2D imaging technologies are limited by the need for a large field of view and their sensitivity to small target motion. Inspired by the characteristics of insect compound eye structure, we propose an infrared bionic compound eye camera based on a small lens array. The camera is composed of 61 small lens arrays mounted on a curved spherical shell and a relay optical system. The imaging device is a high-performance cooled mid-wave infrared detector. This is an innovative design for an infrared biomimetic compound eye camera system that provides a wide field of view and all-day detection capability. Aimed to meet the specified requirements. The optical system achieves a 100% cold-membrane match between the infrared optical system and the cooled detector, and the relay optical system optimizes the large-field aberration by introducing a higher-order aspheric surface and modifying the geometric surface of the lenses. Our entire system enables an observation field angle of $$108^\circ \times 108^\circ$$ 108 ∘ × 108 ∘ . The experiments showed that the image quality of the system is high, each ommatidium was effective within the imaging range of the compound eye camera, resulting in an improved signal-to-noise ratio in various scenes.

Abstract Absent in melanoma 2 (AIM2) is implicated in neuroinflammation. Here, we explored the prognostic significance of serum AIM2 in human aneurysmal subarachnoid hemorrhage (aSAH). We conducted a consecutive enrollment of 127 patients, 56 of whom agreed with blood-drawings not only at admission but also at days 1, 2, 3, 5, 7 and 10 days after aSAH. Serum AIM2 levels of patients and 56 healthy controls were measured. Disease severity was assessed using the modified Fisher scale (mFisher) and World Federation of Neurological Surgeons Scale (WFNS). Neurological outcome at poststroke 90 days was evaluated via the modified Rankin Scale (mRS). Univariate analysis and multivariate analysis were sequentially done to ascertain relationship between serum AIM2 levels, severity, delayed cerebral ischemia (DCI) and 90-day poor prognosis (mRS scores of 3–6). Patients, in comparison to controls, had a significant elevation of serum AIM2 levels at admission and at days 1, 2, 3, 5, 7 and 10 days after aSAH, with the highest levels at days 1, 2, 3 and 5. AIM2 levels were independently correlated with WFNS scores and mFisher scores. Significantly higher serum AIM2 levels were detected in patients with a poor prognosis than in those with a good prognosis, as well as in patients with DCI than in those without DCI. Moreover, serum AIM2 levels independently predicted a poor prognosis and DCI, and were linearly correlated with their risks. Using subgroup analysis, there were no significant interactions between serum AIM2 levels and age, gender, hypertension and so on. There were substantially high predictive abilities of serum AIM2 for poor prognosis and DCI under the receiver operating characteristic curve. The combination models of DCI and poor prognosis, in which serum AIM2, WFNS scores and mFisher scores were incorporated, showed higher discriminatory efficiencies than anyone of the preceding three variables. Moreover, the models are delineated using the nomogram, and performed well under the calibration curve and decision curve. Serum AIM2 levels, with a substantial enhancement during early phase after aSAH, are closely related to bleeding severity, poor 90-day prognosis and DCI of patients, substantializing serum AIM2 as a potential prognostic biomarker of aSAH.

Abstract Depression is a serious psychiatric illness that causes great inconvenience to the lives of elderly individuals. However, the diagnosis of depression is somewhat subjective. Nontargeted gas chromatography (GC)/liquid chromatography (LC)–mass spectrometry (MS) was used to study the plasma metabolic profile and identify objective markers for depression and metabolic pathway variation. We recruited 379 Chinese community-dwelling individuals aged ≥ 65. Plasma samples were collected and detected by GC/LC‒MS. Orthogonal partial least squares discriminant analysis and a heatmap were utilized to distinguish the metabolites. Receiver operating characteristic curves were constructed to evaluate the diagnostic value of these differential metabolites. Additionally, metabolic pathway enrichment was performed to reveal metabolic pathway variation. According to our standard, 49 people were included in the depression cohort (DC), and 49 people age- and sex-matched individuals were included in the non-depression cohort (NDC). 64 metabolites identified via GC‒MS and 73 metabolites identified via LC‒MS had significant contributions to the differentiation between the DC and NDC, with VIP values > 1 and p values

Abstract Lysine crotonylation (Kcr) is a recently discovered histone acylation modification that is closely associated with gene expression, cell proliferation, and the maintenance of stem cell pluripotency and indicates the transcriptional activity of genes and the regulation of various biological processes. During cell culture, the introduction of exogenous croconic acid disodium salt (Nacr) has been shown to modulate intracellular Kcr levels. Although research on Kcr has increased, its role in cell growth and proliferation and its potential regulatory mechanisms remain unclear compared to those of histone methylation and acetylation. Our investigation demonstrated that the addition of 5 mM Nacr to cultured bovine fibroblasts increased the expression of genes associated with Kcr modification, ultimately promoting cell growth and stimulating cell proliferation. Somatic cell nuclear transfer of donor cells cultured in 5 mM Nacr resulted in 38.1% blastocyst development, which was significantly greater than that in the control group (25.2%). This research is important for elucidating the crotonylation modification mechanism in fibroblast proliferation to promote the efficacy of somatic cell nuclear transfer.

