Search

The waters of the Changdao Archipelago are located at the confluence of the Yellow and Bohai seas, which have high species diversity and spatial and temporal heterogeneity. This area is an important route for migratory fish and macroinvertebrates to enter the Bohai Sea for spawning or to leave the Bohai Sea southward for overwintering. In recent decades, with increasing human activities, fishing pressure, and ocean pollution, the ecosystems of the Yellow and Bohai seas have become fragile with many fishery species evolving towards miniaturization and precociousness. Important fishery resources are unable to fulfill the minimum requirements during the fishing season, and the support function of the Yellow and Bohai seas is diminishing. Research on fishery species in the waters of the Changdao Archipelago is less focused on their composition, community structure, and fishery biological health evaluation. To understand the species composition and diversity of demersal fishery species in the waters of the Changdao Archipelago and to identify keystone species that play important regulatory roles in the biological community, we analyzed the biological diversity and identified the dominant species based on the Changdao Archipelago fishery resource survey data from March to December 2021. Keystone species were determined by food web topology and social network analysis, and the fishery biological health status was determined based on the 2021 survey data. A total of 38 species of fish (mainly warm-water, demersal, and low-value fish) and 50 species of invertebrates (mainly small crustaceans) were caught in the area. There were obvious seasonal variations in the composition of the dominant species, with invertebrates, such as Alpheus japonicus and Oratosquilla oratoria, dominating in the spring, Chaeturichthys stigmatias and O. oratoria in the summer and autumn, and only A. japonicus and C. stigmatias in the winter. The species Margalef richness index (R) was highest in the summer, and the Shannon-Wiener diversity index (H´) and Pielou evenness index (J´) were highest in the autumn, in the waters of the Changdao Archipelago. To further investigate the food web topology of the bottom fishery community in the waters of the Changdao Archipelago, and to identify keystone species, seasonal changes in the topology of the study area were analyzed. Based on field survey data, the main species (IRI > 100) were constructed. The area contained 13–23 main species (S) and 32–113 feeding relationships (L) in four seasons. The node density (Dd) ranged from 0.18–0.41, link density from 2.46–5.65, connectance (C) from 0.18–0.28, clustering coefficient (Cl) from 0.334–0.401, and weighted clustering coefficient (W-Cl) from 0.276–0.373, consistent with the interspecific feeding relationships in communities under natural conditions. There were significant seasonal variations in each topological index. Based on the topological structure index, we analyzed the robustness of keystone species at the bottom of the food web in the waters of the Changdao Archipelago. Using different removal methods, we found that these three species have differences in maintaining the robustness of the food web. To study the importance of keystone species, species were removed in ascending and descending order according to the node degree (D). Under the descending order of removal, the stability of the food web showed a downward trend, showing a "staged" change of first increasing and then decreasing. This change may be due to the reconstruction of the food web caused by the loss of some species. Even if new feeding relationships are created among other species, the number of corresponding feeding relationships decreased exponentially, while feeding relationships with ascending removal patterns showed an inverted U-shaped trend with a significantly slower rate of decline. The most important species in the food web were removed first in descending order, which had the greatest effect on the stability of the food web and the number of feeding relationships. Among them are species that play important roles in the robustness of the food web—C. stigmatias, Pennahia argentata, A. japonicus, and O. oratoria are both dominant and keystone species. The keystone species in the waters of the Changdao Archipelago are diverse and small, as most of the bottom organisms in the area are omnivores with diverse feeding relationships and include many migratory species in addition to native species, which leads to the diversity of keystone species—C. stigmatias, P. argentata, A. japonicus and O. oratoria are both dominant and keystone species. The keystone species are characterized by diversification and miniaturism. When keystone species were removed from the food web, the linkage robustness and number of feeding relationships decreased significantly, indicating that keystone species play important roles in maintaining the stability of the food web. In winter, keystone predator species change from O. oratoria and P. argentat to C. stigmatias, and A. japonicus changes from the keystone prey species to the keystone intermediate species. Niche replacement of keystone species leads to the simplification of the bottom of the food web and, to some extent, increases the vulnerability of the bottom community structure in the waters of the Changdao Archipelago. Therefore, in future studies, dynamic monitoring and protection of keystone species should be strengthened to maintain their robustness function in the food web, to maximize the protection of natural resources in the waters of the Changdao Archipelago.

Interferon-stimulated genes (ISGs) are crucially expressed in response to interferons and play pivotal roles in tumor immunity. These genes can either inhibit or promote tumor growth and infiltration by modulating immunosuppressive molecules, immune checkpoint inhibition, and immune editing. This review examines the specific mechanisms through which ISGs influence tumor immunity and their impact on oncological drugs, aiming to provide a theoretical foundation for developing more precise treatment strategies.

Objective To observe the clinical efficacy of Redo-Bentall surgery in the reoperation of aortic root lesions. Methods A retrospective analysis was performed on 46 patients who underwent Redo-Bentall surgery for aortic root lesions in our department from June 2010 to April 2022. They were 35 males and 11 females, at a mean age of 43.37±12.79 years, in 4.96±6.76 years since the last operation. General clinical data in perioperative period and during follow-up were collected and analyzed. Kaplan-Meier survival analysis was used to compare the survival rates of each etiological group. Results There were 9 cases of central end otitis, 12 cases of Behset's disease, and 25 cases of other causes. After operation, 4 cases (8.70%) experienced cardiac arrest, 4 cases (8.70%) renal failure, 2 cases (4.35%) gastrointestinal bleeding, 2 cases (4.35%) new third-degree atrioventricular block and 2 cases (4.35%) permanent pacemaker placement. In perioperative period, 3 cases (6.52%) died in hospital. During a mean follow-up of 5.03±3.27 years after discharge, 5 cases (11.63%) were lost to follow-up, 1 case died (2.33%), 1 case had lacunar infarction (2.33%), and no severe bleeding or embolism complications was observed in the rest patients. The long-term survival rate was significantly lower in the endocarditis group (62.3%) and the Behcet's disease group (70%) than the other etiological groups (80%, P < 0.05). Conclusion The application of Redo-Bentall in the reoperation of aortic root lesions is safe and effective, but the survival rate is quite lower in the patients with infective endocarditis and Behcet's disease.

[Objective] In the context of mandatory municipal solid waste (MSW) classification, traditional waste sorting practices face challenges in terms of participation rates and accuracy. In view of the increasing waste generation and resource recycling demand, the management and disposal level of MSW need to be further improved. This study aimed to thoroughly explore how digital technology paths enhance and transform waste sorting models, promoting the sustainable development of resource recycling and environmental protection. [Methods] This research conducted empirical case studies on the different application scenarios and practical cases of digital technology at various stages of domestic waste management, including generation, transfer, collection, and final disposal. It provided an in-depth analysis of different cases by integrating advanced algorithms such as deep learning and genetic algorithms. [Results] The application of digital technology at the front-stage can improve the participation rate and accuracy of MSW disposal and predict future waste production trends, with errors within 21.94%. The application in the middle-stage optimizes the inefficiencies in the traditional model of waste collection and transportation, planning the optimal routes using genetic algorithms to achieve unified objectives of economic cost, carbon emissions, and collection efficiency. The application at the end-stage helps enhance the overall efficiency of waste treatment and disposal, achieving a net benefit increase ranging from 8% to 39.7%. [Conclusion] This paper proposes a new model for waste sorting based on digital technology and centered on full-chain management. By leveraging information and automation technologies, it provides more efficient and precise solutions for waste sorting. Digital technology addresses the information gaps in traditional waste sorting methods, while the full-chain approach coordinates the front-end, mid-end, and back-end stages of waste sorting. This model overcomes the shortcomings of traditional waste sorting methods, enhances the recycling rate of typical urban waste, and achieves sustainable urban waste management.

