Search

Cellular metabolism has been proposed to govern distinct γδ T cell effector functions, but the underlying molecular mechanisms remain unclear. We show that interleukin-17 (IL-17)–producing γδ T (γδT17) and interferon-γ (IFN-γ)–producing γδ T (γδT1) cells have differential metabolic requirements and that the rate-limiting enzyme isocitrate dehydrogenase 2 (IDH2) acts as a metabolic checkpoint for their effector functions. Intriguingly, the transcription factor c-Maf regulates γδT17 effector function through direct regulation of IDH2 promoter activity. Moreover, mTORC2 affects the expression of c-Maf and IDH2 and subsequent IL-17 production in γδ T cells. Deletion of c-Maf in γδ T cells reduces metastatic lung cancer development, suggesting c-Maf as a potential target for cancer immune therapy. We show that c-Maf also controls IL-17 production in human γδ T cells from peripheral blood and in oral cancers. These results demonstrate a critical role of the transcription factor c-Maf in regulating γδT17 effector function through IDH2-mediated metabolic reprogramming.

Multiple myeloma (MM) is a hematologic malignancy derived from clonal expansion of plasma cells within the bone marrow and it may progress to the extramedullary region in late stage of the disease course. c-Maf, an oncogenic zipper leucine transcription factor, is overexpressed in more than 50% MM cell lines and primary species in association with chromosomal translocation, aberrant signaling transduction and modulation of stability. By triggering the transcription of critical genes including CCND2, ITGB7, CCR1, ARK5, c-Maf promotes MM progress, proliferation, survival and chemoresistance. Notably, c-Maf is usually expressed at the embryonic stage to promote cell differentiation but less expressed in healthy adult cells. c-Maf has long been proposed as a promising therapeutic target of MM and a panel of small molecule compounds have been identified to downregulate c-Maf and display potent anti-myeloma activities. In the current article, we take a concise summary on the advances in c-Maf biology, pathophysiology, and targeted drug discovery in the potential treatment of MM.

Macrophages have been linked to tumor initiation, progression, metastasis, and treatment resistance. However, the transcriptional regulation of macrophages driving the protumor function remains elusive. Here, we demonstrate that the transcription factor c-Maf is a critical controller for immunosuppressive macrophage polarization and function in cancer. c-Maf controls many M2-related genes and has direct binding sites within a conserved noncoding sequence of the Csf-1r gene and promotes M2-like macrophage–mediated T cell suppression and tumor progression. c-Maf also serves as a metabolic checkpoint regulating the TCA cycle and UDP-GlcNAc biosynthesis, thus promoting M2-like macrophage polarization and activation. Additionally, c-Maf is highly expressed in tumor-associated macrophages (TAMs) and regulates TAM immunosuppressive function. Deletion of c-Maf specifically in myeloid cells results in reduced tumor burden with enhanced antitumor T cell immunity. Inhibition of c-Maf partly overcomes resistance to anti–PD-1 therapy in a subcutaneous LLC tumor model. Similarly, c-Maf is expressed in human M2 and tumor-infiltrating macrophages/monocytes as well as circulating monocytes of human non–small cell lung carcinoma (NSCLC) patients and critically regulates their immunosuppressive activity. The natural compound β-glucan downregulates c-Maf expression on macrophages, leading to enhanced antitumor immunity in mice. These findings establish a paradigm for immunosuppressive macrophage polarization and transcriptional regulation by c-Maf and suggest that c-Maf is a potential target for effective tumor immunotherapy.