Abstract In this paper, a double-layer patterned graphene-based frequency-selective absorber (DGFSA) is proposed as a means of reducing an antenna’s radar cross-section (RCS) while simultaneously increasing its gain. The antenna consists of a patch antenna with Multi-Graphene Frequency Selective Absorber (MGFSA) mounted on top. The DGFSA consists of double-layer patterned graphene and a band-pass frequency selective surface (FSS). Two patterned graphene lossy layers with different square resistances are used, which broaden the electromagnetic (EM) wave absorption bandwidth of the DGFSA, thus greatly reducing the out-band monostatic RCSs of the patch antenna. Meanwhile, due to the quasi-Fabry-Perot (F-P) effect, the gain of the proposed antenna is enhanced by 2.4 dB. Additionally, the low-RCS antenna reduces the monostatic RCS from 1.32 to 17 GHz under y-polarization and from 1.4 to 16.8 GHz under x-polarization, respectively. Furthermore, a decrease in the bistatic RCS is accomplished. Results from simulations and measurements match up nicely, which means the antenna we proposed has a good application on the stealth platform.

Abstract Coix lacryma-jobi L. is one of the most economically and medicinally important corns. This study constructed a high-density genetic linkage map of C. lacryma-jobi based on a cross between the parents 'Qianyi No. 2' × 'Wenyi No. 2' and their F2 progeny through high-throughput sequencing and the construction of a specific-locus amplified fragment (SLAF) library. After pre-processing, 325.49 GB of raw data containing 1628 M reads were obtained. A total of 22,944 high-quality SLAFs were identified, among which 3952 SLAFs and 3646 polymorphic markers met the requirements for the construction of a genetic linkage map. The integrated map contained 3605 high-quality SLAFs, which were grouped into ten genetic linkage groups. The total length of the map was 1620.39 cM, with an average distance of 0.45 cM and an average of 360.5 markers per linkage group. This report presents the first high-density genetic map of C. lacryma-jobi. This map was constructed using an F2 population and SLAF-seq approach, which allows the development of a large number of polymorphic markers in a short period. These results provide a platform for precise gene/quantitative trait locus (QTL) mapping, map-based gene separation, and molecular breeding in C. lacryma-jobi. They also help identify a target gene for tracking, splitting quantitative traits, and estimating the phenotypic effects of each QTL for QTL mapping. They are of great significance for improving the efficiency of discovering and utilizing excellent gene resources of C. lacryma-jobi.

Abstract Taking thin gauge strip as an example, the deformation process of metal strip in bending roll straightening was studied. Based on the theory of discrete, curvature integral and elastic–plastic mechanics, the strip travel trajectory of the bending roll straightening process is analyzed, and the numerical analytical calculation method of the continuous straightening process of the strip bending roll is established. The results are verified by establishing MARC finite element simulation and designing straightening experiment. The effects of yield strength, plastic rate and bending amount on residual stress after straightening were studied. In the straightening process, with the increase of the amount of bending roll, the residual strain converges to the region Γ, and with the increase of the yield strength, the region Γ decreases. With the increase of the yield strength, the amount of bending roll and the plastic rate, the wave height increases. The results of the calculation of residual stress, finite element simulation and experiment are close and the trend is consistent. The results show that the logic of the calculation method is reasonable, and the prediction error is within the scope of engineering application, which is helpful to the realization of process intelligence in the process of bending roller straightening.

Abstract Lower-grade gliomas (LGGs) exhibit highly variable clinical behaviors, while classic histology characteristics cannot accurately reflect the authentic biological behaviors, clinical outcomes, and prognosis of LGGs. In this study, we carried out analyses of whole exome sequencing, RNA sequencing and DNA methylation in primary vs. recurrent LGG samples, and also combined the multi-omics data to construct a prognostic prediction model. TCGA-LGG dataset was searched for LGG samples. 523 samples were used for whole exome sequencing analysis, 532 for transcriptional analysis, and 529 for DNA methylation analysis. LASSO regression was used to screen genes with significant association with LGG survival from the frequently mutated genes, differentially expressed genes, and differentially methylated genes, whereby a prediction model for prognosis of LGG was further constructed and validated. The most frequently mutated diver genes in LGGs were IDH1 (77%), TP53 (48%), ATRX (37%), etc. Top significantly up-regulated genes were C6orf15, DAO, MEOX2, etc., and top significantly down-regulated genes were DMBX1, GPR50, HMX2, etc. 2077 genes were more and 299 were less methylated in recurrent vs. primary LGG samples. Thirty-nine genes from the above analysis were included to establish a prediction model of survival, which showed that the high-score group had a very significantly shorter survival than the low-score group in both training and testing sets. ROC analysis showed that AUC was 0.817 for the training set and 0.819 for the testing set. This study will be beneficial to accurately predict the survival of LGGs to identify patients with poor prognosis to take specific treatment as early, which will help improve the treatment outcomes and prognosis of LGG.