Purposes A load feature extraction method based on a combination of event monitoring and Gaussian mixture model clustering is proposed to explore the potential of energy saving and emission reduction at the customer side, to finely analyze and manage the customers’ electricity consumption behavior, and to improve the efficiency of electricity utilization. Methods First, the active power fluctuation of each appliance during a single operation is extracted by the event monitoring algorithm based on sliding window, and the start-up time, number of times, and operation duration of the appliance can be obtained by the event monitoring algorithm. Second, to address the problem that the same appliance often has similar power but inconsistent operation status, the Gaussian mixture model clustering algorithm with the advantages of “soft classification” and flexible class clusters is adopted to finely classify the load operating status and form a load status feature library that is consistent with the actual operation of power-using equipment. Finally, with the public data set AMPds2 as the research object, the method proposed in this paper is applied to study the energy consumption habits of residential customers, and the validation analysis is carried out. Findings The results show that the proposed method can extract load features better than other models.

Objective To investigate the effects of metformin(Met) on the proliferation of pancreatic cancer cells under different glucose concentration culture conditions, and to find the potential role of miR-139-5p in the process. Methods PANC-1 cells were treated with different concentrations of metformin(0/5/10/20 mmol/L) in 25 mmol/L(high-glucose group,HG) or 5 mmol/L(normal-glucose group,NG) glucose culture, cell proliferation, apoptosis, migration and cell cycle were detected after 48 h. The expression of miR-139-5p was quantitatively detected by RT-qPCR, and the miR-139-5p mimics were transfected into PANC-1 cells to clarify the role of miR-139-5p. Results Metformin inhibited the proliferation, promoted apoptosis, and induced S phase and G2/M phase arrest of PANC-1 cells under in high glucose and normal glucose culture conditions, and its anti-proliferation and pro-apoptosis effects were more significant in the normal glucose groups. The expression of miR-139-5p was up-regulated by metformin treatment in normal but not in high glucose culture. Further studies showed that miR-139-5p mimics inhibited of PANC-1 cells proliferation without metformin pre-incubation and enhanced the anti-proliferation effect of 5 mmol/L metformin. The pro-apoptotic effect of 10 mmol/L metformin in normal glucose culture conditions. Conclusions In normal-glucose culture conditions, metformin can inhibit proliferation, induce apoptosis and cell cycle arrest of PANC-1 cells more significantly than in higher-glucose culture, which may be partly related to the up-regulation of miR-139-5p.

The purpose of this study was to explore the structural and expression characteristics of ABP gene from Impatiens uliginosa. ABP gene related to spur development of I. uliginosa was cloned by using RT-PCR method, whose homology and phylogenetic analyses of protein sequence were analyzed by using DNAMAN and MEGA softwares. In addition, the spatiotemporal expression patterns of ABP gene were investigated by qRT-PCR method. The results were as follows: (1) ABP gene of I. uliginosa was successfully cloned, whose full-length cDNA sequences was 627 bp, encoding 208 aa, and named IuABP. The protein encoded by ABP gene had the typical structure of Cupin superfamily proteins. (2) According to the result of its homology analysis, it showed that the homology of ABP gene of I. uliginosa reached 71% with those of I. glandulifera, Rose chinensis and Manihot esculenta. Based on phylogenetic analysis, it was found that IuABP and Impatiens glandulifera clustered into a branch, with the most close genetic relationship. (3) qRT-PCR analysis showed that the IuABP were expressed in both three stages and two different parts of spur development of I. uliginosa. With the development of spur, the expression level of IuABP in the blade had a tendency of declining at the beginning and rising up later, and reached the highest in the blooming stage, while the expression level decreased gradually in the spur cup. These results provide a theoretical reference for further studies on the function and the expression regulation mechanism of IuABP gene in spur development.

With the cross-integration of artificial intelligence and communications, technologies for processing multimodal data such as text, image, audio, and video are booming, the shared dimension of modal semantics is deeply excavated, and the characteristics of multimodal semantic information such as high abstraction, intelligence and simplicity are being fully utilized, which brings new ideas and means to semantic communications.First, the fundamental theories and classifications of semantic communication were introduced, and the research status of single-modal semantic communication was reviewed for text, image, audio, and video respectively.Then, the research status of multimodal semantic communication was reviewed, and multimodal data fusion technology and secure semantic communication were introduced.Finally, the challenges faced by multimodal semantic communication were summarized.

【Objective】 Arbuscular mycorrhizal fungi (AMF) is not only beneficial to plant acquisition of soil nutrients but can also improve plant tolerance to various biotic and abiotic stresses. This study aims to provide reference data for researchers interested in use of AMF to enhance plant tolerance to salinity. 【Method】 The literatures used in the analysis were collected from the Web of Science Database (WOS) and China Knowledge Network Database (CNKI), published in and before 2021. We analyzed the total publications, as well as the top 10 countries, top 10 institutions, top 10 journals and the top 10 researchers, which contributed most to the publications. We also analyzed the most highly cited articles. 【Result】 A total of 1 348 publications related to AMF improvement of plant salt tolerance were retrieved from 1 372 institutions in 94 countries from WOS, and 331 publications were retrieved from CNKI. The number of articles published nationally in China and internationally showed an increasing trend, with Chinese researchers publishing the most. The institutions focusing on using AMF to improve plant salt tolerance were mainly universities and research institutes, with Mycorrhiza contributing most to WOS journals, and Acta Botanica Boreali-occidentalia Sinica topping the list in CNKI journals. Current research focus of Chinese researchers is mainly on plant science. 【Conclusion】 The study of using AMF to improve plant salt tolerance is a hot spot, to which Chinese researchers have made significant contributions. Analysis of the published papers indicates that current research in this area is in molecular biology and mycorrhizal signal transduction. This paper serves as a reference for researchers who are interested in this area.