Due to the important role of N6-methyladenosine (m6A) in breast cancer, single nucleotide polymorphisms (SNPs) in genes with m6A modification may also be involved in breast cancer pathogenesis. In this study, we used a public genome-wide association study dataset to identify m6A-SNPs associated with breast cancer and to further explore their potential functions. We found 113 m6A-SNPs associated with breast cancer that reached the genome-wide suggestive threshold (5.0E-05), and 86 m6A-SNPs had eQTL signals. Only six genes were differentially expressed between controls and breast cancer cases in GEO datasets (GSE15852, GSE115144, and GSE109169), and the SNPs rs4829 and rs9610915 were located next to the m6A modification sites in the 3ʹUTRs of TOM1L1 and MAFF, respectively. In addition, we found that polyadenylate-binding protein cytoplasmic 1 might have a potential interaction with rs4829 (TOM1L1) and rs9610915 (MAFF). In summary, these findings indicated that the SNPs rs4829 and rs9610915 are potentially associated with breast cancer because they had eQTL signals, altered gene expression, and were located next to the m6A modification sites in the 3ʹUTRs of their coding genes. However, further studies are still needed to clarify how genetic variation affects the epigenetic modification, m6A, and its subsequent functions in the pathogenesis of breast cancer.

Liver tumor-initiating cells (TICs) are involved in liver tumorigenesis, metastasis, drug resistance and relapse, but the regulatory mechanisms of liver TICs are largely unknown. Here, we have identified a functional circular RNA, termed circRNA activating MAFF (cia-MAF), that is robustly expressed in liver cancer and liver TICs. cia-MAF knockout primary cells and cia-maf knockout liver tumors harbor decreased ratios of TICs, and display impaired liver tumorigenesis, self-renewal and metastatic capacities. In contrast, cia-MAF overexpression drives liver TIC propagation, self-renewal and metastasis. Mechanistically, cia-MAF binds to the MAFF promoter, recruits the TIP60 complex to the MAFF promoter, and finally promotes MAFF expression. Loss of cia-MAF function attenuates the combination between the TIP60 complex and the MAFF promoter. MAFF is highly expressed in liver tumors and liver TICs, and its antisense oligo (ASO) has therapeutic potential in treating liver cancer without MAFA/MAFG gene copy number alterations (CNAs). This study reveal an additional layer for liver TIC regulation as well as circRNA function, and also provide an additional target for eliminating liver TICs, especially for liver tumor without MAFA/MAFG gene CNAs.

Background Vascular endothelial cell apoptosis is the leading risk factor of atherosclerosis (AS). The purpose of our study was to use a new generation high-throughput transcription factor (TF) detection method to identify novel key TFs in vascular endothelial cell apoptosis induced by palmitic acid (PA). Methods Human umbilical vein endothelial cells (HUVECs) were treated with 0, 300, or 500 µM PA. Candidate TFs in the three groups were identified by differential expression, pathway enrichment, Western Blot (WB), and RT-qPCR analyses. Apoptosis was assessed by fluorescence-activated cell sorting (FACS) using FITC-annexin V and propidium iodide staining. Results We established a HUVEC apoptosis model to simulate the process of atherosclerosis onset and identified 51 significant TFs. of the 51 TFs, v-maf musculoaponeurotic fibrosarcoma oncogene family protein G (MAFG) and v-maf musculoaponeurotic fibrosarcoma oncogene family protein F (MAFF), were matched to known AS signalling pathways and were validated by WB and RT-qPCR analyses in our study. Overexpression of MAFG or MAFF in HUVECs significantly inhibited PA-induced early apoptosis. Conclusions We identified MAFF and MAFG as novel key TFs in vascular endothelial cell apoptosis.

