Search

The objective of this study was to evaluate the actions offered in the Teacher Development Program from the perceptions of the teachers of the medical course of a public university that has been working with active teaching and learning methods since 2002. After each action of the program, an evaluation instrument was applied to the participants, and the answers were submitted to content analysis and then organized into three categories: infrastructure and logistics, the teaching-learning strategies and the developed content. Teachers highlight the importance of organization and planning of activities and the environment in which these actions are developed; they emphasize the importance of using teaching-learning strategies that allow greater reflection on own practice and the integration of theory and practice. They point out that the themes proposed were timely and necessary, they recognize the importance of being in development, they talk about the motivation from the experiences lived. It is concluded that the Teacher Development is a process through which the teacher is in transformation, through a conscious and constant reflection of his own practice. This process can be promoted by institutional investments and by the regulatory mechanisms of institutions, constituted of an evaluation referenced in objective indicators, consistent with the goals to be achieved. In this sense, it is necessary to invest in permanent education, because long-term programs allow the development of the teacher´s and the institution´s needs. O objetivo deste estudo foi avaliar as ações oferecidas em um Programa de Desenvolvimento Docente a partir da percepção dos professores do curso de medicina de uma universidade pública que utiliza métodos ativos de ensino-aprendizagem desde 2002. Após cada ação do programa, um instrumento de avaliação foi aplicado aos participantes, e respostas foram submetidas à análise do conteúdo e em seguida foram organizadas em três categorias: infraestrutura e logística, estratégias de ensino-aprendizagem utilizadas, e conteúdo desenvolvido. Os professores destacam a importância da organização e planejamento das atividades e do ambiente em que essas ações se desenvolveram; Enfatizam a importância de utilizar estratégias de ensino-aprendizagem que possibilitem maior reflexão sobre a própria prática e a integração da teoria e a prática. Apontam que os temas propostos foram oportunos e necessários, reconhecem a importância de estarem em desenvolvimento, falam sobre a motivação a partir das experiências vivenciadas. Conclui-se que o Desenvolvimento Docente é um processo pelo qual o professor está em transformação, por meio de uma reflexão consciente e constante de sua própria prática. Esse processo pode ser promovido pelos investimentos institucionais e pelos mecanismos reguladores das instituições constituídos por uma avaliação referenciada em indicadores objetivos, coerentes com as metas a serem alcançadas. Nesse sentido, é necessário investir na educação permanente, pois os programas em longo prazo permitem trabalhar as necessidades do professor e da instituição. El objetivo de este estudio fue evaluar las acciones ofrecidas en un Programa de Desarrollo Docente a partir de la percepción de los profesores del curso de medicina de una universidad pública que utiliza métodos activos de enseñanza - aprendizaje desde 2002. Después de cada acción del programa, un instrumento de evaluación se aplicó a los participantes, y las respuestas se sometieron al análisis del contenido y luego se organizaron en tres categorías: infraestructura y logística, estrategias de enseñanza - aprendizaje utilizadas, y contenido desarrollado. Los profesores destacan la importancia de la organización y planificación de las actividades y del ambiente en que esas acciones se desarrollaron; Enfatizan la importancia de utilizar estrategias de enseñanza - aprendizaje que posibiliten una mayor reflexión sobre la propia práctica y la integración de la teoría y la práctica. Se señalan que los temas propuestos fueron oportunos y necesarios, reconocen la importancia de estar en desarrollo, hablan sobre la motivación a partir de las experiencias vivenciadas. Se concluye que el Desarrollo Docente es un proceso por el cual el profesor está en transformación, por medio de una re?exión consciente y constante de su propia práctica. Este proceso puede ser promovido por las inversiones institucionales y por los mecanismos reguladores de las instituciones constituidos por una evaluación referenciada en indicadores objetivos, coherentes con las metas a ser alcanzadas. En este sentido, es necesario invertir en la educación permanente, pues los programas a largo plazo permiten trabajar las necesidades del profesor y de la institución.