The effects of technological parameters of solid boroncarburizing and boron-carbon compound carburizing on the microstructure and properties of 12Cr13 martensitic stainless steel were studied.For the co-carburizing，12Cr13 steel was treated by solid borocarburizing heat treatment with different boron-carbon ratios；as for the boron-carbon compound carburizing，12Cr13 martensitic stainless steel was solid carburized first，then the boronizing treatment was carried out to get the optimal composite carburizing parameters.The microhardness，XRD phase structure，corrosion resistance under electrochemistry，friction and wear properties of 12Cr13 martensitic stainless steel samples under the optimum co-carburizing and compound carburizing parameters were tested and analyzed.Results showed that under the co-carburizing conditions of 950 ℃and 6 h，the optimum boron-carbon ratio of borocarburizing agent was 6:4；Under the condition of chemical compound carburizing for 6 h，the optimum parameters of boron-carbon compound carburizing were 950 ℃carburizing and 950 ℃boronizing.After the final heat treatment (quenching＋low temperature tempering) of borocarburizing and compound carburizing test pieces，the hardness of the surface layer could reach 1 507.3 HV0.98 N， and the hardness of the core was 420.6 HV0.98 N.The thickness of the borocarburizing and compound carburizing layers under the optimum parameters was 976 μm and 1 125 μm，respectively.The electrochemical test showed that the corrosion resistance of the material was improved after borocarburizing and boron-carbon compound carburizing，and the corrosion potential was -0.578 V for borocarburizing and -0.582 V for boron-carbon compound carburizing.The wear test showed that the borocarburizing and boron-carbon compound carburizing could significantly improve the wear resistance of 12Cr13 martensitic stainless steel.

Objective To explore the effect and mechanism of pinocembrin on the proliferation, migration and invasion of gastric cancer cell line AGS. Methods AGS cells were divided into different test groups according to concentrations of pinocembrin(50, 100, 200, 400 μmol/L), NC group, 200 μmol/L pinocembrin + anti-miR-NC group, 200 μmol/L pinocembrin + anti-miR-34a-5p group. The proliferation, apoptosis, migration, invasion ability and protein expression of AGS cells were detected by CCK-8 assay, flow cytometry, Transwell chamber assay and Western blot. The expression of miR-34a-5p was detected by real-time fluorescent quantitative PCR (RT-qPCR). Results Different concentrations of pinocembrin reduced the proliferation activity of AGS cells (P＜0.05) and the proportion of in G0/G1 phase cells was increased while the proportion of S phase cells decreased. The expressions of MMP2, MMP9, p-PI3K and p-AKT protein decreased. The cell migration and invasion were inhibited. The expression of miR-34a-5p was increased (P＜0.05), which reduced the inhibitory effect of pinocembrin on the prolifera- tion, migration and invasion of AGS cells. Conclusions Pinocembrin can inhibit the proliferation, migration and invasion of AGS cells by improving the expression of miR-34a-5p.

To solve the problem of small coverage area and discontinuous coverage of large fixed-wing aerospace emergency base stations, a design scheme for continuous coverage of UAV emergency base stations was proposed.Based on the analysis of the coverage capability of the single antenna of the airborne base station, a multi-antenna coverage scheme with inner antenna plus edge antenna was proposed.Taking the roll angle, pitch angle and other parameters of the UAV flight into consideration, the installation plan of multi-antenna mounting that guarantees continuous coverage was designed.Then the link budget was carried out according to the 3GPP propagation loss model, and the UAV flight plan was planned according to the continuous coverage area requirements.Simulation and flight test results show that the proposed scheme can achieve 50 km2 continuous signal coverage of the ground by the mobile base station on the UAV without using the intelligent control of the antenna angle of the PTZ.

Electrochemistry has the advantages of low detection limit, high sensitivity, short analysis time, and convenient operation. It is an effective method for rapid detection of heavy metal ions in environmental samples. In this paper, humic acid-based activated carbon was prepared by chemical activation of humic acid extracted from lignite. The carbon paste electrode was doped with humic acid-based activated carbon, and the stripping voltammetry characteristics of Cd(Ⅱ) on the modified electrode were studied by anodic stripping voltammetry. The research shows that the doping of humic acid-based activated carbon on carbon paste electrode improved the response of Cd(Ⅱ) on the electrode, thus improving the sensitivity, expanding the linear detection range, and reducing the detection limit. When the activated carbon was used for chemical modification of carbon paste electrode a high content of oxygen-containing functional groups and a large pore size, were beneficial to improving the response of Cd(Ⅱ) on the electrode and improving the sensitivity of the electrode. All the carbon paste electrodes doped by humic acid-based activated carbon exhibited good repeatability and long-term stability.

In order to correctly evaluate the phosphating effect on the surface of galvanized steel plate,the two most typical phosphating film evaluation methods,namely P ratio and crystal coverage rate determination method were compared and analyzed.Different methods were used to determine P ratio and crystal coverage rate of phosphating film,respectively.Results showed that when the accuracy of XRD data of phosphating film could not be determined,the method of measuring the diffraction peak area of P phase and H phase was more accurate than that of determining the P ratio.When the XRD data of phosphating film was accurate,the P ratio calculated by directly measuring the diffraction intensity of P phase and H phase was more accurate.When there were many grain shapes and complex grain distribution in SEM morphology,the crystal coverage rate of phosphating film could be measured more accurately according to Q/JL J130012-2018.When the grain distribution was relatively uniform,the crystal coverage rate of the phosphating film could be measured by Photoshop software analysis method,which was more intuitive to observe the distribution of grain interstice.

Objective To investigate the characteristics of continuous glucose monitoring (CGM) in type 1 diabetic patients with fast-glycator phenotype. Methods This was a cross-sectional retrospective study. Patients diagnosed with type 1 diabetes mellitus (T1DM) and wearing CGM for 10 d and more from the T1DM-specific Disease Clinic, the Second Xiangya Hospital of Central South University were enrolled from April 2017 to August 2023 to collect laboratory glycated hemoglobin A1c (HbA1c). Calculation of CGM parameters including time in range (TIR), mean blood glucose (MBG) and mean amplitude of glucose excursions (MAGE), are derived from the data collected by CGM devices worn by the participants. Based on the results of MBG, the estimated HbA1c was calculated, and then the hemoglobin glycation index (HGI) was computed by comparing the laboratory HbA1c with the MBG-estimated HbA1c. Patients were divided into non-fast glycator phenotype group (HGI≤0.4) and fast-glycator phenotype group (HGI>0.4). Comparison of differences between groups using two independent samples t-test or Mann-Whitney U test. Results We included 377 patients with T1DM, of whom 299 were in the non-fast glycator phenotype group and 78 in the fast-glycator phenotype group. Individuals with fast-glycator phenotype exhibited poorer glycemic control compared to those with non-fast glycator phenotype, as evidenced by higher HbA1c levels [(8.53±1.41) % vs. (6.95±0.90)%, P<0.001], lower TIR [(61.36±15.81) % vs. (67.31±18.31) %, P=0.010], and higher MAGE [(8.01±2.06) mmol/L vs. (7.37±2.38) mmol/L, P=0.015]. However, in patients with suboptimal HbA1c, CGM parameters showed inconsistent changes with HbA1c in fast glycation group, with CGM parameters demonstrating better glycemic control than those in the non-fast glycation group, characterized by higher level of TIR [(61.34±16.3)% vs. (51.99±16.3%)%, P<0.001] and lower level of MAGE [(8.10±2.09) mmol/L vs. (9.23±2.11) mmol/L, P=0.001]. Conclusion T1DM in fast-glycator phenotype group had worse glycemic control than the non-fast glycator phenotype group, and exhibited inconsistencies between CGM parameters and HbA1c. [ABSTRACT FROM AUTHOR]

