Search

PURPOSE: Biallelic PIGN variants have been described in Fryns syndrome, multiple congenital anomalies-hypotonia-seizure syndrome (MCAHS), and neurologic phenotypes. The full spectrum of clinical manifestations in relation to the genotypes is yet to be reported.METHODS: Genotype and phenotype data were collated and analyzed for 61 biallelic PIGN cases: 21 new and 40 previously published cases. Functional analysis was performed for 2 recurrent variants (c.2679C>G p.Ser893Arg and c.932T>G p.Leu311Trp).RESULTS: Biallelic-truncating variants were detected in 16 patients-10 with Fryns syndrome, 1 with MCAHS1, 2 with Fryns syndrome/MCAHS1, and 3 with neurologic phenotype. There was an increased risk of prenatal or neonatal death within this group (6 deaths were in utero or within 2 months of life; 6 pregnancies were terminated). Incidence of polyhydramnios, congenital anomalies (eg, diaphragmatic hernia), and dysmorphism was significantly increased. Biallelic missense or mixed genotype were reported in the remaining 45 cases-32 showed a neurologic phenotype and 12 had MCAHS1. No cases of diaphragmatic hernia or abdominal wall defects were seen in this group except patient 1 in which we found the missense variant p.Ser893Arg to result in functionally null alleles, suggesting the possibility of an undescribed functionally important region in the final exon. For all genotypes, there was complete penetrance for developmental delay and near-complete penetrance for seizures and hypotonia in patients surviving the neonatal period.CONCLUSION: We have expanded the described spectrum of phenotypes and natural history associated with biallelic PIGN variants. Our study shows that biallelic-truncating variants usually result in the more severe Fryns syndrome phenotype, but neurologic problems, such as developmental delay, seizures, and hypotonia, present across all genotypes. Functional analysis should be considered when the genotypes do not correlate with the predicted phenotype because there may be other functionally important regions in PIGN that are yet to be discovered.

Proponer un programa de capacitación de Competencias de las TIC del docente para mejorar la gestión de un centro educativo fue el objetivo de esta investigación. Metodológicamente enmarcada en una investigación de campo apoyada en un análisis documental, de carácter no experimental y observacional, el enfoque fue cuantitativo a partir de un estudio exploratorio – descriptivo y su población estuvo conformado por 12 docentes de la institución antes mencionada. Se usó la entrevista como la técnica de recolección de datos. Entre los resultados obtenidos se puede indicar: Los docentes no están capacitados para la implementación de las TIC en los procesos educativos, esto se debe a la falta de conocimiento de los docentes acerca del uso adecuado de programas, aulas virtuales, blog, plataformas educativas y sitios web. En plena era digital los centros educativos, los docentes y los estudiantes no cuentan con las herramientas tecnológicas básicas, debido a que, en muchos casos, existe la falta de recursos económicos. Se propone un programa de capacitación en competencias TIC que aminore el efecto de los aspectos desfavorables.

Educar en valor es un desafío ético que la sociedad tiene para promover los derechos humanos universales. En este contexto, tanto la filosofía, la ciencia y la pedagogía han contribuido a desarrollar metodologías que contribuyan en la formación moral de la ciudadanía. Algunas de ellas siguen una vía intelectual o directa sobre el tema, las cuales se enfocan en la conciencia y comprensión de los valores. Otras metodologías siguen una vía indirecta o emocional, la cual se enfoca en la experiencia y concreción del valor. Esta última vía ha sido fundamentada por el filósofo danés Søren Kierkegaard, quien establece que la comunicación ética ha de ser, principalmente, una comunicación basada en la experiencia. Aquel argumento filosófico realza la importancia de las actividades prácticas para la educación moral, de modo que se concluye que el deporte es un medio propicio para tal finalidad pedagógica. Abstract: Value education is an ethical challenge for society to promote universal human rights. In this context, philosophy, science and pedagogy have all contributed to the development of methodologies that contribute to the moral formation of citizens. Some of them follow an intellectual or direct approach to the subject, which focuses on the awareness and understanding of values. Other methodologies follow an indirect or emotional route, which focuses on the experience and concreteness of the value. The latter way has been substantiated by the Danish philosopher Søren Kierkegaard, who states that ethical communication has to be primarily a communication based on experience. This philosophical argument emphasises the importance of practical activities for moral education, which leads to the conclusion that sport is a suitable medium for this pedagogical purpose.

Cerebral palsy (CP) is a heterogeneous neurodevelopmental disorder that causes movement and postural disabilities. Recent research studies focused on genetic diagnosis in patients with CP of unknown etiology. The present study was carried out in 20 families with one family member affected with idiopathic CP. Chromosomal microarray and exome sequencing techniques were performed in all patients. Chromosomal microarray analysis did not show any pathological or probable pathological structural variant. However, the next-generation sequencing study showed a high diagnostic yield. We report 11/20 patients (55%) with different pathogenic or potentially pathogenic variants detected by exome sequencing analysis: five patients with mutations in genes related to hereditary spastic paraplegia, two with mutations in genes related to Aicardi-Goutières syndrome, three with mutations in genes related to developmental/epileptic encephalopathies, and one with a mutation in the PGK1 gene. The accurate and precise patients' selection, the use of a high-throughput genetic platform, the selection of adequate target genes, and the application of rigorous criteria for the clinical interpretation are the most important elements for a good diagnostic performance. Based on our findings, next-generation sequencing should be considered in patients with cryptogenic CP as the first line of genetic workup. IMPACT: Sequencing techniques in CP of uncertain etiology provides a diagnostic yield of 55%. The appropriate selection of cases optimizes the diagnostic yield. NGS facilitate better understanding of new phenotypes of certain genetic diseases.

Langer–Giedion's syndrome (LGS) or trichorhinophalangeal syndrome type II (TRPS II; MIM:150230) is a contiguous gene deletion syndrome caused by the haploinsufficiency of the TRPS1 and EXT1 genes. Cornelia de Lange's syndrome (CdLS) is a genetically heterogeneous dysmorphic syndrome where heterozygous mutations of RAD21 gene have been associated with a mild clinical presentation (CDLS type 4; MIM: 614701). We report a female patient with a 2.3-Mb interstitial deletion at 8q23.3-q24.1 encompassing EXT1 and RAD21 genes but not TRPS1. Clinical findings in this patient are correlated with a mixed phenotype of LGS and CdLS type 4.