Abstract Frontotemporal dementia (FTD) is a debilitating neurodegenerative disorder with currently no disease-modifying treatment options available. Mutations in GRN are one of the most common genetic causes of FTD, near ubiquitously resulting in progranulin (PGRN) haploinsufficiency. Small molecules that can restore PGRN protein to healthy levels in individuals bearing a heterozygous GRN mutation may thus have therapeutic value. Here, we show that epigenetic modulation through bromodomain and extra-terminal domain (BET) inhibitors (BETi) potently enhance PGRN protein levels, both intracellularly and secreted forms, in human central nervous system (CNS)-relevant cell types, including in microglia-like cells. In terms of potential for disease modification, we show BETi treatment effectively restores PGRN levels in neural cells with a GRN mutation known to cause PGRN haploinsufficiency and FTD. We demonstrate that BETi can rapidly and durably enhance PGRN in neural progenitor cells (NPCs) in a manner dependent upon BET protein expression, suggesting a gain-of-function mechanism. We further describe a CNS-optimized BETi chemotype that potently engages endogenous BRD4 and enhances PGRN expression in neuronal cells. Our results reveal a new epigenetic target for treating PGRN-deficient forms of FTD and provide mechanistic insight to aid in translating this discovery into therapeutics.

Abstract Multidimensional health function impairments are common in older patients with chronic kidney disease (CKD). The purpose of this study was to explore whether the risk or severity of geriatric syndrome increased with a decline in renal function. This survey was conducted for CKD patients aged ≥ 60 years and hospitalized at West China Hospital of Sichuan University (Center of Gerontology and Geriatrics, Nephrology, and Endocrinology) and Chengdu Kangfu Kidney Disease Hospital from September 01, 2013 to June 30, 2014. Patients underwent multidimensional individualized assessments by trained doctors. Logistic regression analysis found that the risk of assisted walking (P = 0.001) and urinary incontinence (P = 0.039) increased with a decline in renal function. Regression analysis revealed that the scores of activities of daily living (P = 0.024), nutritional status (P = 0.000), total social support (P = 0.014), and objective support (P = 0.000) decreased with a decline in renal function.

Abstract The emergence of plasmid-mediated tigecycline resistance gene tet(X4) among clinically relevant bacteria has promoted significant concerns, as tigecycline is considered a last-resort drug against serious infections caused by multidrug-resistant bacteria. We herein focused on the isolation and molecular characterization of tet(X4)-positive Klebsiella pneumoniae (K. pneumoniae) and Escherichia coli (E. coli) in wild bird populations with anthropogenic interaction in Faisalabad, Pakistan. A total of 150 birds including black kites (Milvus migrans) and house crows (Corvus splendens) were screened for the presence of tigecycline resistance K. pneumoniae and E. coli. We found two K. pneumoniae and one E. coli isolate carrying tet(X4) originating from black kites. A combination of short- and long-read sequencing strategies showed that tet(X4) was located on a broad host range IncFII plasmid family in K. pneumoniae isolates whereas on an IncFII-IncFIB hybrid plasmid in E. coli. We also found an integrative and conjugative element ICEKp2 in K. pneumoniae isolate KP8336. We demonstrate the first description of tet(X4) gene in the WHO critical-priority pathogen K. pneumoniae among wild birds. The convergence of tet(X4) and virulence associated ICEKp2 in a wild bird with known anthropogenic contact should be further investigated to evaluate the potential epidemiological implications. The potential risk of global transmission of tet(X4)-positive K. pneumoniae and E. coli warrant comprehensive evaluation and emphasizes the need for effective mitigation strategies to reduce anthropogenic-driven dissemination of AMR in the environment.

Abstract CSF1R is a receptor tyrosine kinase responsible for the growth/survival/polarization of macrophages and overexpressed in some AML patients. We hypothesized that a novel multi-kinase inhibitor (TKi), narazaciclib (HX301/ON123300), with high potency against CSF1R (IC50 ~ 0.285 nM), would have anti-AML effects. We tested this by confirming HX301’s high potency against CSF1R (IC50 ~ 0.285 nM), as well as other kinases, e.g. FLT3 (IC50 of ~ 19.77 nM) and CDK6 (0.53 nM). An in vitro proliferation assay showed that narazaciclib has a high growth inhibitory effect in cell cultures where CSF1R or mutant FLT3-ITD variants that may be proliferation drivers, including primary macrophages (IC50 of 72.5 nM) and a subset of AML lines (IC50