Resumo Introdução Os exames integram o sistema de saúde e contribuem para o avanço da assistência. A sua solicitação pelos médicos deve ser realizada adequadamente, podendo ser influenciada por diferentes aspectos. Objetivo Desenvolver e validar um instrumento de avaliação de aspectos que influenciam a solicitação de exames. Método Trata-se de um estudo transversal e analítico que passou pelas seguintes etapas: 1) identificação dos aspectos que influenciam a solicitação de exames na prática médica; 2) verificação da validade aparente e validade de conteúdo; 3) verificação da validade de construto; 4) análise da confiabilidade; 5) verificação da validade discriminante, aplicada a 158 médicos de família e emergencistas no norte de Minas Gerais. Resultados O instrumento permaneceu com 36 itens, psicometricamente válidos, agrupados em cinco dimensões: particularidade pessoal do médico; estrutura e processos do sistema de saúde; características do paciente; preparo profissional; e dificuldade para a realização do exame. O instrumento apresentou validade aparente, validade de conteúdo, validade de construto, nível satisfatório de confiabilidade e validade discriminante. Conclusão O instrumento de avaliação dos aspectos que influenciam a solicitação de exames na prática médica tem a possibilidade de identificar a influência particular de cada aspecto e de cada dimensão que interfere na prática de solicitação de exames. Abstract Background Exams are part of the health system, and they contribute to the advancement of care. The request of exams by physicians must be performed properly, and can be influenced by different aspects. Objective Develop and validate an instrument to evaluate aspects that influence the request for exams. Method This is a cross-sectional, analytical study conducted in the following steps: 1) Identification of the aspects that influence the request for exams in medical practice; 2) Verification of apparent and content validity; 3) Verification of construct validity; 4) Reliability analysis; 5) Verification of discriminant validity applied to 158 family and emergency physicians in the north of Minas Gerais state. Results The instrument was composed of 36 psychometrically valid items grouped into five dimensions: particularity of the physician, structure and processes of the health system, characteristics of the patient, professional expertise, and difficulty conducting the exam. The instrument presented apparent and content validity, construct validity, satisfactory level of reliability, and discriminant validity. Conclusion The instrument to assess aspects that influence the request of exams in medical practice can identify the particular influence of each aspect and each dimension that interferes with the practice of requesting exams.

Objective: To verify the prevalence of common mental disorders and associated factors in nursing technicians. Method: Cross-sectional analytical study conducted at a university hospital. A questionnaire with sociodemographic, educational and work-related variables and the Self Reporting Questionnaire-20 were used to verify the presence of common mental disorders. Association analysis was performed using the chi-squared test, with a significance level of 5%. Results: 280 nursing technicians participated in the study. The prevalence of common mental disorders was 46.9%. The variables family income (p=0.021) and working exclusively in health area (p

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.

CNPq - Conselho Nacional de Desenvolvimento Científico e Tecnológico FAPEMIG - Fundação de Amparo à Pesquisa do Estado de Minas Gerais CAPES - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior Background: the complex pathophysiology of obesity includes low-grade chronic inflammation of white adipose tissue, an increase in plasma levels of pro-inflammatory cytokines as well as genetic factors, which have all emerged as important risk factors. Objective: evaluate the association between the TNFα-308G/A variant and sociodemographic, clinical and behavioral variables in an urban population using overall and central obesity as the measured outcome. Methods: a cross-sectional population-based study was conducted. Anthropometric measures and genotyping were assessed in 808 individuals. The associations were tested using the hierarchical theoretical model and multiple logistic regressions. Results: thirty-one percent of subjects were overweight while 19.4% were obese. No association was observed between genotype frequencies of TNFα-308G/A and either obesity or other variables of adiposity, including waist circumference, waist to height ratio, conicity index, and fat mass. However, age, gender, physical inactivity, and other comorbidities were associated with measures of excess adiposity in the hierarchical model. The phase angle of AA genotype was lower than GA and GG genotypes (p < 0.05). Conclusion: the rs1800629 SNP of the TNFA gene was not associated with the adiposity indicators evaluated in this based population study. However, AA genotype is more likely to have low cellular membrane integrity.