Resumen La vocación docente es un contenido del currículo oculto, ya que al momento de decidir la profesión de pedagogía, este componente construido desde la subjetividad no participa formalmente del proceso de la toma de decisión; no obstante, esta situación no le resta importancia, pues el deseo por el cual una persona decide ser educador tiene un importante significado para el futuro profesional docente. Este estudio tiene como propósito categorizar los deseos que influyeron en la elección de la carrera de Pedagogía de Educación Física en la Universidad de Playa Ancha, Valparaíso, Chile. La investigación responde al enfoque cualitativo y sus participantes, veinte estudiantes (12 hombres y 8 mujeres), quienes cursan el tercer semestre académico. Los datos fueron recopilados por medio de la técnica del cuestionario no estructurado y el grupo focal, estos dieron paso al análisis de los datos mediante la teoría fundamentada y se utilizó como soporte de la información el programa Atlas.ti 7.5. Los resultados presentan cuatro familias: a) Formación personal del alumnado, b) influir en la comunidad, c) mejorar factores de riesgo social, y d) satisfacción personal. Se concluye que el estudiantado al momento de decidir su profesión, deseó ser actor social con poder de transformación social, ocupando los espacios educativos institucionales, como los espacios educativos comunitarios, con un gran énfasis en contrarrestar las problemáticas de salud que han vivenciado y/o identificado por medio de la historia de vida personal. Se recomienda que el personal docente universitario integre los deseos vocacionales del alumnado en su formación. Abstract Teaching as a vocation pertains to the hidden curriculum. When one decides to enter teaching, this considered to be a more subjective component since it does not formally influence our decision to become teachers and should not be deemed as less important for that reason. The reasons why someone decides to become a teacher is very important for the future of that person’s career. The objective of this study is to classify the different aspirations among the students participating in the study, that influenced their decision to become Physical Educations teachers and major in that field at the University of Playa Ancha in Valparaíso, Chile. The study focused on qualitative aspect of twenty students (12 males and 8 females) currently attending classes during the third semester of the academic school year. The data was gathered using a non-structured questionnaire and a focus group and later analyzed through a Grounded Theory approach. Atlas.ti 75 software was used. The results presented four classifications: a) the students’ personal background, b) influence on the community, c) improvement of social risk factors and d) personal satisfaction. It can be concluded that when students decide to major in this field, they wished to be a social stakeholder with the power of social transformation, occupying positions at educational institutions, such as community educational areas and a great emphasis to counteract healthcare problems experienced or identified though their staff. It is recommended that university faculty include the vocational aspirations of the students as part of their training.

Contains fulltext : 202800.pdf (Publisher’s version ) (Open Access) SMARCC2 (BAF170) is one of the invariable core subunits of the ATP-dependent chromatin remodeling BAF (BRG1-associated factor) complex and plays a crucial role in embryogenesis and corticogenesis. Pathogenic variants in genes encoding other components of the BAF complex have been associated with intellectual disability syndromes. Despite its significant biological role, variants in SMARCC2 have not been directly associated with human disease previously. Using whole-exome sequencing and a web-based gene-matching program, we identified 15 individuals with variable degrees of neurodevelopmental delay and growth retardation harboring one of 13 heterozygous variants in SMARCC2, most of them novel and proven de novo. The clinical presentation overlaps with intellectual disability syndromes associated with other BAF subunits, such as Coffin-Siris and Nicolaides-Baraitser syndromes and includes prominent speech impairment, hypotonia, feeding difficulties, behavioral abnormalities, and dysmorphic features such as hypertrichosis, thick eyebrows, thin upper lip vermilion, and upturned nose. Nine out of the fifteen individuals harbor variants in the highly conserved SMARCC2 DNA-interacting domains (SANT and SWIRM) and present with a more severe phenotype. Two of these individuals present cardiac abnormalities. Transcriptomic analysis of fibroblasts from affected individuals highlights a group of differentially expressed genes with possible roles in regulation of neuronal development and function, namely H19, SCRG1, RELN, and CACNB4. Our findings suggest a novel SMARCC2-related syndrome that overlaps with neurodevelopmental disorders associated with variants in BAF-complex subunits.

Development of assisted reproductive technologies to address infertility has favored the birth of many children in the last years. The majority of children born with these treatments are healthy, but some concerns remain on the safety of these medical procedures. We have retrospectively analyzed both the fertilization method and the microarray results in all those children born between 2010 and 2019 with multiple congenital anomalies, developmental delay and/or autistic spectrum disorder (n = 486) referred for array study in our center. This analysis showed a significant excess of pathogenic copy number variants among those patients conceived after in vitro fertilization with donor oocyte with respect to those patients conceived by natural fertilization (p = 0.0001). On the other hand, no significant excess of pathogenic copy number variants was observed among patients born by autologous oocyte in vitro fertilization. Further studies are necessary to confirm these results and in order to identify the factors that may contribute to an increased risk of genomic rearrangements, as well as consider the screening for genomic alterations after oocyte donation in prenatal diagnosis.

International audience; Proteins involved in transcriptional regulation harbor a demonstrated enrichment of mutations in neurodevelopmental disorders. The Sin3 (Swi-independent 3)/histone deacetylase (HDAC) complex plays a central role in histone deacetylation and transcriptional repression. Among the two vertebrate paralogs encoding the Sin3 complex, SIN3A variants cause syndromic intellectual disability, but the clinical consequences of SIN3B haploinsufficiency in humans are uncharacterized. Here, we describe a syndrome hallmarked by intellectual disability, developmental delay, and dysmorphic facial features with variably penetrant autism spectrum disorder, congenital malformations, corpus callosum defects, and impaired growth caused by disruptive SIN3B variants. Using chromosomal microarray or exome sequencing, and through international data sharing efforts, we identified nine individuals with heterozygous SIN3B deletion or single-nucleotide variants. Five individuals harbor heterozygous deletions encompassing SIN3B that reside within a $230 kb minimal region of overlap on 19p13.11, two individuals have a rare nonsynonymous substitution, and two individuals have a single-nucleotide deletion that results in a frameshift and predicted premature termination codon. To test the relevance of SIN3B impairment to measurable aspects of the human phenotype, we disrupted the orthologous zebrafish locus by genome editing and transient suppression. The mutant and morphant larvae display altered craniofacial patterning, commissural axon defects, and reduced body length supportive of an essential role for Sin3 function in growth and patterning of anterior structures. To investigate further the molecular consequences of SIN3B variants, we quantified genome-wide enhancer and promoter activity states by using H3K27ac ChIP-seq. We show that, similar to SIN3A mutations, SIN3B disruption causes hyperacetylation of a subset of enhancers and promoters in peripheral blood mononuclear cells. Together, these data demonstrate that SIN3B haploinsufficiency leads to a hitherto unknown intellectual disability/autism syndrome, uncover a crucial role of SIN3B in the central nervous system, and define the epigenetic landscape associated with Sin3 complex impairment.