Hepatitis B virus (HBV) is a stealth virus that exhibits only minimal induction of the interferon system, which is required for both innate and adaptive immune responses. However, 90% of acutely infected adults can clear the virus, suggesting the presence of additional mechanisms that facilitate viral clearance. Here, we report that Maf bZIP transcription factor F (MafF) promotes host defense against infection with HBV. Using a small interfering RNA (siRNA) library and an HBV/NanoLuc (NL) reporter virus, we screened to identify anti-HBV host factors. Our data showed that silencing of MafF led to a 6-fold increase in luciferase activity after HBV/NL infection. Overexpression of MafF reduced HBV core promoter transcriptional activity, which was relieved upon mutation of the putative MafF binding region. Loss of MafF expression through CRISPR/Cas9 editing (in HepG2-hNTCP-C4 cells) or siRNA silencing (in primary hepatocytes [PXB cells]) induced HBV core RNA and HBV pregenomic RNA (pgRNA) levels, respectively, after HBV infection. MafF physically binds to the HBV core promoter and competitively inhibits HNF-4α binding to an overlapping sequence in the HBV enhancer II sequence (EnhII), as seen by chromatin immunoprecipitation (ChIP) analysis. MafF expression was induced by interleukin-1β (IL-1β) or tumor necrosis factor alpha (TNF-α) treatment in both HepG2 and PXB cells, in an NF-κB-dependent manner. Consistently, MafF expression levels were significantly enhanced and positively correlated with the levels of these cytokines in patients with chronic HBV infection, especially in the immune clearance phase. IMPORTANCE HBV is a leading cause of chronic liver diseases, infecting about 250 million people worldwide. HBV has developed strategies to escape interferon-dependent innate immune responses. Therefore, the identification of other anti-HBV mechanisms is important for understanding HBV pathogenesis and developing anti-HBV strategies. MafF was shown to suppress transcription from the HBV core promoter, leading to significant suppression of the HBV life cycle. Furthermore, MafF expression was induced in chronic HBV patients and in primary human hepatocytes (PXB cells). This induction correlated with the levels of inflammatory cytokines (IL-1β and TNF-α). These data suggest that the induction of MafF contributes to the host’s antiviral defense by suppressing transcription from selected viral promoters. Our data shed light on a novel role for MafF as an anti-HBV host restriction factor.

The small musculoaponeurotic fibrosarcoma (sMaf) proteins MafF, MafG, and MafK are basic region leucine zipper- (bZIP-) type transcription factors and display tissue- or stimulus-specific expression patterns. As the oxidative stress reactive proteins, sMafs are implicated in various neurological disorders. In the present study, the expressions of sMafs were investigated across five databases gathering transcriptomic data from 74 Alzheimer's disease (AD) patients and 66 controls in the Gene Expression Omnibus (GEO) database. The expression of MafF was increased in the hippocampus of AD patients, which was negatively correlated with the expression of the glutamate cysteine ligase catalytic subunit (GCLC). Furthermore, MafF was significantly increased in patients with Braak stage V-VI, compared to those with Braak stage III-IV. β-Amyloid (Aβ), a strong inducer of oxidative stress, plays a crucial role in the pathogenesis of AD. The responsive expressions of sMafs to Aβ-induced oxidative stress were studied in the APP/PS1 mouse model of AD, Aβ intrahippocampal injection rats, and several human cell lines from different tissue origins. This study revealed that only the induction of MafF was accompanied with reduction of GCLC and glutathione (GSH). MafF knockdown suppressed the increase of GSH induced by Aβ. Among sMafs, MafF is the most responsive to Aβ-induced oxidative stress and might potentiate the inhibition of antioxidation. These results provide a better understanding of sMaf modulation in AD and highlight MafF as a potential therapeutic target in AD.

MafF is a member of the basic leucine zipper (bZIP) transcription factor Maf family and is commonly downregulated in multiple cancers. But the expression and function of MafF in hepatocellular carcinoma (HCC) remain unclear. In this study, we investigated the relationship between endogenous MafF expression and HCC progression and explored the regulatory mechanism of MafF expression in HCC. We found that MafF decreased in HCC tissues and cells. Lentivirus-mediated MafF overexpression inhibited HCC cell proliferation and induced cell apoptosis. Bioinformatics analysis and luciferase assay identified MafF as a direct target of miR-224-5p. RNA pull-down assay demonstrated that circular RNA circ-ITCH could sponge miR-224-5p specifically in HCC. The rescue experiments further elucidated that the expression and antitumor effects of MafF could be regulated via the circ-ITCH/miR-224-5p axis. This study verified that MafF acted as a tumor suppressor in HCC and revealed the upstream regulation mechanism of MafF, which provided a new perspective for potential therapeutic targets of HCC.