Abstract The load sharing performance of encased differential planetary system has a great impact on the operating performance and service life of the transmission system of the coaxial high speed helicopter. In order to improve the load-sharing performance of the gear pair, the influence of different floating spline structural parameters on the load sharing characteristics of the system was studied. Considering the manufacturing error, installation error, time varying meshing stiffness and other factors, the Lagrange equation is used to construct the dynamic model of encased differential planetary gear train with floating spline structure. The effects of input torque, spline clearance, spline shaft stiffness and spline friction coefficient on the load sharing performance of gear pairs were analyzed. The results show that the differential stage system has a better load sharing performance than the encased stage system. The increase of input torque helps to improve the load sharing performance of the system, and the improvement of the encased stage system is more obvious. The floating spline of sun gear of the encased stage has a greater impact on the load sharing performance of the system. Furthermore, increasing the floating spline clearance, reducing spline shaft stiffness or increasing the friction coefficient of the spline can improve the load sharing performance of the system overall.

Abstract To study the aerodynamic performance and wind-induced response of carbon fiber-reinforced polymer (CFRP) cables, CFRP cable was designed by replacing a steel cable in a tied arch bridge based on stiffness, strength and area equivalent criteria, respectively. The aerodynamic performance and wind-induced response of CFRP cable and steel cable were studied and compared by computational fluid dynamics (CFD) model. Based on the computational results, optimal cable replacement criterion was proposed for CFRP cable to replace steel cable. In addition, surface modification was conducted by engrooving vertical symmetric (VS), vertical asymmetric (VA) and helical symmetric (HS) V-shaped grooves to improve the aerodynamic performance and wind-induced response of CFRP cable. Results showed that CFRP cables exhibited inferior aerodynamic performance and wind-induced response in most cases. However, CFRP cable based on stiffness equivalent criterion exhibited better aerodynamic performance and wind-induced vibration properties compared to the other two cable replacement criteria, thus is regarded as the optimal substitute for steel cable. In addition, HS grooves generated symmetric disturbances and caused approximately equivalent boundary layer separation delays uniformly and continuously along the cable length, thus exhibiting better effect in decreasing the reverse flow region, the maximum negative flow velocity, the vortex shedding frequency and the wind-induced vibration amplitude of CFRP cable. Hence, the stiffness equivalent criterion combined with surface modification with HS V-shaped grooves was proposed to replace steel cable with CFRP cable. This study can provide insights into the aerodynamic performance and wind-induced response of CFRP cable and instructions for cable replacement practice.

Abstract The spatial response mechanism of hydrology and water quality of large river-connected lakes is very complicated. In this study, we developed a spatial response analysis method that couples wavelet correlation analysis (WTC) with self-organizing maps (SOM), revealing the spatial response and variation of water level and water quality in Poyang Lake, China's largest river-connected lake, over the past decade. The results show that: (1) there was significant spatial heterogeneity in water level and quality during the dry seasons (2010–2018) compared to other hydrological stages. (2) We identified a more pronounced difference in response of water level and quality between northern and southern parts of Poyang Lake. As the distance increases from the northern lake outlet, the impact of rising water levels on water quality deterioration intensified during the dry seasons. (3) The complex spatial heterogeneity of water level and quality response in the dry seasons is primarily influenced by water level fluctuations from the northern region and the cumulative pollutant entering the lake from the south, which particularly leads to the reversal of the response in the central area of Poyang Lake. The results of this study can contribute to scientific decision-making regarding water environment zoning management in large river-connected lakes amidst complex environment conditions.

Abstract There are important ways to solve the ecological risk problems of regional water resources and soil resources, and to promote the benign development of soil and water resources, involving scientific evaluation of the ecological risk of soil and water resources in Hefei metropolitan area, clarifying the intrinsic evolution law of ecological risk and identifying the characteristics of spatial and temporal variations. Based on the conceptual model of “ST-QS-RR”, the evaluation indicator system is constructed, the CRITIC method is used to assign weights, and the TOPSIS method, kernel density method, markov chain and resistance model are used to measure and analyse the spatial and temporal characteristics of ecological risk of soil and water resources, and to explore the main factors that cause ecological risk of soil and water resources. The results of the study show that: (1) Hefei metropolitan area and its cities show a steady decline and the characteristics of “high in the north and low in the south, high in the west and low in the east”. (2) Most of the subsystems in the Hefei metropolitan area and the cities show a decreasing trend, with its resistance factors mainly concentrated in the QS system. (3) There is club convergence in Hefei metropolitan area. When the type of adjacent domain is higher, the change of risk type is more sensitive.

Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P

Abstract Urinary incontinence is a common disease among middle-aged and elderly women, which not only affects the physical and mental health of patients, but also brings a great medical burden to society. Obesity is a known risk factor for urinary incontinence and is the most common secondary cause of hyperlipidemia. Most obese patients also suffer from hyperlipidemia in the clinic. However, few studies have explored the role of hyperlipidemia in women with urinary incontinence. Using data from the 2005–2018 National Health and Nutrition Examination Survey (NHANES), we aimed to evaluated the independent associations of high body mass index and hyperlipidemia with urinary incontinence in Americans by conducting a weighted multivariate logistic regression model. Additive interactions were also assessed using the relative excess risk due to interaction (RERI), attributed proportion of interaction (AP) and synergy index (S). This study demonstrated that hyperlipidemia was associated with a higher risk of stress urinary incontinence among women with obesity (OR = 1.52, 95% CI = 1.03–2.25), and there was a significant synergistic effect of hyperlipidemia and obesity on stress urinary incontinence(adjusted RERI: 3.75, 95% CI 0.30–7.20; adjusted AP: 0.67, 95% CI 0.54–0.80; adjusted S: 5.49, 95% CI 4.15–7.27). Moreover, fasting serum triglyceride lipids were the most relevant blood lipid indicator for the risk of stress urinary incontinence, especially among obese women younger than 50 years old, which contributes to the development of more refined lipid control protocols for patients with urinary incontinence in different age groups.

Abstract This paper presents a solution that prioritises high privacy protection and improves communication throughput for predicting the risk of sexually transmissible infections/human immunodeficiency virus (STIs/HIV). The approach utilised Federated Learning (FL) to construct a model from multiple clinics and key stakeholders. FL ensured that only models were shared between clinics, minimising the risk of personal information leakage. Additionally, an algorithm was explored on the FL manager side to construct a global model that aligns with the communication status of the system. Our proposed method introduced Random Forest Federated Learning for assessing the risk of STIs/HIV, incorporating a flexible aggregation process that can be adjusted to accommodate the capacious communication system. Experimental results demonstrated the significant potential of a solution for estimating STIs/HIV risk. In comparison with recent studies, our approach yielded superior results in terms of AUC (0.97) and accuracy ( $$93\%$$ 93 % ). Despite these promising findings, a limitation of the study lies in the experiment for man’s data, due to the self-reported nature of the data and sensitive content. which may be subject to participant bias. Future research could check the performance of the proposed framework in partnership with high-risk populations (e.g., men who have sex with men) to provide a more comprehensive understanding of the proposed framework’s impact and ultimately aim to improve health outcomes/health service optimisation.

Abstract In the CheckMate 651 study, nivolumab plus ipilimumab versus EXTREME (cisplatin/carboplatin + cetuximab + fluorouracil) regimen was compared for effectiveness. It is not known whether these immunotherapy agents are cost-effective for recurrent or metastatic squamous cell carcinomas of the head and neck (R/M SCCHN). The purpose of this study was to compare the cost-effectiveness of nivolumab plus ipilimumab with EXTREME in the first-line setting from the standpoint of third-party payers in the United States. The projecting of costs and outcomes over 15 years was done using a three-state partitioned survival model discounted by 3% per year. Long-term extrapolation of CheckMate 651 was used to model progression-free survival and overall survival (OS). The incremental net health benefit (INHB), incremental net monetary benefit (INMB), quality-adjusted life years (QALYs), and incremental cost-effectiveness ratio (ICER) were calculated. The uncertainty and stability of the model were accounted for via one-way and probabilistic sensitivity analyses. As compared with nivolumab plus ipilimumab, EXTREME was associated with an increase of 0.154 life-years and 0.076 QALYs, as well as a cost increase of $572 per patient. The corresponding ICERs were $7545/QALY along with the values of INMB and INHB were $113,267 and 0.076 QALYs, respectively, at a willingness to pay (WTP) threshold of $150,000/QALY. The probability of nivolumab plus ipilimumab being cost-effective was > 99% in patients with combined positive score (CPS) ≥ 1, CPS 1–19, or CPS ≥ 20. Moreover, hazard ratio for OS and body weight were the most sensitive parameters for the model. According to sensitivity analyses, these results were generally robust. In overall populations with R/M SCCHN, the EXTREME regimen is cost-effective compared with nivolumab plus ipilimumab. Given a WTP threshold of $150,000 per QALY, the probability of the EXTREME regiment being cost-effective compared with nivolumab and ipilimumab, was 64%. Importantly, there was heterogeneity in the cost-effectiveness probabilities, based on primary sites and expression levels of PD-L1. Therefore, tailored treatment based on individual patient and clinical characteristics, remains important, and may impact the cost-effectiveness of the regimens under study.