El estudio de las emociones en educación física es cada vez más común. Sin embargo, las emociones del alumnado han gozado de más protagonismo en la literatura, en comparación con las del profesorado. El estudio de las emociones del profesorado se divide en dos enfoques principales, uno orientado a la intensidad y otro a la calidad emocional. Con la finalidad de contribuir a la comprensión de la calidad emocional, se ha decidido realizar una revisión narrativa que tuvo por objetivo analizar los significados de las emociones del profesorado de educación física. La búsqueda se llevó a cabo en siete bases de datos internacionales y se lograron identificar siete investigaciones cualitativas sobre la temática. Los resultados indican que las emociones del profesorado responden al saber docente, los valores, el desempeño laboral, la experiencia personal y profesional. Se concluye que las emociones del profesorado expresan la complejidad de la labor docente y sus posicionamientos éticos frente a diversas situaciones pedagógicas. Abstract. The study of emotions in physical education is increasingly common. However, the emotions of the students have enjoyed more prominence in the literature, compared to those of the teachers. The study of teachers' emotions is divided into two main approaches, one focused on intensity and the other on emotional quality. With the intention of contributing to the understanding of emotional quality, it has been decided to carry out a narrative review that aimed to analyze the meanings of the emotions of physical education teachers. The search was carried out in seven international databases and it was possible to identify seven qualitative investigations on the subject. The results indicate that teachers' emotions respond to teaching knowledge, values, work performance, personal and professional experience. It is concluded that the teachers' emotions express the complexity of the teaching work and their ethical positions in the face of diverse pedagogical situations.

La actividad filosófica se dirige principalmente al mundo de las ideas, o sea, trata sobre el pensamiento y la meditación de los temas más profundos de la existencia humana y no humana. Por otra parte, la actividad pedagógica se dirige principalmente a fines más prácticos, aunque no menos importantes, y aprovecha los saberes desvelados por los diferentes referentes de la filosofía. No obstante, se ha señalado que por diferentes motivos la educación se ha alejado mucho del mundo más profundo de las ideas, lo cual puede derivar en una actividad pedagógica muy superficial. Con este ensayo se pretende acercar la filosofía a la educación y, en concreto, a la educación física. En primer lugar, se tuvo como objetivo analizar el significado de amor que proponen dos filósofos asociados a la escuela fenomenológica, Max Scheler y José Ortega y Gasset. Posteriormente, aquel significado se asoció a la formación ética en la educación física escolar. El análisis refleja que ambos coinciden en que el amor es un sentimiento objetivo y un acto intencional dirigido a conservar adecuadamente lo que es valorado positivamente. También reconocen que el amor es anterior a las emociones, los pensamientos y los deseos, así como que su dirección va desde lo superior a lo inferior. Este conocimiento puede ser aplicado en la educación física de diferentes formas, destacando la conciencia sobre la relación de las emociones con los valores éticos, como la solidaridad, el respeto a los derechos humanos, la tolerancia y la humildad. Abstract: Philosophical activity is directed primarily to the world of ideas, that is, it deals with thoughts and meditation on the deepest themes of human and non-human existence. On the other hand, the pedagogical activity is mainly directed to more practical purposes, although not less important, and takes advantage of the knowledge revealed by the different referents of philosophy. However, it has been pointed out that for different reasons education has strayed far from the deeper world of ideas, which can lead to very superficial pedagogical activity. This essay aims to bring philosophy closer to education and, specifically, to physical education. First, the objective was to analyze the meaning of love proposed by two philosophers associated with the phenomenological school, Max Scheler and José Ortega y Gasset. Later, that meaning was associated with ethical training in school physical education. The analysis reflects that both agree that love is an objective feeling and an intentional act aimed at adequately preserving what is positively valued. They also recognize that love precedes emotions, thoughts, and desires, as well as its direction goes from the top to the bottom. This knowledge can be applied in physical education in different ways, highlighting awareness on the relationship between emotions and ethical values, such as solidarity, respect for human rights, tolerance, and humility.

En la educación formal, la retórica de los valores morales es muy común; sin embargo, suele prescindir de un profundo análisis de sus significados. Este ensayo tiene por objetivo analizar el valor de la humildad y su posible contribución al proceso pedagógico; en concreto, desde la perspectiva de los intelectuales Max Scheler y Paulo Freire. De esta forma, se ha reconocido que ambos filósofos asocian la humildad al acto de amar y, a su vez, al aceptar los aspectos valiosos que trascienden a la propia persona. Es decir, una antítesis del orgullo del ser moral y de la arrogancia intelectual. En este sentido, dicha virtud propiciaría un entorno pedagógico coherente con el diálogo democrático.

MECP2 duplication syndrome (MDS) is an X-linked neurodevelopmental disorder characterized by a severe to profound intellectual disability, early onset hypotonia and diverse psycho-motor and behavioural features. To date, fewer than 200 cases have been published. We report the clinical and molecular characterization of a Spanish MDS cohort that included 19 boys and 2 girls. Clinical suspicions were confirmed by array comparative genomic hybridization and multiplex ligation-dependent probe amplification (MLPA). Using, a custom in-house MLPA assay, we performed a thorough study of the minimal duplicated region, from which we concluded a complete duplication of both MECP2 and IRAK1 was necessary for a correct MDS diagnosis, as patients with partial MECP2 duplications lacked some typical clinical traits present in other MDS patients. In addition, the duplication location may be related to phenotypic severity. This observation may provide a new approach for genotype-phenotype correlations, and thus more personalized genetic counselling.