Background Recent studies have shown a relationship between adiposity traits and a low-grade inflammation of adipose tissue resulting from chronic activation of the innate immune system as interleukin-1 beta (IL-1β). However, this association remains controversial. Besides, the Quilombola communities that have presumed different genetic background and it could change the obesity vulnerability. Objective To estimate the association between IL-1β and adiposity traits like obesity or abdominal obesity in Quilombola communities. A cross-sectional population-based study was conducted the northern region of Minas Gerais with the representative sample of 756 individuals aged ≥ 18 years. The swab oral was used for DNA extraction and the IL-1β rs1143634 polymorphism was evaluated by RFLP-PCR. The interviewed and measures were done using specific protocols. It was estimated to outcomes: the overweight (body mass index ≥ 25 kg/m2), abdominal obesity (waist circumference ≥ 88 cm for women and ≥ 102 cm for men), and the high conicity index (≥ 1.18 cm or women e ≥ 1.25 cm for men). Poisson regression multivariate models were constructed considering genotype and the outcomes, adjusted for socioeconomic and lifestyle variables. Results The distribution of IL-1β for the TT genotype was (11.9%), CT (25.1%) and CC (63.0%). The women TT carriers showed a higher regular soft drink consumption (p = 0.048). The height was lower in man TT carriers (p = 0.041) and lower weight (p = 0.025). The CT genotype showed higher BMI (p = 0.037). The CT and TT carriers showed less prevalence ratio to abdominal obesity even adjusted to socioeconomic and lifestyle variables, there no associations between genotype and overweight or high conicity index. Conclusions In conclusion, after socioeconomic and lifestyle adjustment T variant of rs1143634 is a protection factor for central obesity in Quilombola communities.

A qualidade de vida tornou-se uma importante medida de impacto em saúde. Sua avaliação relacionada às doenças e seus fatores de risco tem acrescido na população em geral. Objetivo: Verificar a qualidade de vida e a presença de associação com fatores de risco para as doenças crônicas não transmissíveis na população urbana do município de Montes Claros, Minas Gerais. Métodos: Estudo transversal de base populacional. A amostra foi calculada considerando-se a prevalência do fator de risco sobrepeso de 30% e corrigida para um efeito de delineamento de 30%. Amostragem por conglomerados de setores censitários urbanos. Sorteou-se 17 setores censitários e entrevistou-se 648 moradores de idade maior ou igual a 18 anos. Os fatores de risco para as doenças crônicas não transmissíveis foram verificadas e a qualidade de vida também através do SF-36. Resultados: Alguns dos fatores de risco foram associados a piores escores no questionário SF-36. Conclusão: a presença de alguns fatores de risco para as doenças crônicas tem impacto na qualidade de vida.Quality of life has become an important yardstick of the impact on health. Its evaluation related to diseases and associated risk factors has increased in the population in general. This article seeks to assess the quality of life and the presence of the association with risk factors for non-communicable chronic diseases in the urban population of the city of Montes Claros in the State of Minas Gerais. It is a population-based cross-sectional study. The sample was calculated considering the prevalence of risk factors of overweight of 30% and corrected for a variation of 30%. Cluster sampling was conducted on urban census sectors. Seventeen census sectors were selected and 648 residents aged e" 18 years were interviewed. The risk factors for non-communicable chronic diseases as well as the quality of life were verified using the SF-36 questionnaire. Some risk factors were associated with the lowest scores on the SF-36 questionnaire. The presence of some risk factors for chronic diseases has an impact on quality of life.