Abstract Subjective well-being is based on the unity of internal and external needs, as well as material and non-material needs. However, existing research lacks consideration of the impact of both objective material conditions and subjective psychological cognition on the subjective well-being of migrant workers. Thus, based on data from the 2017 China General Social Survey, this paper applies ordered logit models and OLS models to investigate the impact of social cognition and socioeconomic status on the subjective well-being of migrant workers and their intergenerational differences. The results indicate that: (1) Social cognition has a significant impact, and the impact of fairness perception is more pronounced than depression perception and class change perception; (2) among socioeconomic status, personal income did not have a significant effect as education level, car ownership and house property ownership; (3) there are intergenerational differences. The emotional state of the older generation is the most critical factor influencing their subjective well-being. In contrast, the new generation is more concerned with their feelings about future expectations. The older generation is more concerned with their house property ownership, while the increase in income, education and car ownership can significantly increase the subjective well-being of the new generation. For this reason, we believe that the Chinese government should gradually change the existing urban and rural management system to create a fair and just social environment; make migrant workers receive the same protection as urban residents and improve the income distribution mechanism; pay attention to the social security of the older generation of migrant workers and the development opportunities of the new generation of migrant workers and their ability to integrate into the city to improve their subjective well-being.

Abstract The issue of high energy consumption in exhibition buildings has long been a focal point in the field of architectural design. However, current energy consumption assessments for exhibition buildings mainly focus on post-construction evaluations, lacking corresponding guidance during the initial design phase. To address this issue, this study selected 48 well-known exhibition buildings both domestically and internationally as research subjects. Utilizing scatter plot curve fitting, it was discovered that there exists a nonlinear quadratic relationship between the building area of the first floor and the courtyard area. Based on this relationship, four typical layouts were established to match the climatic characteristics of Hangzhou, a representative region in the Yangtze River Delta of China. Taking into account regional architectural features, the study specifically examined the impact of different orientations and window-to-wall ratios on energy consumption levels. The influence of these factors on energy consumption was analyzed using the DesignBuilder software. The results revealed that there exists an optimal window-to-wall ratio for exhibition buildings, with parallel, L-shaped enclosed south-facing courtyards, and U-shaped enclosed east-facing courtyards showing greater energy efficiency. This research provides guidance for designing exhibition buildings that are energy-efficient and foster a harmonious indoor–outdoor relationship.

Abstract Along with the further integration of demand management and renewable energy technology, making optimal use of energy storage devices and coordinating operation with other devices are key. The present study takes into account the current situation of power storage equipment. Based on one year of measured data, four cases are designed for a composite energy storage system (ESS). In this paper, a two-tiered optimization model is proposed and is used to optimizing the capacity of power storage devices and the yearly production of the system. Furthermore, this paper performs a comparative analysis of the performance of the four cases from the energy, environmental and economic perspectives. It is concluded that this kind of energy storage equipment can enhance the economics and environment of residential energy systems. The thermal energy storage system (TESS) has the shortest payback period (7.84 years), and the CO2 emissions are the lowest. Coupled with future price volatility and the carbon tax, the electrothermal hybrid energy storage system (HESS) has good development potential. However, the current investment cost is very high, and it will not be possible to recover this cost in 10 years. Finally, it is recommended that the cost of equipment be reduced in combination with subsidies and incentives for further promotion. The research results not only fill a gap in the study area, but also provide some suggestions for further development of industry and research on user-side energy storage.

Abstract The hemorrhagic progression of a contusion (HPC) after Traumatic brain injury (TBI) is one of the important causes of death in trauma patients. The purpose of this meta-analysis was to evaluate the predictive effect of imaging features of Computed tomography (CT) on HPC after TBI. A comprehensive systematic search was performed using PubMed, EMBASE, and WEB OF SCIENCE databases to identify all relevant literature. A total of 8 studies involving 2543 patients were included in this meta-analysis. Meta-analysis showed that subarachnoid hemorrhage (OR 3.28; 95% CI 2.57–4.20), subdural hemorrhage (OR 4.35; 95% CI 3.29–5.75), epidural hemorrhage (OR 1.47;95% CI 1.15–1.89), contrast extravasation (OR 11.81; 95% CI 4.86–28.71) had a predictive effect on the occurrence of HPC. Skull fracture (OR 1.64; 95% CI 0.84–3.19) showed no statistical significance, and midline displacement > 5 mm (OR 4.66; 95% CI 1.87–11.62) showed high heterogeneity. The results of this meta-analysis showed that some imaging features were effective predictors of HPC after TBI. Well-designed prospective studies are needed to more accurately assess the effective predictors of HPC after TBI.