Este estudio tuvo por objetivo comprender la dinamica de la vocacion, en el transcurso de la experiencia laboral de los docentes de educacion fisica que se desempenan en el sistema educativo escolar. La metodologia utilizada corresponde al enfoque cualitativo y la participacion consta de nueve docentes hombres, con edades comprendidas entre los 34 y los 62 anos. El promedio de experiencia docente de los participantes es de 24 anos. Los datos fueron recopilados a traves de entrevistas semi-estructuradas y sometidos a un analisis de contenido deductivo-inductivo. En los resultados se presentan las siguientes familias de codigos: a) representacion de la vocacion docente; b) vocacion por la educacion fisica; c) factores que incentivan la vocacion docente; d) factores que perjudican la vocacion docente. Se concluye que la vocacion docente tiene un significativo componente afectivo, que ha estimulado a los docentes a desarrollar un compromiso social durante su labor educativa. Self-perception of the vocation in school physical education teachers in Chile Abstract The purpose of this study was to understand the dynamics of the vocation, in the course of the work experience of physical education teachers who work in the school education system. The methodology used corresponds to the qualitative approach and the participation consists of nine male teachers, aged between 34 and 62 years. The average teaching experience of the participants is 24 years. The data was collected through semi-structured interviews and subjected to an analysis of deductive-inductive content. The following families of codes are presented in the results: a) representation of the teaching vocation; b) vocation for physical education; c) factors that encourage the teaching vocation; d) factors that harm the teaching vocation. It is concluded that the teaching vocation has a significant affective component, which has stimulated teachers to develop a social commitment during their educational work. Recibido: 29 de abril de 2018 Aceptado: 05 de julio de 2018

The frequency of mitochondrial diseases (MD) has been scarcely documented, and only a few studies have reported data in certain specific geographical areas. In this study, we arranged a nationwide call in Spain to obtain a global estimate of the number of cases. A total of 3274 cases from 49 Spanish provinces were reported by 39 centres. Excluding duplicated and unsolved cases, 2761 patients harbouring pathogenic mutations in 140 genes were recruited between 1990 and 2020. A total of 508 patients exhibited mutations in nuclear DNA genes (75% paediatric patients) and 1105 in mitochondrial DNA genes (33% paediatric patients). A further 1148 cases harboured mutations in the MT-RNR1 gene (56% paediatric patients). The number of reported cases secondary to nuclear DNA mutations increased in 2014, owing to the implementation of next-generation sequencing technologies. Between 2014 and 2020, excepting MT-RNR1 cases, the incidence was 6.34 (95% CI: 5.71–6.97) cases per million inhabitants at the paediatric age and 1.36 (95% CI: 1.22–1.50) for adults. In conclusion, this is the first study to report nationwide epidemiological data for MD in Spain. The lack of identification of a remarkable number of mitochondrial genes necessitates the systematic application of high-throughput technologies in the routine diagnosis of MD.

A pesar de la importancia de la formación moral de las personas, suele ser una materia profundizada poco desde la perspectiva filosófica en el ámbito pedagógico. No obstante, suele ser regularmente mencionada para justificar acciones pedagógicas. En ese contexto, es que se ha considerado oportuno analizar la aprehensión de valores morales desde una perspectiva objetiva, y en concreto, de la que fundamentan dos importantes filósofos alemanes contemporáneos. A partir de este análisis, se explicará cómo los valores que existen independientes de la consciencia, se relacionan esencialmente con las disposiciones de ánimo y con la voluntad de cada persona. Relación que determinará la posibilidad o la impotencia de cada sujeto para apropiarse de los valores morales positivos.

Familial amyloidotic polyneuropathy is a genetically determined disease characterized by deposition of an anomalous transthyretin. A high index of suspicion is needed for this multisymptomatic and lethal disease to be diagnosed. The patient was a 70-year-old male examined due to hypesthesia in the hands and feet, plus difficulty walking. A neurophysiological study delivered the diagnosis of axonal sensorimotor polyneuropathy. He later developed cardiac symptoms and diarrhea. Urine laboratory analyses revealed a monoclonal spike of light chains (kappa). Biopsies of abdominal fat and bone marrow yielded normal results. The genetic study was compatible with a heterozygous Val30Met-transthyretin mutation. Very few case studies have described an association between familial amyloidotic polyneuropathy and monoclonal gammopathy. We stress that genetic confirmation is important regardless of the type of amyloid deposition revealed by the biopsy.

Introduction: Schaaf-Yang syndrome (SYS) is caused by truncating point mutations of the paternal allele of MAGEL2, an imprinted gene located in the critical region of Prader-Willi syndrome (PWS). These patients present a phenotype with neurodevelopmental delay, hypotonia, joint contractures, and a particularly high prevalence of autism (up to 75% in affected individuals). The loss of function of MAGEL2 is suggested to contribute to endocrine hypothalamic dysfunction in individuals with PWS. Case Presentation: The current study presented the case of a patient with SYS and a novel de novo truncating mutation of MAGEL2 and phenotypic characteristics typical of this Prader-Willi-like syndrome and also including partial hypopituitarism, hypothyroidism, growth hormone deficiency, and hyperprolactinemia. Conclusions: The clinical and molecular similarities between SYS and PWS suggested the need for a thorough endocrinological follow-up to improve the prognosis and long-term quality of life for patients with SYS.

The NSDHL gene encodes 3β-hydroxysteroid dehydrogenase involved in one of the later steps of the cholesterol biosynthetic pathway. Mutations in this gene can cause CHILD syndrome (OMIM 308050) and CK syndrome (OMIM 300831). CHILD syndrome is an X-linked dominant, male lethal disorder caused by mutations in the NSDHL gene that result in the loss of the function of the NSDHL protein. CK syndrome is an allelic X-linked recessive disorder. So far, 13 patients with CK syndrome from two families have been reported on. We present a new five-generation family with affected males manifesting clinical features of CK syndrome. Next generation sequencing was targeted to a custom panel of 542 genes with known or putative implication on intellectual disability. Missense mutation p.Gly152Asp was identified in the NSDHL gene in the DNA sample of the affected male. Mutation carrier status was confirmed for all the obligate carriers in the family. The clinical features of the affected males in the family manifested as weak fetal movements, severe intellectual disability, seizures, spasticity, atrophy of optic discs, microcephaly, plagiocephaly, skeletal abnormalities, and minor facial anomalies, including a high nasal bridge, strabismus, and micrognathia. A highly significant preferential transmission of the mutation was observed in this and previous families segregating CK syndrome. Our report expands the clinical spectrum of this syndrome to include weak fetal movements, spasticity, and plagiocephaly, and transmission ratio distortion. The various findings in these patients increase our understanding of the diversity of the clinical presentation of cholesterol biosynthesis disorders.