Many lines of evidence suggest that Parkinson's disease (PD) and Alzheimer's disease (AD) have common characteristics, such as mitochondrial dysfunction and oxidative stress. As the underlying molecular mechanisms are unclear, we perform a meta-analysis with 9 microarray datasets of PD studies and 7 of AD studies to explore it. Functional enrichment analysis revealed that PD and AD both showed dysfunction in the synaptic vesicle cycle, GABAergic synapses, phagosomes, oxidative phosphorylation, and TCA cycle pathways, and AD had more enriched genes. Comparing the differentially expressed genes between AD and PD, we identified 54 common genes shared by more than six tissues. Among them, 31 downregulated genes contained the antioxidant response element (ARE) consensus sequence bound by NRF2. NRF2 is a transcription factor, which protects cells against oxidative stress through coordinated upregulation of ARE-driven genes. To our surprise, although NRF2 was upregulated, its target genes were all downregulated. Further exploration found that MAFF was upregulated in all tissues and significantly negatively correlated with the 31 NRF2-dependent genes in diseased conditions. Previous studies have demonstrated over-expressed small MAFs can form homodimers and act as transcriptional repressors. Therefore, MAFF might play an important role in dysfunction of NRF2 regulatory network in PD and AD.

IgA regulates the composition and function of gut microbiota. Nakajima et al. show that a heavily glycosylated monoclonal IgA coats B. theta and induces Mucus-Associated Functional Factor in vivo to enhance symbiotic interactions with commensal bacteria to maintain gut homeostasis., Immunoglobulin A (IgA) promotes health by regulating the composition and function of gut microbiota, but the molecular requirements for such homeostatic IgA function remain unknown. We found that a heavily glycosylated monoclonal IgA recognizing ovalbumin coats Bacteroides thetaiotaomicron (B. theta), a prominent gut symbiont of the phylum Bacteroidetes. In vivo, IgA alters the expression of polysaccharide utilization loci (PUL), including a functionally uncharacterized molecular family provisionally named Mucus-Associated Functional Factor (MAFF). In both mice and humans, MAFF is detected predominantly in mucus-resident bacteria, and its expression requires the presence of complex microbiota. Expression of the MAFF system facilitates symbiosis with other members of the phylum Firmicutes and promotes protection from a chemically induced model of colitis. Our data reveal a novel mechanism by which IgA promotes symbiosis and colonic homeostasis., Graphical Abstract

Genome-wide association studies (GWASs) have mainly focused on top significant single nucleotide polymorphisms (SNPs), most of which did not have clear biological functions but were just surrogates for unknown causal variants. Studying SNPs with modest association and putative functions in biologically plausible pathways has become one complementary approach to GWASs. To unravel the key roles of mitogen-activated protein kinase (MAPK) pathways in cutaneous melanoma (CM) risk, we re-evaluated the associations between 47 818 SNPs in 280 MAPK genes and CM risk using our published GWAS dataset with 1804 CM cases and 1026 controls. We initially found 105 SNPs with P ≤ 0.001, more than expected by chance, 26 of which were predicted to be putatively functional SNPs. The risk associations with 16 SNPs around DUSP14 (rs1051849) and a previous reported melanoma locus MAFF/PLA2G6 (proxy SNP rs4608623) were replicated in the GenoMEL dataset (P < 0.01) but failed in the Australian dataset. Meta-analysis showed that rs1051849 in the 3ʹ untranslated regions of DUSP14 was associated with a reduced risk of melanoma (odds ratio = 0.89, 95% confidence interval: 0.82–0.96, P = 0.003, false discovery rate = 0.056). Further genotype–phenotype correlation analysis using the 90 HapMap lymphoblastoid cell lines from Caucasians showed significant correlations between two SNPs (rs1051849 and rs4608623) and messenger RNA expression levels of DUSP14 and MAFF (P = 0.025 and P = 0.010, respectively). Gene-based tests also revealed significant SNPs were over-represented in MAFF, PLA2G6, DUSP14 and other 16 genes. Our results suggest that functional SNPs in MAPK pathways may contribute to CM risk. Further studies are warranted to validate our findings.