Abstract Quantitative analysis of the biologically-active metabolites of vitamin D (VitD), which are crucial in regulating various physiological and pathological processes, is important for clinical investigations. Liquid chromatography-tandem mass spectrometry (LC-MS) has been widely used for this purpose but existing LC-MS methods face challenges in achieving highly sensitive and accurate quantification of low-abundance VitD metabolites while maintaining high throughput and robustness. Here we developed a novel pipeline that combines a trapping-micro-LC-(T-µLC) with narrow-window-isolation selected-reaction monitoring MS(NWI-SRM) for ultra-sensitive, robust and high-throughput quantification of VitD metabolites in serum samples after derivatization. The selective-trapping and delivery approach efficiently removes matrix components, enabling high-capacity sample loading and enhancing sensitivity, throughput, and robustness. The NWI-SRM further improves the sensitivity by providing high selectivity. The lower limits of quantification (LOQs) achieved were markedly lower than any existing LC-MS methods: 1.0 pg/mL for 1,25(OH)2D3, 5.0 pg/mL for 24,25(OH)2D3, 30 pg/mL for both 25(OH)D2 and 25(OH)D3, all within a 9-min cycle. The method is applied to quantify VitD metabolites from 218 patients with multiple sclerosis. This study revealed negative correlations(r=− 0.44 to − 0.51) between the levels of 25(OH)D2 and all the three D3 metabolites in multiple sclerosis patients.

Abstract To investigate the clinical characteristics of Guillain–Barré syndrome (GBS) in patients with primary Sjögren’s syndrome (SS). Records of patients with positive anti-SSA antibodies hospitalized in the Beijing Tiantan Hospital between December 2011 and May 2020 were retrieved. Patients who fulfilled the criteria for diagnosis of GBS and primary SS were included, and their clinical data were analyzed. Among the 785 patients with positive anti-SSA, 52 patients were identified in this study. They were 27 males and 25 females with median age of 59 years old. Besides anti-SSA antibodies, multiple autoantibodies were detected in these patients including antinuclear antibody, anti-Ro52, anti-mitochondrial M2, anti-thyroid peroxidase and anti-thyroglobulin autoantibodies. Preceding infection was reported in 42 patients. Hyporeflexia/areflexia and limbs weakness were the most common manifestation and 35 patients presented cranial nerve injuries. GBS disability score of 3, 4 and 5 was scaled in 28 (53.8%), 15 (28.8%) and 3 (5.8%) patients respectively. Forty-six patients received intravenous immunoglobulin (IVIG) monotherapy, 5 patients were treated by IVIG plus glucocorticoids, and 51 patients improved during hospitalization. The frequency of male gender among the patients with both GBS and primary SS suggests an independent onset of GBS and the co-existence of these autoimmune diseases in patients with multiple autoantibodies. Majority of patients with GBS and primary SS experience benign disease course.

Abstract The development of algorithms and the spread of digital infrastructure have contributed significantly to the productivity of the digital economy. Data has come to be known as the “oil of the digital economy”. At the same time, data has begun to participate more deeply in the production activities of the global sports industry chain, and the international discussion on how to protect the rights of sports event data has been increasing. Based on the configurational theory and fuzzy-set qualitative comparative analysis, this study discusses the factors affecting the protection of sports event data rights. The study found three configuration paths for achieving high enterprise data protection effectiveness and two for achieving low enterprise data protection effectiveness. The results of this study provide theoretical support for governments to address the issue of sports event data rights. They will also facilitate the safe use of data in sports, promote the global sports industry and humanitarian action development, and contribute to international sustainable development.

Abstract mRNA vaccines are becoming a feasible alternative for treating cancer. To develop mRNA vaccines against LUAD, potential antigens were identified and LUAD ferroptosis subtypes distinguished for selecting appropriate patients. The genome expression omnibus, cancer genome atlas (TCGA) and FerrDB were used to collect gene expression profiles, clinical information, and the genes involved in ferroptosis, respectively. cBioPortal was used to visualize and compare genetic alterations, GEPIA2 to calculate prognostic factors of the selected antigens, and TIMER to visualize the relationship between potential antigens and tumor immune cell infiltration. Consensus clustering analysis was utilized to identify ferroptosis subtypes and their prognostic value assessed by Log-rank and cox regression tests. The modules of ferroptosis-related gene screening were conducted by weight gene co-expression network analysis. The LUAD ferroptosis landscape was visualized through dimensionality reduction and graph learning. Six tumor antigens had obvious LUAD-mutations, positively correlated with different antigen-presenting cells, and might induce tumor cell ferroptosis. LUAD patients were stratified into three ferroptosis subtypes (FS1, FS2, and FS3) according to diverse molecular, cellular, and clinical characteristics. FS3 showed the highest tumor mutation burden and the most somatic mutations, deemed potential indicators of mRNA vaccine effectiveness. Moreover, different ferroptosis subtypes expressed distinct immune checkpoints and immunogenic cell death modulators. AGPS, NRAS, MTDH, PANX1, NOX4, and PPARD are potentially suitable for mRNA vaccinations against LUAD, specifically in patients with FS3 tumors. This study defines vaccination candidates and establishes a theoretical basis for LUAD mRNA vaccinations.