Human CMT2-FiPS4F1 cell line was generated from fibroblasts of a patient with Charcot-Marie-Tooth disease harbouring the following mutations in the GDAP1 gene in heterozygosis: p.Q163X/p.T288NfsX3. This patient did not present mutations in the PM22, MPZ or GJB genes. Human reprogramming factors OCT3/4, KLF4, SOX2 and C-MYC were delivered using a non-integrative methodology that involves the use of Sendai virus.

Resumen basado en el de la publicación Título, resumen y palabras clave disponibles en español y en inglés Se analizan las investigaciones sobre las emociones en el contexto de la clase de Educación Física publicadas en las bases de datos de libre acceso desde el año 2010 en adelante. Las bases de datos consultadas fueron Google Académico, REDALYC, REDIB, Dialnet, SciELO y DOAJ. Entre los criterios de inclusión se primó que fuesen documentos originales y que estuviesen disponibles en formato de texto completo. Los resultados indican que, en las fechas estudiadas, todos los artículos sobre esta materia se habían realizado en España y que la percepción emocional es el asunto que ha concentrado la mayor cantidad de los trabajos – seguido, con mucha menor cantidad, por la competencia emocional y por la inteligencia emocional percibida –. La revista que más estudios ha publicado sobre el tema es EmásF, Revista digital de Educación Física, y el enfoque más utilizado en los estudios es el cuantitativo, en segundo lugar el cualitativo y finalmente el enfoque mixto. El conocimiento que se expone es de mucha utilidad para los profesionales de la Educación Física puesto que estimula la reflexión sobre su quehacer docente contribuyendo a generar estrategias que propicien un estado de bienestar en el alumnado. ESP

Resumen Fundamento y objetivo Las alteraciones genomicas desequilibradas (duplicaciones o deleciones) causantes de trastornos del neurodesarrollo (TND) son en su mayoria episodios de novo . Sin embargo, tambien pueden surgir como consecuencia de reordenamientos equilibrados no detectados en uno de los progenitores, cambiando radicalmente el riesgo de recurrencia y el consejo genetico de estos casos. La tecnica de fluorescence in situ hybridization (FISH, «hibridacion in situ fluorescente») permite la identificacion y localizacion de reordenamientos cromosomicos tanto equilibrados como desequilibrados, identificando la ubicacion de los segmentos duplicados. En este trabajo se pretende localizar en el genoma los segmentos duplicados detectados en pacientes con TND, e identificar aquellos casos debidos a reordenamientos heredados. Pacientes y metodo El estudio se llevo a cabo en 13 pacientes con TND y portadores de duplicaciones genicas detectadas por compared genomic hybridization-array (CGH- array , «hibridacion genomica comparada sobre arrays »). Se utilizaron 2 aproximaciones de la tecnica FISH: hibridacion con sondas de pintado cromosomico y con sondas especificas de cada duplicacion. Resultados En la serie de 13 pacientes con duplicacion estudiados, se han encontrado 11 con duplicaciones en tandem, un caso con una traslocacion insercional intracromosomica, y otro con una traslocacion insercional intercromosomica. Por tanto, 2 de las duplicaciones que se habian considerado de novo habian sido, en realidad, heredadas de forma desequilibrada de un progenitor que era portador equilibrado del reordenamiento. Conclusion Los resultados ponen de manifiesto la necesidad de caracterizar, mediante la tecnica de FISH, los reordenamientos que se detectan por CGH- array , para identificar los casos con un elevado riesgo de recurrencia y realizar un correcto asesoramiento genetico.

Here we report on two unrelated male patients with syndromic intellectual disability (ID) due to duplication at Xq13.3–q21.1, a region of about 6 Mb and 25 genes. Among these, the most outstanding is ATRX, the causative gene of X-linked alpha-thalassemia/mental retardation. ATRX belongs to the growing list of genes implied in chromatin remodeling causing ID. Many these genes, such as MECP2, are dose-sensitive so that not only deletions and point mutations, but also duplications cause ID. Both patients have severe ID, absent expressive speech, early hypotonia, behavior problems (hyperactivity, repetitive self-stimulatory behavior), postnatal growth deficiency, microcephaly, micrognathia, cryptorchidism, low-set, posteriorly angulated ears, and downslanting palpebral fissures. These findings are also usually present among patients with loss-of-function mutations of the ATRX gene. Completely skewed X inactivation was observed in the only informative carrier mother, a constant finding among female carriers of inactivating point mutations of this gene. Participation of other duplicated genes cannot be excluded; nevertheless we propose that the increased dosage of ATRX is the major pathogenic mechanism of this X-linked disorder, a syndrome reminiscent of MECP2 duplication. © 2014 Wiley Periodicals, Inc.

Item does not contain fulltext Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.

Resumen: El amor como parte de la dimensión afectiva del ser humano requiere ser incorporado significativamente en la labor pedagógica, no obstante, es un desafío complejo por la naturaleza de aquel afecto, por lo que este estudio pretende comprender la perspectiva del profesorado. El propósito del estudio es identificar la representación social del amor en la educación escolar por parte del profesorado que se desempeña en la educación pública. El estudio responde al enfoque cualitativo y sus participantes son seis docentes de diferentes disciplinas pedagógicas. La recolección de datos se realizó por medio de informes cualitativos y entrevistas semi-estructuradas. Los datos fueron sometidos a un análisis de contenido que constó de tres fases utilizando el programa Atlas. ti 7.5. Los resultados presentan dos familias, semántica del amor y rol del amor en la educación escolar, las cuales se encuentran compuestas por tres códigos cada una. Se concluye que los docentes perciben el amor como un componente esencial para el bienestar y el aprendizaje, el cual es construido socialmente y se transmite por medio del lenguaje, transformando la realidad educativa. Abstract: Love as part of the affective dimension of the human being needs to be incorporated significantly into the pedagogical work, however, it is a complex challenge because of the nature of that affect, so this study aims to understand the perspective of the teaching staff. The purpose of the study is to identify the social representation of love in school education by teachers who work in public education. The study responds to the qualitative approach and its participants are six teachers from different pedagogical disciplines. The data collection was done through qualitative reports and semi-structured interviews. The data were subjected to a content analysis consisting of three phases, using the Atlas.ti 7.5 program. The results present two families, semantics of love and the role of love in school education, which are composed of three codes each. It is concluded that teachers perceive love as an essential component for wellbeing and learning, which is socially constructed and transmitted through language, transforming the educational reality.