The human gene MafF (hMafF) is a member of bZip transcription factor Maf family, but it alone cannot activate its target genes. In 2006, a novel hMafF interacting protein (MIP) was identified. Transient transfection assay in Hela cells suggested that co-expression of MIP and hMafF could activate US2-driven transcription. In this work, we constructed a series of plasmids and transformed YM4271 yeast strain to establish a recombinant yeast detection system. In this system, MIP's expression level could be regulated using glucose incubation or galactose-induced incubation. The expression level of reporter gene LacZ in obtained recombinant yeast strains was measured using quantitative liquid assay. By comparing and analyzing the beta-galactosidase activities of different yeast strains or the same yeast strain in different culture media, the effect of MIP on transactivation driven by nUS2-hMafF was finally determined. Only in the presence of both MIP and hMafF could the nUS2-pLacZi reporter in yeast genome be activated. More importantly, this work established a novel recombinant yeast detection system, which may serve as a powerful tool to study the regulatory mechanisms of transcription complex in the future.

The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine smooth muscle cells. We found that MAFF transcript levels are induced by proinflammatory cytokines in PHM1–31 myometrial cells. We observed an important induction by interleukin 1 beta (IL1B) and a weaker upregulation by tumor necrosis factor (TNF), whereas interleukin 6 (IL6) treatment had no effect. Time course experiments revealed a rapid induction of MAFF transcripts within 30 min following IL1B treatment. The presence of actinomycin D inhibited the upregulation, suggesting that regulation of MAFF mRNA levels occurs at the transcriptional level. We generated a MAFF-specific antiserum and determined that MAFF protein was also induced by TNF and IL1B in PHM1– 31 cells. In contrast, it was particularly interesting that the transcript and protein levels of the highly homologous MAFG and MAFK genes are not modulated by these cytokines. Our results suggest a possible specific role for MAFF in proinflammatory cytokine-mediated control of myometrial gene expression and provide the first link between a small MAF transcription factor and the inflammatory response. CNC, cytokines, gene regulation, IL1B, MAF, parturition, signal transduction, TNF, transcription factor, uterus

Exposure to inorganic arsenic has been associated with various forms of cancer, nervous system pathogenesis, and vascular diseases, as well as reproductive and developmental toxicity. Here, the effect of inorganic arsenic on placental JAR choriocarcinoma cells was assessed. The nuclear protein levels of the CNC transcription factor Nrf2 were strongly induced in the presence of arsenic. Dosage response experiments showed that 0.5 microM of arsenic is sufficient to augment Nrf2 levels. The expression of the Nrf2 dimerization partners MafG and MafK appeared not to be modulated by arsenic, whereas MafF protein levels were slightly increased. Arsenic also induced the binding of endogenous Nrf2/small Maf DNA-binding complexes to a stress response element (StRE) recognition site. In addition, arsenic caused oxidative stress in the choriocarcinoma cell model as evidenced by an increase in intracellular H2O2 levels. Expression of the enzyme heme oxygenase-1 (HO-1), a known Nrf2 target gene, was upregulated by exposure of JAR cells to arsenic. These results suggest that Nrf2/small Maf heterodimers may play an important role in the response to arsenic-mediated stress in placental cells.

