Search

Pineapple is one of the most economically important fruit crops of Mauritius and is often sold after being minimally processed (MP). Unfortunately, minimally processed whole (MPW) and fresh-cut (MPC) pineapples are susceptible to microbial contamination that can compromise the quality of the products. It is therefore important that MP pineapples have optimal freshness, nutritional quality, and are free from microbial contamination which would otherwise constitute a public health hazard to the consumers. The main aim of this study was to assess the microbiological, nutritional, and physicochemical quality of MP pineapples sourced from wet markets and supermarkets. Samples of MPW and MPC pineapples collected from open markets and supermarkets were subjected to microbiological, pH, and vitamin C analyses. The MP pineapples were also challenged using the specific spoilage organism (SSO), Pseudomonas fluorescens and subsequently stored at either ambient or refrigeration temperature to simulate storage conditions of wet markets and supermarkets, respectively. Laboratory analyses revealed that the Total Viable Counts (TVC), pH, and vitamin C content for MPW and MPC pineapples sampled ranged from 4.8 – 5.5 Log CFU/g, 4.16 – 4.96, and 21.60 – 28.90 mg/100 g, respectively. Since the population density of TVC was less than 7 Log CFU/g, which usually marks the onset of microbiological spoilage, the products were considered to be of a satisfactory microbiological quality. Moreover, there was no statistically significant difference in the microbiological load, pH, and vitamin C content for pineapples sourced from markets and supermarkets. Taken together, this study reveals that MP pineapples sold in wet markets and supermarkets have a satisfactory microbiological, nutritional, and sensorial quality with a shelf-life of >7 hours and >5 days when stored at room (29°C) and refrigeration (4°C) temperatures, respectively. [ABSTRACT FROM AUTHOR]

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea , has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato ( Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius ; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Potato ( Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In September 2019, in a seed potato field located in St Pierre, approximately 10% of tubers showed the presence of numerous irregular-shaped black scurf lesions on the surface. After surface sterilization of tubers with 70% alcohol, the presumed sclerotia were directly transferred to chloramphenicol amended Potato Dextrose Agar (PDA) and incubated for 5 days at 25oC in the dark. From all sampled tubers, only fast-growing, pale brown Rhizoctonia - like colonies grew, from which hyphal-tip isolates with uniform morphology were obtained. Following staining with aniline blue using the clean slide technique, cells of the isolate were observed to be multinucleate, with typical characteristics of Rhizoctonia solani AG-3 including hyphal branching at right angles, slight constriction and septum near the branch base, presence of typical monilioid cells and formation of light-brown irregular-shaped sclerotia of average size 2 mm (Tsror 2010). Identification was further conducted by sequencing of ITS rDNA region. Total DNA was extracted directly from mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') (Gardes and Bruns 1993) and ITS-4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al. 1990). The nucleotide sequence of the representative isolate 448G-19/M (Accession No. MT523021) was compared with those available in GenBank and shared 99-100% identity with over 20 R. solani AG-3 isolates (100% with isolate 16-107, Salamone and Okubara 2020). Therefore, based on the morphological characteristics and sequence homology, the isolate was identified as R. solani AG-3. Koch's postulates were confirmed for the isolate by carrying out the pathogenicity tests. Twenty healthy, unwounded tubers were disinfected for 1 min with 50% commercial bleach (2% NaOCl) and individually placed in pots (20 cm ø) containing sterile substrate. Ten tubers were inoculated by placing colony fragments of 7 day-old cultures of isolate 448G-19/M near each tuber during planting. Similarly, 10 tubers inoculated with sterile PDA served as negative control. Plants were maintained in a greenhouse, watered daily and assessed for the presence of symptoms 60 days post emergence. All inoculated plants exhibited partial root necrosis while progeny tubers showed black scurf due to presence of sclerotia. Control plants remained symptomless. From all symptomatic tubers, the original isolate was successfully recovered and identified by the morphological and molecular characteristics mentioned above, thus fulfilling Koch's postulates. Although occurrence of potato black scurf had previously been observed in Mauritius (Anonymous 1927), to the best of our knowledge, this the first report confirming R. solani AG-3 as causal agent of black scurf on seed tubers in Mauritius. Early detection of R. solani AG-3 during potato seed production is necessary to prevent its dispersal via infected tubers to other fields around the island. This research is significant as it will contribute to the body of knowledge on potato pathology in Mauritius and at the same time assist in reducing losses associated with this important crop.

Tomatoes ( Solanum lycopersicum ) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M in Mauritius, with an annual production of 18,376 t over an area of 1365 ha. (Cheung Kai Suet 2019). In August 2019, disease surveillance was conducted in the tomato cv. 'Elipida' grown in the greenhouse situated at Camp Thorel (eastern part of Mauritius), a super-humid zone where the prevailing temperature and humidity were 30°C and 70% respectively. The symptoms included numerous circular to irregular, dark brown, target like lesions on the leaves, followed by the occurrence of yellow halo and occasional defoliation. Disease incidence was estimated to be 80% in the entire greenhouse. From sampled symptomatic leaves, small pieces of infected tissue were surface-disinfected with 1% sodium hypochlorite, air dried, and placed on PDA. After 7 days incubation at 23°C under 12 hours of natural light regime, isolates with fast growing grey-brown, velvety colonies were recovered. In colonies, singly-borne or in short chains, pale brown, cylindrical, straight or slightly curved conidia with 2 - 14 pseudosepta (34 x 2 μm) were numerous. Based on morphological features, the isolates were identified as Corynespora cassiicola (Berk. and M.A. Curtis) C.T. Wei (Dixon et al. 2009). Morphological identification was confirmed by amplifying and sequencing of the ITS region (ITS1, 5.8S rDNA and ITS2 regions) of the rDNA. Total DNA was extracted directly from fungal mycelium using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. PCR amplification and sequencing were performed with primers ITS1F and ITS4 (Takamatsu et al. 2010). The nucleotide sequence of the representative isolate 408G-19/M (575 bp) (Accession No. MN860167) was compared with those available in GenBank and shared 98 to 99.82% identity with over 100 C. cassiicola isolates (99.65% with FJ852578 from Solanum melongena , Dixon et al. 2009). Koch's postulates were confirmed by spraying 10 healthy tomato plants (four leaf phenophase) with spore suspension (1 x 103 conidia/ml) prepared from 10 days old colonies of isolate 408G-19/M in sterile water. Healthy tomato plants inoculated with sterile water served as negative control. Plants were maintained in greenhouse conditions. On all inoculated plants, characteristic target like necrotic spots were visible 7 days post inoculation. No symptoms were recorded in the negative control after 15 days. From all symptomatic tomato leaves, the original isolate was successfully recovered. So far in Mauritius, C. cassiicola had been reported on Molucella (Anon. [Director of Agriculture] 1961) and Bignonia spp. (Orieux 1959) and also as an endophyte associated with Jatropha spp. (Rampadarath et al. 2018). Although symptoms resembling target spot were previously observed on field-grown tomatoes (Vally, pers. Comm.), to our knowledge, this is the first study confirming C. cassiicola as a tomato pathogen in Mauritius. As C. cassiicola affects a wide range of hosts (Lopez et al. 2018), including tomato, cucumber, zucchini and banana which are all important for Mauritius, the occurrence of this pathogen is a potential threat. Additionally, the results will help in developing efficient disease control strategies, thus minimizing yield loss of tomatoes produced locally.