Background Intellectual disability is a very complex condition where more than 600 genes have been reported. Due to this extraordinary heterogeneity, a large proportion of patients remain without a specific diagnosis and genetic counselling. The need for new methodological strategies in order to detect a greater number of mutations in multiple genes is therefore crucial. Methods In this work, we screened a large panel of 1256 genes (646 pathogenic, 610 candidate) by next-generation sequencing to determine the molecular aetiology of syndromic intellectual disability. A total of 92 patients, negative for previous genetic analyses, were studied together with their parents. Clinically relevant variants were validated by conventional sequencing. Results A definitive diagnosis was achieved in 29 families by testing the 646 known pathogenic genes. Mutations were found in 25 different genes, where only the genes KMT2D, KMT2A and MED13L were found mutated in more than one patient. A preponderance of de novo mutations was noted even among the X linked conditions. Additionally, seven de novo probably pathogenic mutations were found in the candidate genes AGO1, JARID2, SIN3B, FBXO11, MAP3K7, HDAC2 and SMARCC2. Altogether, this means a diagnostic yield of 39% of the cases (95% CI 30% to 49%). Conclusions The developed panel proved to be efficient and suitable for the genetic diagnosis of syndromic intellectual disability in a clinical setting. Next-generation sequencing has the potential for high-throughput identification of genetic variations, although the challenges of an adequate clinical interpretation of these variants and the knowledge on further unknown genes causing intellectual disability remain to be solved.

Background Aquaporins (AQPs) constitute a family of channel proteins implicated in transmembrane water transport. Thirteen different AQPs (AQP0–12) have been described but their precise biologic function still remains unclear. AQPs 1, 3, 4, 8, and 9 expression has been described in human chorion, amnion and placenta; however, AQP4 is the only that has been identified in the first trimester of human pregnancy. Objective To assess multiplicity of AQPs expression from 10th to 14th week gestation. Population and methods Chorionic villi samples (CVS) collected in pregnant women for prenatal diagnosis were analysed by real time-PCR to assess cDNA expression of AQPs 1, 2, 3, 4, 5, 6, 7, 8, 9, and 11, and compared with AQPs expression in placentas from normal term pregnancies. Results 26 CVS corresponding to 26 pregnant women (age: 32.7 ± 4.5 years; gestational age: 12.4 ± 0.9 weeks) and 10 placental samples corresponding to normal term pregnancies were analysed. In CVS karyotype was normal in 16 cases, trisomy in 6 cases, mosaicism in 1 and unknown in 1. We found high mRNA expression for AQPs 1, 3, 9 and 11, low for AQPs 4, 5, and 8, and non-detectable for AQPs 2, 6, and 7 in chorionic villi. Conclusions This is the first study systematically assessing the expression of a multiplicity of AQPs in chorionic villi samples between 10th and 14th weeks of gestation. High expression of AQP11 has been identified for the first time in early stages of human pregnancy. Chromosomal abnormalities did not alter AQPs' expression.

Summary Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

Hypomethylation of the KCNQ1OT1 imprinting center of chromosome 11 associated to Sotos-like features

Several authors have attempted to construct a phenotype map for duplications of different portions of chromosome 18 to identify a possible critical region (CR) for Edwards Syndrome. Partial duplications of 18q have been reported in the literature involving the distal CR in patients with some clinical features of Edwards Syndrome. Here, we describe a phenotypically normal male with a large duplication on chromosome 18 that involves the proposed distal CR. The lack of clinical features is remarkable, except for pathological semen analysis, which suggests that terminal 17.4 Mb of 18q do not contain the Edwards Syndrome CR. Alternatively, unknown modifier factors or undetected somatic mosaicism might cause incomplete penetrance of this duplication.

Loss-of-function mutations of the MECP2 gene are the cause of most cases of Rett syndrome in females, a progressive neurodevelopmental disorder characterized by severe mental retardation, global regression, hand stereotypies, and microcephaly. On the other hand, gain of dosage of this gene causes the MECP2 duplication syndrome in males characterized by severe mental retardation, absence of speech development, infantile hypotonia, progressive spasticity, recurrent infections, and facial dysmorphism. Female carriers of a heterozygous duplication show a skewed X-inactivation pattern which is the most probable cause of the lack of clinical symptoms. In this paper, we describe a girl with a complex de novo copy number gain at Xq28 and non-skewed X-inactivation pattern that causes mental retardation and motor and language delay. This rearrangement implies triplication of the MECP2 and IRAK1 genes, but it does not span other proximal genes located in the common minimal region of patients affected by the MECP2 duplication syndrome. We conclude that the triplication leads to a severe phenotype due to random X-inactivation, while the preferential X chromosome inactivation in healthy carriers may be caused by a negative selection effect of the duplication on some proximal genes like ARD1A or HCFC1.

Neuroblastoma (NB) is an embryonal tumour of neuroectodermal cells, and its prognosis is based on patient age at diagnosis, tumour stage and MYCN amplification, but it can also be classified according to their degree of methylation. Considering that epigenetic aberrations could influence patient survival, we studied the methylation status of a series of 17 genes functionally involved in different cellular pathways in patients with NB and their impact on survival. We studied 82 primary NB tumours and we used methylation-specific-PCR to perform the epigenetic analysis. We evaluated the putative association among the evidence of hypermethylation with the most important NB prognostic factors, as well as to determine the relationship among methylation, clinical classification and survival. CASP8 hypermethylation showed association with relapse susceptibility and, TMS1 and APAF1 hypermethylation are associated with bad prognosis and showed high influence on NB overall survival. Hypermethylation of apoptotic genes has been identified as a good candidate of prognostic factor. We propose the simultaneous analysis of hypermethylation of APAF1, TMS1 and CASP8 apoptotic genes on primary NB tumour as a good prognostic factor of disease progression.

Submicroscopic deletions of 1q44–qter cause severe mental retardation, profound growth retardation, microcephaly and corpus callosum hypo/agenesis in most patients. At least 3 intervals in 1q44 have been described as critical regions containing genes leading to corpus callosum abnormalities. In this report we describe a patient with a de novo small interstitial 1q44 deletion of 1,152 kb detected with 44K oligonucleotide array-CGH (44K Agilent Technologies) and a mild phenotype lacking corpus callosum abnormalities. The first deleted oligonucleotide was located at 242.638 Mb (within the ADSS gene), and the last deleted oligonucleotide at 243.791 Mb (within the KIF26B gene). The clinical and molecular findings of the patient here reported remain consistent with a role for the AKT3 or ZNF238 genes in corpus callosum development.