While small Maf proteins have been suggested to be essential for the Nrf2-mediated activation of antioxidant response element (ARE)-dependent genes, the extent of their requirement remains to be fully documented. To address this issue, we generated mafG::mafF double-mutant mice possessing MafK as the single available small Maf. Induction of the NAD(P)H:quinone oxidoreductase 1 (NQO1) gene was significantly impaired in double-mutant mice treated with butylated hydroxyanisole, while other ARE-dependent genes were less affected. Similarly, in a keap1-null background, where many of the ARE-dependent genes are constitutively activated in an Nrf2-dependent manner, only a subset of ARE-dependent genes, including NQO1, were sensitive to a simultaneous deficiency in MafG and MafF. Examination of single and double small maf mutant cells revealed that MafK also contributes to the induction of ARE-dependent genes. To obtain decisive evidence, we established mafG::mafK::mafF triple-mutant fibroblasts that completely lack small Mafs and turned out to be highly susceptible to oxidative stress. We found that induction in response to diethyl maleate was abolished in a wider range of ARE-dependent genes in the triple-mutant cells. These data explicitly demonstrate that small Mafs play critical roles in the inducible expression of a significant portion of ARE-dependent genes.

Maf proteins are basic-leucine zipper transcription factors belonging to the AP1 superfamily. Several developmental processes require Maf proteins yet, the redundancy or complementarity of their respective roles in common processes has been only partially investigated. We present for the first time a complete comparative analysis of maf gene expression patterns in vertebrates. Expression of c-maf, mafB/kreisler, mafA/L-maf, mafF, mafG and mafK was analyzed by whole-mount in situ hybridization within chick embryos and their extraembryonic tissues ranging from embryonic day (E) 1 to 7. We carefully examined the extent of overlap between distinct maf genes and report that the developing lens, kidney, pancreas and apoptotic zones of limb buds show sustained co-expression of large maf genes. Small maf genes also exhibit overlap, for example in the dermomyotome. We also describe so far unidentified sites of maf gene expression. mafA is found in the developing neural tube and dorsal root ganglia. c-maf hybridization is detected in the neuroretina, the notochord and the endothelium of extraembryonic blood vessels.

ABSTRACT The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human β-globin locus control region is required for high level globin gene expression. We used an oligonucleotide of the NF-E2 tandem repeat, within HS2, as recognition site probe to screen a K562 cDNA library for interacting transcription factors. A 2.3 kb full length cDNA encoding the b-zip transcription factor MafF was isolated. MafF can form both homodimers and high affinity heterodimers with Nrf1, Nrf2 and Nf-E2, three members of the CNC-bZip family. Despite obvious structural similarities with the other small Maf proteins, MafF differs in its tissue distribution and its inability to repress transcription when overexpressed as homodimer. In fact, in different cell lines and on different promoters (γ-globin, β-globin and glutamylcysteine synthetase genes) the MafF homodimers do not appreciably affect transcription of target promoters, whereas MafF/CNC member heterodimers act as weak transcriptional activators. Even though MafF was cloned using probes derived from the globin LCR, it is in the context of the GCSl promoter and in combination with Jun that MafF shows a rather distinct and specific regulatory role. These observations suggest that a complex network of small Maf and CNC—AP1 protein interactions might be involved in regulating transcription in diverse tissues or developmental stages.