Natural corrosion of concrete structure due to sulfate poses a serious threat to people's lives and property. Therefore, it is of great practical significance to study the phenomenon of sulfate corrosion on concrete. In order to explore the mechanical properties of a new type of concrete corroded by sulfate, a full immersion accelerated erosion method was used with 5% sulfate solution. Erosion tests were performed on 11 groups of polypropylene fiber reinforced concrete (PC) specimens, 11 groups of polypropylene fiber lithium slag concrete (PLiC) specimens, 8 PC columns with large eccentricity, and 8 PLiC large eccentric columns. The mechanical properties of concrete under different erosion times are obtained. Based on the fractal theory, the fractal characteristics of surface crack distribution of specimens and columns are analyzed. In addition, the relationship between the fractal dimension of surface crack and erosion time, compressive strength, and ultimate bearing capacity is discussed. Results show that the compressive strength of PC and PLiC initially increases and then decreases with increased erosion days, reaching a maximum of 120 days. The distribution of surface cracks is observed to be fractal when they are broken. With increased erosion days, fractal dimension of surface cracks initially increases, then decreases, and finally increases again. On the other hand, a decreasing trend of fractal dimension of surface cracks is observed with increased compressive strength. The ultimate bearing capacity of PC and PLiC columns with large eccentricity increases first and then decreases with erosion days. Addition of lithium slag is observed to improve the sulfate resistance of polypropylene fiber reinforced concrete columns. With broken members, fractal dimension of surface cracks presents a rising trend of shock with sulfate erosion days. Results signify that fractal characteristics of concrete surface cracks can be used as one of the indexes to determine the damage degree of members, which can provide reference for the prediction of bearing capacity and service life of concrete structures in the future.

Water is one of the most important compounds and plays an important role in biological process, chemical synthesis and material science. Thus, studies about water and related particles water radical cations are always the top research fields. In this work, water dimer radical cation (H2O)2+• was prepared using home made low energy corona discharge device at ambient condition, and its structure was further studied using collision induced dissociation (CID) experiment and isotope labelling method. The dissociation results showed that (H2O)2+• (m/z 36) will lose OH• and H2O to give ions of m/z 19 (H2OH+) and m/z 18 (H2O+•), competitively, revealing that (H2O)2+•can exist in two different structures, including ［H2OH+—•OH］ (hydrogen atom bound structure (A)) and ［H2O∴OH2］+ (oxygen oxygen atom bound structure (B)). Structure A is asymmetry and structure B is symmetry. Furthermore, isotopic labeled experiments were conducted using deuterated water (D2O) and 18O-enriched water (H218O). The dissociation of (D2O)2+•(m/z 40) gave the corresponding protonated water D2OD+ (m/z 22) and water radical cation (D2O)+• (m/z 20). Dissociation of (H2O•D2O)+•(m/z 38) produced the protonated water H2OD+ (m/z 20)/D2OH+ (m/z 21), and water radical cation H2O+• (m/z 18), HOD+• (m/z 19), D2O (m/z 20)+•. In 18O-enriched water (H218O) labelled isotopic experiments, (H2O•H218O)+•(m/z 38) also was dissociated into its corresponding protonated water H2OH+(m/z 19)/H218OH+(m/z 21) and water radical cation H2O+• (m/z 18) and H218O+•(m/z18). The CID and the isotope labelling results indicated that water dimer radical cation (D2O)2+•, (H2O•D2O)+• and (H2O•H218O)+•also exist A and B two structured forms. In conclusion, two structures of water dimer radical cation (H2O)2+•will further reveal that mass spectrometry may help to elucidate chemical mechanism related with (H2O)2+•in the biological processes and chemical reactions.

【Background】 The climate in Inner Mongolia of China is suitable for growing strawberry but the shallow root system of the crop makes it prone to soil salinity. How to alleviate soil salinity and improve the resistance of strawberry against soil salinity is hence essential to safeguarding strawberry production in both fields and greenhouses that endured secondary soil salination. 【Objective】 The objective of this paper is to study the feasibility of using arbuscular mycorrhizal fungi (AMF) inoculation to improve physical and biogeochemical conditions of the rhizosphere of strawberry to improve its resistance against salinity stress. 【Method】 We used the cultivar of ‘Charlie sweet’ as the model plant and inoculated its roots with AMF. They were then grown in soils with a salinity gradient created by adding 0 to 100 mmol/L of solution of NaCl and Na2SO4 mixed at 1:1 ratio. In each treatment, we measured the number of microbes and the activity of urease, catalase, sucrase and amylase in the rhizosphere. 【Result】 With the salt concentration increasing, the salinity index of the crop increased, while the rate of mycorrhizal infection, the number of soil microorganisms and the enzymatic activity all decreased. Compared with control without inoculation, 28 days after instigating the salt stress inoculation reduced the salt damage index of the strawberry by 10.91% to 23.93%, depending on salt concentration, 28 days after instigating the salt stress. Inoculation also increased the activity of all enzymes and the number of microorganisms at significant level (P

Objective This study aims to investigate the feasibility and safety of Da Vinci robotic-assisted thoracoscopy for resecting mediastinal tumors in pediatric patients. Methods From November 2020 to June 2023, a total of 80 pediatric patients undergoing mediastinal tumor resection at Wuhan Children's Hospital were randomly assigned into two groups, with each group consisting of 40 participants. The control group underwent conventional thoracoscopy, while the observation group underwent Da Vinci robotic-assisted thoracoscopy. This study aimed to compare perioperative indicators between the two groups and establish learning curves based on surgical duration and intraoperative blood loss. Additionally, it assessed levels of pain mediators and stress response markers before surgery and at 24 hours post-surgery, as well as postoperative complications. Inflammatory marker levels were evaluated one month after surgery, and the children's quality of life was measured using the Pediatric Quality of Life Inventory(PedsQL) Generic Core Scales before surgery and one month post-surgery. Results The surgical duration for the observation group and the control group was(1.76 ± 0.33) hours and(2.82±0.62) hours, respectively, and the intraoperative blood loss was(49.83 ± 6.39) mL and(71.55 ± 8.19) mL, respectively. Furthermore, the post-operative drainage time, drainage volume, and hospital stay for the observation group were all lower than those for the control group(P < 0.05). After surgery, the levels of BK, 5-HT, NPY, and PGE2 in the observation group were(8.06 ± 1.06) mg/L, (170.20 ± 13.21) ng/L, (201.82 ± 13.52) mg/L, and(241.82 ± 15.32) ng/L, respectively, indicating lower levels of pain mediators, stress response markers, and inflammatory factors compared to the control group(P < 0.05). he overall incidence of complications was 2.50% in the observation group as opposed to 20.00% in the control group. Moreover, there was a statistically significant improvement in quality of life after surgery within the observation group when compared to that within the control group(P < 0.05). Conclusion Da Vinci robotic-assisted thoracoscopy demonstrates enhanced feasibility and safety in pediatric mediastinal tumor resection, thereby justifying its clinical promotion. [ABSTRACT FROM AUTHOR]