Neuroblastoma is an embryonal tumor of neuroectodermal cells. Patients with metastatic neuroblastoma have a poor survival rate, which has led to numerous efforts to develop prognostic markers. Cancer/testis-specific antigens MAGE-A1 and MAGE-A3 genes were proposed as minimal residual disease (MRD) markers in neuroblastoma, but its usefulness for this purpose is rather limited.We studied 47 primary neuroblastoma tumors. RNA was extracted and cDNA was prepared by reverse transcription. Detection of the MAGE-A1 expression was done by hybridization of the RT-PCR products. We used methylation-specific-PCR to perform the epigenetic studies.We studied the MAGE-A1 and MAGE-A3 expressions, and the MAGE-A1 expression showed significant association with tumor stage, absence of bone marrow infiltration and survival. A multivariate analysis enabled us to conclude that the MAGE-A1 expression represents a new independent predictive factor, which is independent of N-Myc amplification (P value = 0.000), age at diagnosis (P value = 0.002) or tumoral stage (P value = 0.024). Considering the epigenetic regulation of MAGE-A1, we analyzed its methylation profile, and found a significant association with its expression in tumor cells. Moreover, we found tumors that failed to show the MAGE-A1 expression despite the hypomethylated sequence, and corresponded to advanced neuroblastoma that might share another mechanism involved in MAGE-A1 silencing. Given the association described between genome-wide hypomethylation and microsatellite instability, we determined the MSI status of tumor samples, finding a significant correlation with the MAGE-A1 expression and, more specifically, with the hypomethylated status of this gene only in female patients.We conclude that the MAGE-A1 expression is associated with good prognosis in neuroblastoma.

Esta investigación tiene como propósito identificar las atribuciones causales de las emociones en el proceso de prácticade los estudiantes de Pedagogía en Educación Física que cursan el octavo semestre de su formación docente en laUniversidad. El estudio es de tipo descriptivo, realizado desde un enfoque cualitativo, con énfasis en la interpretación dela vivencia subjetiva. Los participantes son un total de 40 estudiantes, los cuales cursan su tercera práctica en el sistemaeducativo. Los datos fueron recopilados a través de informes afectivos y entrevistas sobre los sentimientos percibidosdurante el proceso, que se refieren al componente cognitivo de las emociones.Los resultados manifiestan dos dimensiones emergentes, que son 1) emociones positivas (alegría, entusiasmo,satisfacción): atribuidas al comportamiento respetuoso y motivado de los escolares, al refuerzo positivo y a lapreparación de las clases; 2) emociones negativas (miedo, ansiedad nerviosismo, tristeza, frustración): atribuidas a lairresponsabilidad de los escolares, la incertidumbre, las expectativas, la actitud del profesor guía y la autoevaluación dela práctica. Finalmente se concluye que las dimensiones y atribuciones detectadas, requieren de un proceso que seenfoque en la formación docente al aprendizaje de competencias emocionales, las que otorgarán inteligencia emocional alos practicantes en su desempeño profesional, propiciando el afecto positivo y regulando el afecto negativo.

MECP2 (methyl CpG binding protein 2) duplication causes syndromic intellectual disability. Patients often suffer from life-threatening infections, suggesting an additional immunodeficiency. We describe for the first time the detailed infectious and immunological phenotype of MECP2 duplication syndrome. 17/27 analyzed patients suffered from pneumonia, 5/27 from at least one episode of sepsis. Encapsulated bacteria (S.pneumoniae, H.influenzae) were frequently isolated. T-cell immunity showed no gross abnormalities in 14/14 patients and IFNy-secretion upon ConA-stimulation was not decreased in 6/7 patients. In 6/21 patients IgG2-deficiency was detected – in 4/21 patients accompanied by IgA-deficiency, 10/21 patients showed low antibody titers against pneumococci. Supra-normal IgG1-levels were detected in 11/21 patients and supra-normal IgG3-levels were seen in 8/21 patients – in 6 of the patients as combined elevation of IgG1 and IgG3. Three of the four patients with IgA/IgG2-deficiency developed multiple severe infections. Upon infections pronounced acute-phase responses were common: 7/10 patients showed CRP values above 200 mg/l. Our data for the first time show systematically that increased susceptibility to infections in MECP2 duplication syndrome is associated with IgA/IgG2-deficiency, low antibody titers against pneumococci and elevated acute-phase responses. So patients with MECP2 duplication syndrome and low IgA/IgG2 may benefit from prophylactic substitution of sIgA and IgG. Electronic supplementary material The online version of this article (doi:10.1007/s10875-015-0129-5) contains supplementary material, which is available to authorized users.

Purpose: Chromosomal alterations are a major cause of clinically recognized abortions. So cryptic chromosomal rearrangements could be responsible for recurrent miscarriages. Methods: The study was performed on 18 clinically normal couples who had four or more spontaneous abortions and whose karyotypes were found to be normal. Fluorescence in situ hybridization with specific probes of subtelomeric regions was used after optimizing the amount of probe. Results: Only one subtelomeric translocation was detected between 2p and 3p chromosomes, in a female with seven miscarriages. Conclusion: Subtelomeric rearrangements are infrequently related to multiple miscarriages. This kind of studies can be considered specially worthy when a couple have had not only abortions but also offspring with mental and physical anomalies. Thus, possible initial studies should focus on affected children or fetus.

Neuroblastoma and pheochromocytoma have the same embryonal origin. They originate from neural crest cells, and they usually affect suprarenal glands. The SDHB gene encodes the B subunit of succinate dehydrogenase, a protein implicated in the electron transport chain and Krebs cycle. Some mutations have been described in this gene in pheochromocytoma, and this gene could be an appropriate candidate for its study in neuroblastoma given its localization in lp35-36. The aim of this study was to analyze neuroblastoma tumors in order to assess a possible implication of this gene in neuroblastoma development. We studied 28 neuroblastoma tumor samples from different stages. Mutation research in genomic DNA was carried out after individual amplification of each of the eight SDHB exons by SSCP analysis and sequencing of those samples with migration pattern variants. No variant was found except for three polymorphisms in four neuroblastoma samples. The first polymorphism was a synonymous A → C change in the third position of codon 6 (exon 1). The other two polymorphisms were a TTC insert at the 5' flanking intron sequence of exon 5 in a stretch of seven TTC repeats. Upon the basis of posterior microsatellite instability and hyper-methylation promoter studies, which were not significant, we can conclude that the SDHB gene, a positional candidate gene, is unlikely to be related to either initiation or tumoral progression in neuroblastoma.