Trata-se de um estudo ecológico de tendência temporal, cujo objetivo é verificar a dinâmica populacional conforme os censos de 1980, 1991 e 2000 e o perfil de mortalidade no período entre 1996 e 2005, em Montes Claros (MG). Utilizou-se o banco de dados dos sistemas de informação do Datasus e IBGE. Os principais resultados indicam que o grupo de idosos passou de 4,1% em 1980, 5,0% em 1991, para 6,6% em 2000. Sobre a mortalidade proporcional por causa básica, as doenças do aparelho circulatório foram a primeira causa básica de óbito, sendo 23,05% em 1996 e 28,26% em 2005; seguiram-se as neoplasias, 14,13% em 1996 e 15,69% em 2005, causas externas de morbidade e mortalidade, 11,87% em 1996 e 12,74% em 2005 e doenças infecciosas e parasitárias, 8,42% em 1996 e 5,43% em 2005. O perfil de mortalidade acompanhou a dinâmica populacional do município, observando redução de doenças infecciosas e um aumento das doenças crônicas, compatível com o processo de envelhecimento populacional.This study is an ecological study of time trend. The objective of this study is to assess the population dynamics as the 1980 Census, 1991 and 2000, and the profile of mortality in the period between 1996 and 2005, in Montes Claros, Minas Gerais State. We used the information systems database of Datasus and IBGE. The main results indicate that the elderly group increased from 4.1% in 1980, 5.0% in 1991 to 6.6% in 2000. On the proportional mortality by cause, diseases of the circulatory system were the first cause of death, and 23.05% in 1996 and 28.26% in 2005, followed by cancer 14.13% in 1996 and 15.69% in 2005, external causes of morbidity and mortality 11.87% in 1996 and 12.74% in 2005 and infectious and parasitic diseases 8.42% in 1996 and 5.43% in 2005. The profile of mortality followed the population dynamics of the city observed a reduction of infectious diseases and an increase in chronic diseases, consistent with the process of population aging.

Este estudo objetivou compreender quais os modelos educacionais têm sido aplicados às atividades de educação em saúde. Trata-se de uma revisão de literatura, sobre o tema “Modelos de Educação” e “Educação em Saúde”, utilizando como referenciais livros-textos contemporâneos de especialistas da área de educação e periódicos sobre tais temas, disponíveis nas principais bases de dados. Os resultados revelaram que o Modelo Tradicional de educação em saúde objetiva transmissão do conhecimento e experiência do educador, atribuindo uma importância suprema ao conteúdo ensinado, esperando que os educandos o absorvam sem modificações e o reproduzam fielmente. Já, o modelo dialógico compreende a educação em saúde como um processo de conscientização, mudança e transformação, caracterizada por uma filosofia emancipatória dos sujeitos.Este estudio tuvo como objetivo determinar modelos educativos que se han aplicado a las actividades de educación en salud. Es una revisión de la literatura sobre el tema “Modelos de Educación”, “Educación para la Salud”, utilizando como referencia libros contemporáneos, revistas sobre temas tales disponible en las principales bases de datos. Resultados mostraron que Modelo Tradicional de educación para la salud tiene por objeto transferencia de experiências, conocimientos de al educador, lo que da una importancia primordial a los contenidos enseñados, con esperanza de que estudiantes absorber la misma, la reproducción fiel. Modelo basado en el diálogo entiende la educación para la salud como proceso de sensibilización, el cambio, la transformación, que se caracteriza por una filosofía del sujeto emancipatorio.This study aimed at determining which educational models have been applied to the activities health education. This is a review of literature on the topic “Models of Education” and “Health Education”, using as reference contemporary books of specialists in the field of education and journals on such topics available in major databases. The results showed that the Traditional Model of health education aims to transfer the knowledge and experience of the educator, giving a paramount importance to the content taught, hoping that the students absorb unchanged and faithfully reproduce. The model based on dialogue understands the in health education as a process of awareness, change and transformation, characterized by a philosophy of emancipatory subject.