Traditional performance analysis methods for high performance applications have shortcomings such as additional overhead during the analysis process and inaccurate analysis results, resulting in users spending more time and domain knowledge. To address these issues, this paper transforms the problem of program performance analysis into a multi-classification problem of unbalanced small sample datasets under high-dimensional features. By collecting 500 pieces of performance data that include seven types of metrics such as the number of process switches, memory utilization, and disk I/O load during program runtime, after data preprocessing such as PCA dimensionality reduction, a program performance problem analysis model is trained using a random forest classifier. Experimental validation shows that the model can identify five types of performance issues, including excessive memory utilization and heavy disk I/O load. To evaluate the effectiveness of the model's guidance, this paper collects performance data generated by the HotSpot3D program and the LU-Decomposition program during runtime. Based on the model's output guidance, the two validation programs are optimized at the runtime level and the compilation level. Experimental results indicate that the proposed method can effectively guide the optimization of program performance, with speedup ratios of 1.056 and 5.657 for the two programs, respectively. [ABSTRACT FROM AUTHOR]

Background Autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction is often misdiagnosed because its main symptoms are syncope and gastrointestinal motility disorder. This study summarized the clinical, electrophysiological and pathological changes of peripheral nerve biopsy of patients of autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction, which could provide reference for diagnosis, differential diagnosis and treatment. Methods and Results The clinical data of 3 patients diagnosied with autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction who were hospitalized in Department of Neurology, Peking University First Hospital from February 2016 to February 2019 were collected. All of the 3 patients were young women, presented with onset symptoms as acute orthostatic hypotension and gastrointestinal motility disorder. Two patients had dysuria and dyshidrosis, and 2 patients had pupil changes. Electrophysiology revealed decreased sensory and motor nerve conduction velocity in 2 patients. Abnormal F wave and H reflex were found in 2 patients. The conduction velocity of large myelinated fibers was normal in one patient. In the autonomic function test, 2 patients had decreased Valsalva ratio, decreased heart rate variability of deep breathing. The blood pressure changes during tilt test between lying and upright position of 2 patients in acute stage was more than 30/15 mm Hg. Two patients underwent lumbar puncture, and one patient showed albuminocytologic dissociation. Sural nerve biopsies showed moderate to marked loss of small myelinated fibers and unmyelinated fibers. Two patients in acute stage were treated with immunomodulatory therapy (glucocorticoid combined with intravenous immunoglobulin), and their symptoms improved in varying degrees. Conclusions Autoimmune autonomic neuropathy with acute autonomic nerve dysfunction has unique clinical manifestations. Early consideration of autoimmune autonomic neuropathy followed by diagnostic work⁃up and prompt immune treatment will help to improve the prognosis. DOI:10.3969/j.issn.1672⁃6731.2020.10.005

Objective To discuss the activation characteristics of the prefrontal cortex of people with mild cognitive impairment （MCI） due to brain trauma during working memory tasks. Methods The psychological experiment design software E-prime was used and N-back paradigm was adopted as working memory task. Functional near-infrared spectroscopy （fNIRS） was used to detect changes in cortical oxygenated hemoglobin concentrations of 22 channels within the prefrontal lobe of 24 people with MCI due to brain trauma （study group） and 27 healthy volunteers （control group） with matching gender and age. Behavioral data, such as the number of keystroke errors and reaction time, were recorded simultaneously. Independent samples t test and non-parametric test were used to compare the mean value of oxygenated hemoglobin concentration change, the number of key errors and the mean value of reaction time of the two groups in each task. Results （1） The differences in the number of errors and reaction time between the two groups in 1-back and 2-back tasks had statistical significance （P0.05）. During the 2-back task, the differences in oxygenated hemoglobin concentration changes of the two groups in channel 2, 3, 7, 9, 10, 11, 14, 15, 18, 19, 21 and 22 had statistical significance （P

Platinum-based catalysts have been widely used in fuel cells due to their excellent activity in oxygen reduction reactions. At the same time, using Pt in large quantities is costly. To solve the high cost of fuel cell catalysts, research into low-Pt-content and highly efficient catalysts with special structures has attracted considerable attention. However, conditions required for synthesis of these catalysts are highly restrictive and the synthetic methods are energy-intensive and harmful to the environment. In this study, Cu nanowires (NWs) were synthesized hydrothermally at 80 ℃. Growth of the Au shell on the Cu NWs, achieved through a liquid phase reduction method, was carried out in aqueous solution at low temperature. Finally, Pt layers were deposited on the surface of the Au−Cu NWs by Galvanic displacement between the uncovered copper NWs and chloroplatinic acid. Subsequently, Pt−Au−Cu ternary core-shell catalysts were constructed. The as-synthesized catalysts were characterized in depth using scanning electron microscopy (SEM), X-ray diffraction (XRD), and transmission electron microscope (TEM). The growth mechanism of the Pt−Au−Cu NWs was also explored. Results show that the phase composition of the synthetic NWs is monolithic Cu with an average diameter of about 83 nm; average diameter of the Au−Cu NWs is about 90 nm, and the small particles attached to the surface are Au. After Pt loading, the Pt−Au−Cu ternary core shell structure of the NWs is obtained with an average diameter of 120 nm. It is confirmed that the formation of the surface Au nanoparticles on the Cu NWs depends on the heterogeneous nucleation and growth mechanism, and that the growth mode conforms to the Stranski-Krastanow (S-K) mode. Pt and Cu interdiffusion exists during Pt loading, so that the surface of the NW is mostly Pt particles and the whole is a CuPt alloy phase. This study demonstrates a new strategy in synthesis of ternary core-shell NWs.

The carbon cycle of terrestrial ecosystems is an important element in the study of global and regional climate change and the impact of human activities. The Three Gorges Reservoir Area, as an important ecological environmental protection and restoration area in the Yangtze river basin, plays an extremely important role in global and regional carbon cycle under climate change. Therefore, based on the data of solar radiation, temperature, CO2 concentration and normalized vegetation index from 2000 to 2021, parameters were adjusted based on the C-FIX model, and a terrestrial ecosystem net primary productivity (NPP) estimation model were established in the Three Gorges Reservoir Area (Chongqing section). Quantitative analysis of the e spatial and temporal characteristics of vegetation NPP from 2000 to 2021 was conducted using the barycenter model and trend analysis methods. The relative roles of climate change and human activities in influencing NPP were quantitatively distinguished using correlation analysis methods combined with the Miami model. The results showed that: (1) NPP in the Three Gorges Reservoir Area showed a fluctuating upward trend from 2000 to 2021, and the regional mean annual NPP increased from 666.02gC·m-2·y-1 to 809.04gC·m-2·y-1 from 2000 to 2021, with an increase of 17.68%. (2) The spatial distribution of NPP in the Three Gorges Reservoir Area gradually decreased from northeast to southwest, with an average annual NPP value of 762.3gC·m-2·y-1, among which the area with NPP >800gC·m-2·y-1 accounted for 46% of the total area of the study area, and was mainly distributed in the area of 400-900m altitude. (3) The NPP center of gravity in the study area showed a trend of moving from southwest to northeast, indicating that the NPP increment and growth rate of vegetation in the northeast part of the study area were higher than that in the central and western part of the study area during this period. (4) The changes of vegetation NPP in the Three Gorges Reservoir Area were more sensitive to the effect of temperature, and the partial correlation coefficients between vegetation NPP and annual temperature range from -0.68 to 0.94, with the proportion of positively correlated areas being as high as 95.6%, and the partial correlation coefficients between vegetation NPP and annual precipitation range from -0.83 to 0.82, with the proportion of positively correlated areas being 75.7%, which were located in the majority of the areas along the north side of the Yangtze River, and the majority of the areas in Wulong and Fuling. (5) There was significant spatial heterogeneity in the relative roles of climate change and human activities on the changes of vegetation NPP in the Three Gorges Reservoir Area, and the areas in the state of vegetation recovery accounted for 93.63% of the total area, of which 45.24% were affected by climate change, and 46.72% of the areas in the state of vegetation recovery were affected by climate change and human activities. [ABSTRACT FROM AUTHOR]