TCF11 (also known as Nrf1 and LCR-F1) is a basic-region leucine-zipper (b-ZIP) transcription factor that is essential during embryonic development. We have carried out expression analysis at a number of developmental stages and find that while there is some localized elevated expression between 8 and 9 days post coitum (dpc), the gene is widely expressed with a constant level of mRNA transcripts detectable in all tissues and at all stages examined. However, this does not reflect the specific nature of a TCF11 mutant phenotype (EMBO J. 17 (1998) 1779) which shows an essential role in foetal liver haematopoiesis. The specificity of TCF11 function may be controlled at a post-transcriptional level including availability of, and specific interaction with, a range of potential heterodimerization partners. We therefore carried out expression analysis of four candidate partner molecules; the three small Maf genes and another bZIP transcription factor found to bind to TCF11 in a two-hybrid screen, ATF4. We show different patterns of expression for the three Maf genes during development with MafG being widely expressed, MafK expressed only later in development and in specific tissues, and no detection of MafF. ATF4 shows evidence of complex regulation during development and shows elevated expression in many of the same sites as TCF11.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Small Maf proteins are obligatory heterodimeric partner molecules of mammalian Cap'n'Collar proteins that together control a wide variety of eukaryotic genes. Although both MafK and MafG are expressed in overlapping but distinct tissue distribution patterns during embryonic development, the physiological consequences of loss-of-function mutations in either gene are modest. This suggested that compensation by the third small Maf protein, MafF, might be a major reason for such mild phenotypes and that further analysis of MafF might therefore provide important insights for understanding small Maf regulatory function(s). We therefore cloned, mapped, transcriptionally and developmentally characterized, and finally disrupted the mafF gene. We show that murine mafF is transcriptionally regulated by three different promoters and is most abundantly expressed in the lung. The lacZ gene inserted into the mafF locus revealed prominent expression sites in the gut, lung, liver, outflow tract of the heart, cartilage, bone membrane, and skin but not in hematopoietic cells at any developmental stage. Homozygous mafF null mutant mice were born in a normal Mendelian ratio and displayed no obvious functional deficiencies, indicating that MafF activity may be dispensable even in tissues where the expression of other small Maf proteins is quite low.

The TP53 tumor-suppressor gene is frequently mutated in human cancer. Missense mutations can add novel functions (gain-of-function, GOF) that promote tumor malignancy. Here we report that mutant (mut) p53 promotes tumor malignancy by suppressing the expression of a natural occurring anti-inflammatory cytokine, the secreted interleukin-1 receptor antagonist (sIL-1Ra, IL1RN). We show that mutp53 but not wild-type (wt) p53 suppresses the sIL-1Ra production in conditioned media of cancer cells. Moreover, mutp53, but not wtp53, binds physically the sIL-1Ra promoter and the protein-protein interaction with the transcriptional co-repressor MAFF (v-MAF musculoaponeurotic fibrosarcoma oncogene family, protein F) is required for mutp53-induced sIL-1Ra suppression. Remarkably, when exposed to IL-1 beta (IL-1β) inflammatory stimuli, mutp53 sustains a ready-to-be-activated in vitro and in vivo cancer cells' response through the sIL-1Ra repression. Taken together, these results identify sIL-1Ra as a novel mutp53 target gene, whose suppression might be required to generate a chronic pro-inflammatory tumor microenvironment through which mutp53 promotes tumor malignancy.

Chronic myeloid leukemia (CML) is one of the most frequent hematological neoplasia worldwide. The abnormal accumulation of reactive oxygen species may be an important factor in CML development. The transcription factor NRF2 can regulate the transcription of a battery of antioxidant and detoxificant genes after heterodimerizing with small-Maf proteins. Although the participation of NRF2 in the development of chronic degenerative diseases has been thoroughly studied, the role of small-Maf genes has not been documented. We have identified polymorphisms in the three MAF genes (F, G and K) and assessed their association with CML. Over 266 subjects with CML and 399 unrelated healthy donors have been studied. After sequencing each MAF gene by Sanger technology, we found 17 variants in MAFF gene, eight in MAFG and seven in MAFK. In the case-control study, the homozygote genotype CC for the rs9610915 SNP of MAFF was significantly associated with CML. The frequency of the ACC haplotype from MAFK was significantly lower than controls. After stratification by gender, the ACC and GTG haplotypes were associated only with males with CML. These novel data suggest an association between MAFF and MAFG and the development of CML.