OBJETIVO: Verificar a prevalência do transtorno mental comum (TMC) na população da cidade de Montes Claros, MG, e a existência de associação entre os fatores socioeconômicos e a utilização de práticas integrativas e complementares/medicina complementar e alternativa (PIC/MCA) com o TMC. MÉTODOS: Estudo transversal. População alvo: moradores de Montes Claros. A amostragem foi probabilística, com 3.090 pessoas. Utilizou-se formulário semi-estruturado e o self reporting questionnaire (SRQ-20) para identificação do TMC. Realizou-se regressão robusta de Poisson na análise com significância estatística considerada de p < 0,05. RESULTADOS: A prevalência de TMC foi de 23,2%, sendo 75% usuá­rios de PIC/MCA. Após controle para fatores de confusão, a prevalência de TMC foi maior naqueles com menor escolaridade (RP = 2,12; IC = 1,80-2,49); com menor nível econômico (RP = 1,92; IC = 1,07 - 3,44); com mais de 40 anos (RP = 1,30; IC = 1,15-1,48); do gênero feminino (RP = 2,99; IC = 1,50-3,58) e mais freqüente entre os que recorreram à homeopatia (RP = 1,52; IC = 1,12-2,08) e às benzedeiras (RP = 1,25; IC = 1,08-1,46). CONCLUSÕES: O TMC é muito freqüente na população de Montes Claros. As variáveis: escolaridade, nível econômico, idade e sexo, bem como a procura por homeopatia e benzedeiras estiveram associados ao TMC.OBJECTIVE: To verify the Common Mental Disorders (CMD) prevalence in Montes Claros, and existence of association among social economic factors and the Complementary and Alternative Medicine (CAM) utilization with CMD. METHODS: Cross-sectional study. Target population: Montes Claros residens. The sample was probabilistic with 3.090 people. A semi-structured questionnaire was used and the Self Reporting Questionnaire (SRQ-20) for identification of the CMD. It was done Poisson regression in the analysis with significance statistics considered of p < 0,05. RESULTS: The prevalence of CMD was of 23,2%, being 75% CAM users. The CMD prevalence was bigger in the those with minor schooling (RP = 2,12; IC = 1,80-2,49); minor economic level (RP = 1,92; IC = 1,07-3,44); over 40 years (RP = 1,30; IC = 1,15-1,48); in the women (RP = 2,99; IC = 1,50-3,58). It was more frequent among who turn to homeopathy (RP = 1,52; IC = 1,12-2,08) and spiritual healing by others (RP = 1,25; IC = 1,08-1,46). CONCLUSIONS: The CMD is very frequent in population of Montes Claros. The variables: schooling, economic level; age; sex as well as turn to homeopathy and spiritual healing by others.

The purpose of this study was to assess the LEPR gene Gln223Arg polymorphism (rs1137101) in oral squamous cell carcinoma (OSCC) and in potentially malignant oral lesions (PMOL) in comparison to normal oral mucosa in a Brazilian population. Smokers (n = 89) were selected from a representative sample of 471 individuals from the general population of Montes Claros, Brazil. Participants were age and gender matched to patients with OSCC (n = 25) and oral epithelial dysplasia (n = 25). We investigated the LEPR Gln223Arg polymorphism (A>G; rs1137101) in these groups. Genotype variants were assessed by RFLP-PCR, using MspI (HPAII) restriction endonuclease. The institutional review board of the Universidade Estadual de Montes Claros approved the study (process number 2667/2011). Written informed consent for this study was obtained from all participants. The GG genotype (Arg223Arg) appears to be the more relevant polymorphic variant in OSCC. It occurred, approximately, twice as frequently in OSCC patients than in the general population. In contrast, the A allele in its homozygosis form (Gln223Gln) is significantly associated with the development of PMOL; 80% of the samples from the PMOL group exhibit AA genotype. Our findings suggest new insights regarding LEPR gene variations in the development of OSCC and PMOL.

Hypertension is responsible for high morbidity and mortality as one of the most important cardiometabolic risk factors. The aim of the study was to investigate whether the Gln223Arg in the leptin receptor (LEPR) influences the prevalence of hypertension. A cross-sectional study was carried out in individuals aged ≥ 18 years. Polymorphism identification was performed using PCR-RFLP analysis. Participants with blood pressure ≥ 140/90 mmHg or medication use were considered hypertensive. Frequencies, means, cross-tabulations, and multivariate models were produced to study differences in hypertension prevalence by genotypes. The study includes 470 participants. The frequency of GG polymorphism variant was 10.43%, 46.81% AG, and 42.77% AA. The distribution of hypertension frequency by LEPR genotypes was the following: AA 43.8%, AG 40.4%, and GG 40.8%; there were no significant differences between groups. Comparative analysis which used multivariate Poisson regression adjusted by many potential confounders (age, sex, schooling, smoking, alcohol intake, obesity, and family history of parental obesity) did not modify this result. In this large sample of population-based study, the association of the LEPR Gln223Arg gene polymorphism with hypertension was not observed.