The purpose of the study was to improve the cell wall-breaking rate of industrial Saccharomyces cerevisiae and its application value. The effects of heat, alkali and ultrasonic synergistic treatment on the cell wall-breaking rate of industrial Saccharomyces cerevisiae ScY01 strain were explored. The results showed that the wall-breaking rate of ScY01 strain with a concentration of 6 g/L was 91.78% when treated with heat (boiling water bath 12.5 min), alkali (sodium hydroxide 0.6 g) and ultrasonic crushing (ultrasonic power 450 W, radiation time 11 s, radiation interval 15 s, ultrasonic time 20 min). The amount of protein released after cell fragmentation was used for preliminary application characterization, the total protein release by synergistic treatment was 11.54 times higher than that of alkali alone, 10.26 times higher than that by boiling alone, and 4.01 times higher than that by ultrasonic alone. The study indicates that the synergistic treatment is suitable for model Saccharomyces cerevisiae strain CEN.PK2-1c, and the experimental results can provide a new method for efficient crushing of industrial Saccharomyces cerevisiae cells. [ABSTRACT FROM AUTHOR]

Objectives: This study is to investigate the effect of group music therapy on depression and anxiety in acute psychiatric in-patients. Methods: Two groups of experiments were pretest-posttest designed. The research subjects were 122 inpatients in the acute psychiatric ward of a medical center. The experimental group received 50 minutes of a group music therapy intervention every Wednesday and Friday for a total of 8 times over 4 weeks. The control group received routine care. Both groups were administered the Beck Depression Inventory (BDI-II) and Beck Anxiety Inventory (BAI) pretest and posttest. Results: For the experimental group, the music therapy intervention showed a significant reduction in both depression (p <.001) and anxiety (p <.001). Implications for practice: The results of this study provide an empirical basis for the use of group music therapy as an intervention to reduce depression and anxiety in in-patients with mental illness. It is suggested that mental health care professionals may find music therapy helpful in routine group therapy programs to reduce depression and anxiety symptoms in acute psychiatric in-patients. [ABSTRACT FROM AUTHOR]

Currently, the self-sufficiency rate of domestic vegetable oil is still low. As an important oil crop in China, rapeseed contributes to nearly 50% of the oil production of domestic oil crops, and it plays a vital role in ensuring national edible oil supply security. Since the "No. 1 central document" for 2012 first proposed the comprehensive deployment of agricultural science and technology strategy, the rapeseed industry has made great progress with scientific and technological support. The "No. 1 central document" for 2023 clearly proposes to further promote the soybean and oilseed production capacity improvement project, take coordinated steps to support the rapeseed industry, promote rice-oil rotation, and vigorously develop winter idle fields. This paper systematically figured the development status of rapeseed industry from 2012 to 2022, summarized the scientific and technological progress within this sector, and analysed the current challenges and prospects. Finally, policy suggestions were put forward to support the sustainable development of rapeseed industry in China. [ABSTRACT FROM AUTHOR]

Guizhou Province is one of the main producing areas of Camellia oleifera in China. In recent years, the area of newly planted C. oleifera forest has been expanding, which led to a larger yield potential in Guizhou Province. This paper combeded the main problems of camellia processing industry development in Guizhou Province, including a lack of scale production, basic research and deep processing technology, as sell as a lack of powerful brands and quality management system. It foucused on discussion of processing industry, and pointed out keys to healthy develop Guizhou camellia processing industry. In addition, it also put forward suggestions and countermeasures for development of camellia processing industry in Guizhou from 6 aspects: promoting the transformation and upgrading of camellia processing, extending the industrial chain of camellia processing, encouraging the diversified development of industry, cultivating large and medium-sized camellia processing enterprises, implementing brand development strategy, building scientific research platform, accelerating technological innovation and upgrading, and improving product quality standard system, in order to promote healthy and rapid development of camellia processing industry in Guizhou Province. [ABSTRACT FROM AUTHOR]

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type Ⅱ patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type Ⅱ. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type Ⅱ, and his family was diagnosed as Alexander's disease type Ⅱ pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. DOI: 10.3969/j.issn.1672-6731.2019.03.010

With large-scale wind and solar energy power units put into operation, it brings great influence on the stability and safety of the power network due to the high fluctuation and randomness features of the wind and solar resources. In order to absorb more new energy power, regional load dispatch center puts up very high requirement for the operation flexibility, load fast-following and deep peak load regulation ability. Therefore, it is very significant to adopt advanced control strategies to optimize the coordinated control system (CCS) to improve its control quality. In this work, the load prediction neural network model considering "condensate throttling" and the main steam pressure prediction model were developed by taking a 1000 MW ultra-supercritical power unit as the object investigated. Based on the established models, a classic optimization theory-improved simplex method was selected as the CCS optimization algorithm. An intelligent coordination optimization scheme with condensate throttling was designed, and the real-time optimization program was developed with MATLAB software. Detailed simulation tests were carried out in the full-scope simulator of the 1000 MW power unit. Simulation results indicate that the proposed scheme can effectively improve the coordinated control quality with faster load response, less main steam pressure fluctuation during dynamic load-changing process.

The lower extremity impairment can be caused by illness, accident, work-related injury, traffic accident and fighting, etc. The injuries of lower extremity joint, nerve, muscle and tendon may lead to lower extremity dysfunction. So far, there is no unified standard for international and domestic function evaluation of lower extremity impairment, the evaluation standards in the same field are also different, and function evaluation of lower extremity impairment has no complete research system. However, the degree of lower extremity impairment has great influence on personal damage compensation. Therefore, the function evaluation of lower extremity impairment often becomes a dispute issue in forensic medicine identification. This article summarizes the function evaluation standards, methods and status quo of lower extremity impairment, so as to provide a new insight into the research on standardization of lower extremity impairment.