Abstract Data centers are usually characterized by high energy loads, which raises increasing sustainability concerns in both academic and daily usage. To mitigate the uncertainty and high volatility of distributed wind energy generation, this paper proposes a hybrid energy storage allocation strategy by means of the Empirical Mode Decomposition (EMD) technique and the two-stage robust method. First, this paper conducts the evolution analyses for the over- and under-evaluated uncertainty of wind power fluctuation under different time scales. Second, we employ the EMD technique to configure a high-frequency flywheel energy storage device, realizing the wind power transformation from large fluctuations to small fluctuations and the convergence of the wind power fluctuation curves in minute- and hour levels. Finally, based on the hour-level wind energy stable power curves, we carry out two-stage robust planning for the equipment capacity of low-frequency cold storage tanks and lithium bromide chillers. The case study on a data center microgrid in northeastern China confirms the effectiveness of our proposed strategy.

Abstract We conducted a systematic search across medical databases, including PubMed, Web of Science, EMBASE, and Cochrane Library, up to March 2023. A total of 1944 subjects or individuals from 17 studies were included in our final analysis. The correlation coefficient (r) between sKlotho and calcium was [0.14, (0.02, 0.26)], and a moderate heterogeneity was observed (I2 = 66%, P

Abstract In recent years, there has been a global trend of aging, which has resulted in significant changes to the burden of gastritis and duodenitis (GD). Using the global burden of disease (GBD) database spanning 1990 to 2019, we evaluated the temporal trends of age-standardized incidence rates (ASIR), age-standardized death rates (ASDR), and age-standardized disability-adjusted life years (AS-DALYs) for GD using estimated annual percentage changes (EAPC). Additionally, we examined the burden of GD across various strata, including social demographic index (SDI), age, and sex. Finally, the risk factors linked to the incidence and mortality of GD, utilizing Pearson correlation analysis. In 2019, there were 31 million GD patients globally, a notable increase of 12 million from 1990, while the ASIR, ASDR, and AS-DALYs for GD all showed a decrease. Correlation analysis showed a significant negative relationship between ASIR and SDI. Factors like hand hygiene and vitamin A deficiency had significant positive correlations with ASIR and ASDR in 2019. Over the past thirty years, the burden of GD has increased alongside global population aging. Future efforts should focus on exploring prevention for GD, with special attention to the elderly population in low SDI regions.

Abstract To evaluate the safety and efficacy of low-intensity focused ultrasound (LIFU) therapy in facilitating fundus descent and relieving postpartum breast pain compared with sham treatment. A multicentre, randomised, sham-controlled, blinded trial was conducted. A cohort of 176 eligible participants, who had normal prenatal check-ups and met the inclusion and exclusion criteria, were recruited from three medical centres and subsequently randomized into either the LIFU or sham group. All participants received three treatment sessions, wherein LIFU signal was applied to the uterus and breast sites using coupling gel, with the absence of ultrasound signal output in the sham group. Fundal height measurement and breast pain score were performed after each treatment. The primary outcome, uterine involution, was presented by measuring the fundal height of the uterus. The visual analogue scale (VAS) score, as a secondary outcome, was used to assess breast pain and determine the correlation between breast pain and fundal height as the outcome simultaneously. All participants were randomly assigned to either the LIFU group (n = 88) or sham group (n = 88), with seven individuals not completing the treatment. Overall, a statistically significant difference was noted in the rate and index of fundus descent after each treatment. The rate and index of fundus descent showed greater significance following the second treatment (rate: 1.5 (1.0, 2.0) cm/d; index: 0.15 (0.1, 0.18), P

Abstract The robustness and generalization of medical image segmentation models are being challenged by the differences between different disease types, different image types, and different cases.Deep learning based semantic segmentation methods have been providing state-of-the-art performance in the last few years. One deep learning technique, U-Net, has become the most popular architecture in the medical imaging segmentation. Despite outstanding overall performance in segmenting medical images, it still has the problems of limited feature expression ability and inaccurate segmentation. To this end, we propose a DTA-UNet based on Dynamic Convolution Decomposition (DCD) and Triple Attention (TA). Firstly, the model with Attention U-Net as the baseline network uses DCD to replace all the conventional convolution in the encoding-decoding process to enhance its feature extraction capability. Secondly, we combine TA with Attention Gate (AG) to be used for skip connection in order to highlight lesion regions by removing redundant information in both spatial and channel dimensions. The proposed model are tested on the two public datasets and actual clinical dataset such as the public COVID-SemiSeg dataset, the ISIC 2018 dataset, and the cooperative hospital stroke segmentation dataset. Ablation experiments on the clinical stroke segmentation dataset show the effectiveness of DCD and TA with only a 0.7628 M increase in the number of parameters compared to the baseline model. The proposed DTA-UNet is further evaluated on the three datasets of different types of images to verify its universality. Extensive experimental results show superior performance on different segmentation metrics compared to eight state-of-art methods.The GitHub URL of our code is https://github.com/shuaihou1234/DTA-UNet .