Objective To evaluate the knowledge about diagnostic imaging methods among primary care and medical emergency physicians. Materials and Methods Study developed with 119 primary care and medical emergency physicians in Montes Claros, MG, Brazil, by means of a structured questionnaire about general knowledge and indications of imaging methods in common clinical settings. A rate of correct responses corresponding to ≥ 80% was considered as satisfactory. The Poisson regression (PR) model was utilized in the data analysis. Results Among the 81 individuals who responded the questionnaire, 65% (n = 53) demonstrated to have satisfactory general knowledge and 44% (n = 36) gave correct responses regarding indications of imaging methods. Respectively, 65% (n = 53) and 51% (n = 41) of the respondents consider that radiography and computed tomography do not use ionizing radiation. The prevalence of a satisfactory general knowledge about imaging methods was associated with medical residency in the respondents' work field (PR = 4.55; IC 95%: 1.18-16.67; p-value: 0.03), while the prevalence of correct responses regarding indication of imaging methods was associated with the professional practice in primary health care (PR = 1.79; IC 95%: 1.16-2.70; p-value: 0.01). Conclusion Major deficiencies were observed as regards the knowledge about imaging methods among physicians, with better results obtained by those involved in primary health care and by residents.

The leptin receptor gene has been reported to associate with insulin and glucose metabolism and adiposity in different study settings and various populations. Therefore, the aim of the study was to investigate the associations of the leptin receptor gene Gln223Arg polymorphism (LEPR Gln223Arg) with high capillary glucose levels. Cross-sectional study with probabilistic sample was carried out in individuals aged ≥18 years in an urban area of Montes Claros, MG, Brazil. The capillary glucose was considered high when ≥140 mg/dL. The genotypes of LEPR Gln223Arg distribution were as the following: 10.43% GG (n=49), 46.81% AG (n=220), and 42.77% AA (n=201), and there were no prevalence differences between genders, (P=0.57). Multivariate-adjusted models showed that there is no association between the polymorphism LEPR Gln223Arg and capillary high levels of glucose even when adjusted for age, sex, smoking, schooling, and parental history of obesity. In conclusion, no association between the polymorphism LEPR Gln223Arg and elevated blood glucose levels was detected.

Objective Resveratrol (RSV) is the most studied natural compound that activates sirtuins, which produce beneficial metabolic effects on lipid and glucose metabolism. The aim of the present study was to investigate the role of resveratrol in preventing nonalcoholic fatty liver disease (NAFLD) and expression of liver inflammatory markers in mice treated with a high-fat diet. Methods and procedures Eighteen male mice were divided into three groups and fed for 60 d with a standard diet (ST), high-fat diet (HFD), or high-fat diet plus resveratrol (HFD + RSV, 30 mg/kg/d). Body weight, food intake, and serum total cholesterol, triacylglycerol, insulin, alanine transaminase (ALT), and aspartate aminotransferase (AST) were evaluated. Liver histology was analyzed. Expression of ACC, PPAR-γ, ChREBP, SREBP-1 c, CPT-1, tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), NF-κB, interleukin 1 β (IL-1 β), and SIRT1 were evaluated by quantitative real-time reverse transcriptase PCR (qRT-PCR). Results The major finding of the present study was that RSV reduced body fat, total cholesterol, triacylglycerol, transaminases, and insulin plasma level. These results were accompanied with a significant reduction in TNF-α, IL-6, and NF-κB mRNA expression in the liver. Analyses of liver adipogenesis related genes indicated that ACC, PPAR-γ, and SREBP-1 mRNA expression were significantly suppressed in HFD + RSV mice. In addition, we observed increased expression of SIRT1 in the HFD + RSV group. Conclusions We observed that treatment with resveratrol improved lipid metabolism, and decreased NAFLD and pro-inflammatory profile in liver of mice with obesity-inducible diets. These data suggest an important clinical application of RSV in preventing liver diseases.