Both polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs) are typical POPs in the atmosphere, which are environmentally persistent and have certain health effects. In this study, a detection method based on polyurethane foam (PUF) + glass fiber filter membrane and soxhlet extraction-gas chromatography triple quadrupole mass spectrometry (GC-MS/MS) was developed for the analysis of eight polychlorinated biphenyls (PCBs) and ten organochlorine pesticides (OCPs) compounds in the atmospheric environment. Atmospheric PCBs and OCPs were analyzed at three different time periods in winter, spring and autumn of 2021 using the Pudong New Area monitoring station and Huinan substation as two sampling stations, representing urban and rural areas, respectively. The average concentrations of PCBs and OCPs at the monitoring station in Pudong New Area were (21.73±6.93) pg/m³ and (205.68±42.74) pg/mm³, respectively, which are gener¬ally much lower than those reported in the literature for other cities in China, and are comparable to the levels in other devel¬oped cities. [ABSTRACT FROM AUTHOR]

The fifth generation (5G) mobile communication technology has the characteristics of high speed and large bandwidth,which makes the fading of radio signal in time domain and frequency domain more obviously.With the increase of differential values statistical step and the spatial sampling interval,the channel estimation method based on the differential probability can't track the deep fading area and the peak area was over-tacked.In view of the above problems,a channel estimation method based on quadratic differentials probability was proposed.Firstly,the valley point and peak point of the fading curve were found.Then,the estimated differential values of deep fading area and peak area were improved by quadratic differential probability.Finally,the estimated gains were obtained by the difference operation.Simulation results show that,this method can improve the whole tracking performance effectively and reduce the tracking error.

Objective To investigate the overall blood glucose control and self-management status of patients with type 1 diabetes (T1DM) in structured training who participated in a summer camp. Methods A cross-sectional study was conducted in patients of all ages diagnosed with type 1 diabetes mellitus (T1DM) at the National Clinical Research Center for Metabolic Diseases, Second Xiangya Hospital of Central South University from August 2012 to August 2019. The participating group included T1DM patients who voluntarily participated in an annual recreational camp activity ("summer camp"), while the non-participating group consisted of T1DM patients diagnosed at the same time at the center who did not participate in the camp. According to the propensity scoring method, gender and age were included with a 1:2 propensity score, and the caliper value was taken as 0.03. Data on blood glucose monitoring methods [glycaemic meters, flash glucose monitoring system (FGM), and/or continuous glucose monitoring (CGM)], frequency of daily self-glucose monitoring, current insulin treatment plan, and glycosylated hemoglobin (HbA1c) levels were collected for all patients. The self-management level of patients was assessed using self-report measure of self-management of type 1 diabetes for adolescents (SMOD-A), which included five subscales related to cooperation between adolescents and parents in diabetes management, daily diabetes care behavior, problem-solving skills related to diabetes management, communication with others affected by diabetes, and goals for diabetes management; and self-management scale of type 1 diabetes for chinese adults (SMOD-CA), which included four dimensions related to daily behavioral performance, disease management cooperation, coping strategies for disease-related problems, and goals for disease management. Statistical analysis was performed using t-tests, Mann-Whitney U tests or χ² tests for comparisons between groups. Results A total of 299 patients with T1DM who participated in a recreational camp were included, with an average age of 15.0 (10.0, 25.0) years and disease duration of 35.0 (17.0, 69.0) months. 44.8% (134/299) were male. Five hundred and twenty-seven patients who did not participate in recreational camp were successfully matched by a 1:2 comparative propensity score. Compared with the results of the non-participating group, the rate of HbA1c reaching the standard in the participating group [25.9% (131/505) vs. 50.5% (139/275)], use of FGM and / or CGM [15.4% (22/143) vs. 48.5% (94/194)], adherence to daily self-glucose monitoring≥4 times [20.5% (30/146) vs. 62.8% (125/199)], use of insulin pump therapy [16.2% (77/475) vs. 24.2% (71/293)] were significantly higher, and the differences were statistically significant (P<0.05). In addition, the participation group were significantly higher than the non-participation group in daily care behaviors, solving related problems and grasping the ability to grasp diabetes management goals, with statistical significance (P<0.001), but there was no statistical significance in the ability to collaborate in disease management between the two groups (P>0.05). Conclusions The HbA1c compliance rate of T1DM patients who participated in the leisure camp was generally higher. Although their daily care behaviors, problem-solving abilities, and mastery of diabetes management goals were better than those in the non-participating group, there were still shortcomings in disease management collaboration. [ABSTRACT FROM AUTHOR]

To investigate the relationship between bacterial community diversity and free amino acid content during hand-rolled cigar processing, hand-rolled cigars were sampled separately from five processing stages including wrapping, moisture balancing, cigar freezing, cigar curing, and cigar packaging. The diversity of the bacterial communities was analyzed by high-throughput Illumina MiSeq sequencing technology, the contents of 18 free amino acids were determined by ion chromatography-integrated pulse amperometry. The data obtained were analyzed by Spearman correlation analysis targeting the relationship between the bacterial community structure and the amino acid contents. The results showed that: during the process of hand-rolled cigar rolling, 1) the overall richness and diversity of bacterial communities of cigars had a downward trend and were more affected by the moisture balancing process; 2) the dominant bacterial phyla were Firmicutes, Proteobacteria, and Actinobacteriota with the average relative abundances of 51.75%, 35.80%, and 10.38%, respectively. The dominant bacterial genera were Acinetobacter, Oceanobacillus, Bacillus, Staphylococcus, and Klebsiella with the average relative abundances of 12.40%, 9.96%, 8.48%, 8.27%, and 4.21%, respectively; 3) the relative abundance of 9 bacterial genera groups changed significantly, which were Lysinibacillus, Corynebacterium, Sphingobacterium, Enterobacter, Aerococcus, Paenibacillus, norank_f_Mitochondria, Ralstonia, and Enterococcus; 4) the total content of the free amino acids generally had an increasing trend, among which aspartic acid accounted for the highest proportion, which was closely related to Sphingobacterium, Staphylococcus, and Paracoccus. In conclusion, the contents of amino acids are closely related to the community diversity of the bacterial during hand-rolled cigar rolling processing. [ABSTRACT FROM AUTHOR]

Autocorrelation test was a statistical test to evaluate the correlation between one sequence and the corresponding non-cyclic left-shifted d bits sequence.It was impractical to adopt all the values of d since its range was often very wide.Three relations between parameters of randomness test were defined firstly.Then the relationships among the subclass D={1,2,m/4,m/2,3m/4,m,2m}of autocorrelation test for block cipher were studied by statistical experiments,where m was block length.The experiments show that the prefer choice of parameter d is m when doing autocorrelation test for block cipher.The method is also available for parameter selection of other randomness test for other types of cryptosystem.

The conditions that two different parameters in a same randomness test should satisfy if they are independ- ent with each other was studied based on statistical theory. And a hypothesis method was proposed to test whether two parameters were independent or not. A series of experiments were designed to study the relations among the parameters gather of poker test,which was selected as a research instance by means of this method, and the experiment results were analyzed in details. The method is general and it can be used to deal with other randomness test, such as entropy test and binary derivation test. The work is helpful to select reasonable and scientific parameters in practical randomness test.