Neuroblastoma (NB) is a pediatric cancer of highly variable clinical outcome. Much effort is devoted to detection of minimal residual (MRD) disease through RT-PCR or immunology of tissue-specific markers. Tyrosine hyrdroxylase (TH) has demonstrated a high utility to assess disease dissemination, although this marker can be lost due to clonal variability. Here we propose the use of the doublecortin (DCX) gene as a new molecular marker of neuroblastoma cells. DCX specifically appears in migrating neurons of the central and peripheral nervous system and interacts with and regulates the microtobule cytoskeleton. We have studied this gene by real-time quantitative RT-PCR in a total of 47 primary tumors and 202 samples of bone marrow or peripheral blood from 34 high-risk neuroblastoma patients as well as in 41 normal controls. The expression of DCX demonstrated a good specificity and concordance with TH, showing a higher expression rate in all the sample types studied as well as at different time points from diagnosis. We conclude that DCX would be a more efficient marker of minimal disease in neuroblastoma and perhaps other tumors of neuronal lineage.

Clinical and molecular studies are reported on a Basque family (MRX82) with nonsyndromic X-linked mental retardation (XLMR) in five affected males. A total of 38 microsatellite markers were typed. The XLMR locus has been linked to DXS8067, DXS1001, DXS425, DXS7877, and DXS1183 with a maximum LOD score of 2.4. The haplotype studies and multipoint linkage analysis suggest a localization of the MRX82 locus to an interval of 7.6 Mb defined by markers DXS6805 and DXS7346, in Xq24 and Xq25, respectively. No gene contained in this interval has been so far associated with nonsyndromic mental retardation, except for GRIA3, disrupted by a balanced translocation in a female patient with bipolar affective disorder and mental retardation. However, the search for mutations of this gene did not showed a pathogenic mutation in the present family. Given that there are other eight MRX families overlapping this interval, none of them with known mutation, we conclude that at least one new gene responsible for nonsyndromic mental retardation is located in this region.

Two novel mutations of the ribosomal S6 kinase 2 gene (also known as RSK2) have been identified in two unrelated patients with Coffin–Lowry syndrome. The first mutation consists of a de novo insertion of a 5′-truncated LINE-1 element at position −8 of intron 3, which leads to a skipping of exon 4, leading to a shift of the reading frame and a premature stop codon. The L1 fragment (2800 bp) showed a rearrangement with a small deletion, a partial inversion of the ORF 2, flanked by short direct repeats which duplicate the acceptor splice site. However, cDNA analysis of the patient shows that both sites are apparently not functional. The second family showed the nucleotide change 803T>C in exon 10, resulting in the F268S mutation. This mutation was detected in two monozygotic twin patients and in their mother, who was mildly affected. The patients fulfill the clinical criteria of the syndrome, and therefore the mutation provides further support for the importance of phenylalanine at position 268, which is highly conserved in the protein kinase domain of many serine–threonine protein kinases.

Alterations of epigenetic mechanisms, and more specifically imprinting modifications, could be responsible of neurodevelopmental disorders such as intellectual disability (ID) or autism together with other associated clinical features in many cases. Currently only eight imprinting syndromes are defined in spite of the fact that more than 200 genes are known or predicted to be imprinted. Recent publications point out that some epimutations which cause imprinting disorders may affect simultaneously different imprintedloci, suggesting that DNA-methylation may have been altered more globally. Therefore, we hypothesised that the detection of altered methylation patterns in known imprintinglociwill indirectly allow identifying new syndromes due to epimutations among patients with unexplained ID. In a screening for imprinting alterations in 412 patients with syndromic ID/autism we found five patients with altered methylation in the four genes studied:MEG3, H19, KCNQ1OT1, andSNRPN. Remarkably, the cases with partial loss of methylation inKCNQ1OT1andSNRPNpresent clinical features different to those associated with the corresponding imprinting syndromes, suggesting a multilocus methylation defect in accordance with our initial hypothesis. Consequently, our results are a proof of concept that the identification of epimutations in knownlociin patients with clinical features different from those associated with known syndromes will eventually lead to the definition of new imprinting disorders.

Only 15 point mutations in NFIX gene have been reported so far, nine of them cause the Marshall-Smith syndrome (MSS) and the remaining mutations lead to an overgrowth disorder with a less severe phenotype, defined as Sotos-like. The clinical findings in three patients with MSS and two patients with a Sotos-like phenotype are presented. Analysis of the NFIX gene was performed both by conventional or next-generation sequencing. Five de novo mutations in NFIX gene were identified, four of them not previously reported. Two frameshift mutations and a donor-splice one caused MSS, while two missense mutations in the DNA binding/dimerisation domain entailed an overgrowth syndrome with some clinical features resembling Sotos syndrome, accompanied by a marfanoid habitus, very low BMI, long narrow face, or arachnodactyly. Marshall-Smith mutations are scattered through exons 6–10 of NFIX gene, while most point mutations causing an overgrowth syndrome are clustered in exon 2. Clinical features of this overgrowth syndrome may well be considered an intermediate phenotype between Sotos and Marfan syndromes.

This paper describes the presence of an interstitial pure duplication of 19p13.3 (4.95 Mb) in a patient with intellectual disability studied by array-CGH which was initially considered as a de novo alteration. The discovery of the same chromosomal alteration in a first-degree cousin of this patient led us to investigate the presence of insertional translocations, which were consequently found in three family generations. The same duplication was found in three intellectually disabled patients and among the translocation carrier family members a very high incidence of miscarriages are reported. A review of other published cases has allowed us to find three other patients with a similar pure duplication, all of them sharing some common clinical findings such as intrauterine growth retardation, microcephaly, motor and speech delay, moderate to severe intellectual disability, and dysmorphic features. These findings allow us to suggest the presence of a new microduplication syndrome in chromosomal region 19p13.3. © 2015 Wiley Periodicals, Inc.

In this report we present the clinical features and molecular and cytogenetic findings in a female with partial trisomy 14q. Molecular and cytogenetic studies allowed us to determine that the extra 14q material (of paternal origin) was translocated postzygotically onto the maternal X chromosome. Consequently, only the derivative X chromosome was inactivated, although inactivation apparently did not spread over the entire chromosome 14q. This partial inactivation makes the present case unusual, giving rise to phenotypic features absent in other patients with partial trisomy 14q, typically restricted to the distal part of the chromosome.