Objetivou-se compreender a perspectiva de usuários sobre Educação em Saúde e seu significado no cotidiano, mediante pesquisa qualitativa, descritiva e exploratória. Os participantes foram 11 usuários cadastrados em uma Equipe de Saúde da Família em Montes Claros, MG, Brasil, com frequência igual ou superior a cinco atividades em grupos educativos desenvolvidos na unidade de saúde em 2007. Os dados, coletados em entrevistas não estruturadas, foram analisados pela análise do discurso. Resultados revelaram três categorias empíricas: "A prática de Educação em Saúde na Equipe de Saúde da Família"; "A Educação em Saúde propicia uma aprendizagem significativa"; "A Educação em Saúde favorece mudanças na saúde do usuário". Os grupos educativos, em cujas sessões utilizaram-se pedagogias de condicionamento, transmissão e/ou problematização, favoreceram aprendizagem significativa do usuário, propiciando mudanças nos hábitos de vida, no exercício da autonomia e na responsabilização pela saúde. This study aimed to understand users' perspectives regarding health education and its significance in everyday life, through qualitative, descriptive and exploratory research. The participants were eleven users registered with a family health team in Montes Claros, MG, Brazil, whose frequency of attendance of educational activities carried out in 2007, in health education groups, was not less than five times. Data were gathered through unstructured interviews and were analyzed by means of discourse analysis. The results revealed three empirical categories: "Health education practice in the family health team", "Health education provides meaningful learning" and "Health education favors changes in users' health". The health education groups, in which the sessions used pedagogical approaches of conditioning, transmission and/or problem-solving, favored meaningful learning among users. This enabling changes regarding living habits, use of autonomy and taking responsibility for health. Se trata de comprender la perspectiva de los usuarios sobre Educación en Salud y su significado en lo cotidiano mediante investigación cualitativa, descriptiva y exploratoria. Han participado 11 usuarios registrados en un Equipo de Salud de la Familia en Montes Claros, estado de Minas Gerais, Brazil, con frecuencia igual o superior a cinco actividades en grupos educativos desarrollados en la unidad de salud en 2007. Los datos, obtenidos en entrevistas no estructuradas, se analizaron por el análisis del discurso. Los resultados revelan tres categorías empíricas: " La práctica de Educación en Salud en el Equipo de Salud de la Familia" y " La educación en salud proporciona un aprendizaje significativo" , " La educación en salud favorece cambios en la salud del usuario" . Los grupos educativos cuyas sesiones se han utilizado pedagogías de condicionamiento, transmisión y/o problematización, favorecen un aprendizaje significativo del usuario, facilitando cambios en los hábitos de vida, en el ejercicio de la autonomía y en la responsabilización por la salud.

Resumo Objetivo: Analisar a prevalência de obesidade abdominal e fatores associados em comunidades quilombolas do norte de Minas Gerais, Brasil. Métodos: Estudo transversal realizado em 2019, a partir de entrevistas estruturadas e mensuração do perímetro da cintura; empregou-se regressão de Poisson, separada por sexo, para calcular razões de prevalência (RP) da obesidade abdominal ajustadas pelas variáveis independentes e intervalo de confiança de 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) dos quilombolas observados apresentaram obesidade abdominal; na análise ajustada, entre homens, verificou-se associação do desfecho com idade de ≥60 anos (60-69 anos: RP=2,52 - IC95% 1,33;4,75), não ser tabagista (RP=1,73 - IC95% 1,17;2,55) e referir hipertensão arterial (RP=1,42 - IC95% 1,11;1,80), enquanto, nas mulheres, associou-se com idade ≥50 anos (50-59 anos: RP=1,25 - IC95% 1,01;1,54), ex-tabagismo (RP=1,26 - IC95% 1,00;1,58), consumo de frango com pele (RP=1,09 - IC95% 1,00;1,19) e hipertensão (RP=1,22 - IC95% 1,11;1,36). Conclusão: Encontrou-se prevalência de obesidade abdominal alta entre os quilombolas, maior nos idosos, hipertensos, fumantes e ex-fumantes.