Objective To explore the feasibility and the value of Pittsburgh formula, SEARCH formula, coronary artery calcification in type 1 diabetes mellitus (CACT1) formula and Guangdong formula in evaluating insulin sensitivity in patients with type 1 diabetes mellitus (T1DM). Methods This study was a retrospective study. The patients who were admitted into T1DM comprehensive management clinic of the Second Xiangya Hospital of Central South University from November 2015 to December 2016 were collected. Waist circumference and hip circumference were recorded, and waist-hip ratio was calculated. Their blood pressure, fasting plasma glucose (FPG), glycated hemoglobin A1c (HbA1c), triglyceride (TG) and low-density lipoprotein-cholesterol (LDL-C) were collected. According to the 4 alternative formulas, the insulin sensitivity index of patients was calculated, respectively. The upper and lower quartile of insulin sensitivity indexes were defined as low and high insulin resistance respectively, and between the upper and lower quartile of insulin sensitivity indexes were defined as moderate insulin resistance. According to age, the patients were divided into minor group (≤ 18 years old) and adult group (>18 years old). T test or Mann-Whitney U test was used for comparison between the two groups. Kappa analysis was used for consistency analysis of 4 alternative formulas. Pearson or Spearman correlation analysis was used to analyze the correlation between insulin sensitivity index calculated by different formulas and clinical features of patients. Results Eighty-four patients with T1DM were included. Among them, there were 40 cases in adult group and 44 cases in minor group. There were 21 cases in high insulin resistance group, 42 cases in moderate insulin resistance group and 21 cases in low insulin resistance group. The consistency between Guangdong formula and Pittsburgh formula was the best, with the consistency rate of 78.6% and the Kappa coefficient of 0.657 (P<0.01). The insulin sensitivity indices calculated by the 4 alternative formulas were negatively correlated with waist circumference (r values were -0.300, -0.697, -0.422 and -0.349, respectively), waist-hip ratio (r values were -0.733, -0.514, -0.231 and -0.678, respectively), systolic blood pressure (r values were -0.241, -0.263, -0.356 and -0.384, respectively), FPG (r values were -0.355, -0.321, -0.359 and -0.300, respectively), TG (r values were -0.358, -0.700, -0.686 and -0.423, respectively) and LDL-C (r values were -0.385, -0.369, -0.329 and -0.428, respectively) (all P<0.05). The insulin sensitivity indices evaluated by Pittsburgh formula, SEARCH formula and Guangdong formula were negatively correlated with waist-hip ratio in minor and adult groups (r values in minor group were -0.651, -0.472 and -0.631, respectively; r values in adult group were -0.755, -0.651, -0.730, respectively), HbA1c (r values in minor group were -0.936, -0.843 and -0.895, respectively; r values in adult group were -0.799, -0.752 and -0.826, respectively) and TG (r values in minor group were -0.449, -0.696 and -0.499, respectively; r values in adult group were -0.353, -0.697 and -0.360, respectively) (all P<0.05). Conclusions Four alternative formulas can be used to evaluate insulin sensitivity in T1DM patients. Among them, Guangdong formula and Pittsburgh formula have the best consistency. Pittsburgh formula, SEARCH formula and Guangdong formula can be used to evaluate insulin sensitivity of minor and adult patients with T1DM. [ABSTRACT FROM AUTHOR]

Objective To summarize the data of women with breast mulignant tumor investigation consequence in Hainan Province from 2014 to 2018, and we study the execution of breast cancer items and the morbidity of women's breast mulignant tumor. Methods According to the unified standards of Hainan Province, the clinical data of 213 321 cases of breast cancer screening projects from 2014 to 2018 were summarized, and the results of breast cancer screening and project implementation were statistically analyzed. Results From 2014 to 2018, the total number of breast cancer screening tasks for women in Hainan Province was 172 000, and the total number of actual examinations was 213 321, and the task completion rate was 124.02%. Of the actual total, 93 127(43.66%) had been previously screened for breast cancer. The suspicious detection rates of color ultrasonic examination, X-ray examination and pathological examination were 4.98%, 44.74% and 32.67%, respectively, it is statistically significant of positive detection in the different years (P<0.05). A total of 13 885 cases of benign breast diseases were detected in 5 years, the positive rate of abnormal cases was 6.51%. The detection rates of breast fibroadenoma, intraductal papilloma, and other benign diseases were 1.04%, 0.04% and 5.43%, it is statistically significant of the abnormal/suspicious detection rate of different benign breast diseases (P<0.05). The positive rate of histopathological abnormalities in 5 years was 53.91/100 000. And the detection rate of breast cancer was 41.25/100 000, precancerous lesion was 10.78/100 000. After adjusting the age structure, the standardized prevalence rates of breast cancer in 2014-2018 were 51.53/100 000, 33.87/100 000, 59.26/100 000, 40.87/100 000, 36.14/100 000, and the 5-year standardized prevalence rate of breast cancer was 44.20/100 000. The follow-up rate of breast cancer was 91.30%, and the treatment rate was 83.48%. Conclusions The breast mulignant tumor investigation project in Hainan Province has achieved certain results. The government still needs to increase investment to expand the scope of breast cancer screening, improve the suspicious/abnormal case follow-up system, make better diagnosis capabilities of doctors and better investigation effectiveness. [ABSTRACT FROM AUTHOR]

In order to find a fast and accurate method for the determination of Bacillus cereus in cigar tobacco leaves, the performances of COMPASS chromogenic medium method (COMPASS method) and the ISO 7932 method were compared. The results showed that: 1) The standard strain and quantitative quality control strain were used to verify the performances of COMPASS chromogenic medium and mannitol yolk polymyxin agar ( MYP) medium used in the ISO 7932 method. The COMPASS chromogenic medium was more specific and selective than MYP medium, while their sensitivities were similar. 2) The difference between the detection results of the two methods on artificially contaminated samples and natural samples was not significant (P> 0.05), but the COMPASS method was simpler in use, needed less time and offered a higher accuracy. 3) The detection rate of Bacillus cereus in 24 cigar tobacco leaf samples was 83.3% with the level less than 105 CFU/g. Therefore, the COMPASS method was considered superior to the ISO 7932 method, as it could effectively reduce the interference of non-target Bacillus spp. in actual samples. In conclusion, the COMPASS method is suitable for the rapid detection of Bacillus cereus in cigar tobacco leaves. [ABSTRACT FROM AUTHOR]

In order to promote the calibration accuracy of pressure drop standards, a calibration method via adjusting volume flow was proposed. The proposed calibration method was compared with the existing CFO(Critical Flow Orifice) method in terms of repeatability and stability. The proposed calibration method was used in the collaborative studies of pressure drop standards organized by CORESTA. The results showed that: 1) Comparing with CFO method, the volume flow-based method decreased the standard deviation, the variance coefficient of calibration results and the extreme error of calibration results in a period of five months by more than 50%. 2) The relative extreme error between the mean values of calibration results of the laboratory in ZTRI (Zhengzhou Tobacco Research Institute, Zhengzhou, China) and three foreign laboratories was less than 0.40%; the coefficient of variation of calibration results in the four laboratories was less than 0.10%. This method can be used to improve the accuracy of measurement results of cigarette draw resistance and filter pressure drop. [ABSTRACT FROM AUTHOR]