The human TCF11 gene encodes a ubiquitously expressed bZIP transcription factor of the cap n' collar (CNC) domain family. It has a high sequence similarity to the erythroid-specific bZIP factor p45 NF-E2 in the CNC domain, which is involved in DNA binding. LCR-F1, a TCF11 isoform, is a more potent transcriptional activator than p45 NF-E2 in erythroid cells. We show here that the TCF11 protein interacts to form heterodimers with small Maf proteins, previously shown to dimerize with p45 NF-E2, ECH and Fos. Such heterodimerization significantly alters the DNA binding characteristics of TCF11. While TCF11 alone binds in vitro to the tandem NF-E2 site derived from 5' DNase hypersensitive site 2 in the beta-globin locus control region and to the single NF-E2 site in the porphobilinogen deaminase gene promoter, stronger binding is detected in the presence of small Maf proteins. Using antibodies, TCF11 isoforms bound to the single NF-E2 site were detected in K562 erythroid cell nuclear extracts. These findings place TCF11 as a good candidate for the proposed widely expressed factor(s) known to interact with small Maf proteins and bind NF-E2 sites in a sequence-specific manner resembling NF-E2.

Embryogenesis is a period during which cells are exposed to dynamic changes of various intracellular and extracellular stresses. Oxidative stress response genes are regulated by heterodimers composed of Cap'n'Collar (CNC) and small Maf proteins (small Mafs) that bind to antioxidant response elements (ARE). Whereas CNC factors have been shown to contribute to the expression of ARE-dependent cytoprotective genes during embryogenesis, the specific contribution of small Maf proteins to such gene regulation remains to be fully examined. To delineate the small Maf function in vivo, in this study we examined mice lacking all three small Mafs (MafF, MafG, and MafK). The small Maf triple-knockout mice developed normally until embryonic day 9.5 (E9.5). Thereafter, however, the triple-knockout embryos showed severe growth retardation and liver hypoplasia, and the embryos died around E13.5. ARE-dependent cytoprotective genes were expressed normally in E10.5 triple-knockout embryos, but the expression was significantly reduced in the livers of E13.5 mutant embryos. Importantly, the embryonic lethality could be completely rescued by transgenic expression of exogenous MafG under MafG gene regulatory control. These results thus demonstrate that small Maf proteins are indispensable for embryonic development after E9.5, especially for liver development, but early embryonic development does not require small Mafs.

The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine smooth muscle cells. We found that MAFF transcript levels are induced by proinflammatory cytokines in PHM1-31 myometrial cells. We observed an important induction by interleukin 1 beta (IL1B) and a weaker upregulation by tumor necrosis factor (TNF), whereas interleukin 6 (IL6) treatment had no effect. Time course experiments revealed a rapid induction of MAFF transcripts within 30 min following IL1B treatment. The presence of actinomycin D inhibited the upregulation, suggesting that regulation of MAFF mRNA levels occurs at the transcriptional level. We generated a MAFF-specific antiserum and determined that MAFF protein was also induced by TNF and IL1B in PHM1-31 cells. In contrast, it was particularly interesting that the transcript and protein levels of the highly homologous MAFG and MAFK genes are not modulated by these cytokines. Our results suggest a possible specific role for MAFF in proinflammatory cytokine-mediated control of myometrial gene expression and provide the first link between a small MAF transcription factor and the inflammatory response.

The human transcription factor MafF (hMafF) lacks a transactivation domain, it contains a heptad-leucine repeat motif (viz., Leu-zipper) that may mediate protein-protein interactions to regulate transcriptional activities. A protein with a coiled-coil domain encoded by a novel human gene (GenBank Accession No. AF289559) was found to interact with hMafF in vitro and in vivo and is designated as a MafF interacting protein (MIP). Here, we provide evidence that the coiled-coil domain of MIP is essential for binding to the Leu-zipper of hMafF and that the interaction between MIP and hMafF causes the translocalization of MIP from cytoplasm to nucleolus in HELA cells. We used a promoter-reporter system containing six tandem repeats of the US2 element, located in the promoter of the human oxytocin receptor gene and reported to bind specifically to hMafF, to understand effects on transcriptional activation of hMafF, and its interaction with MIP. Expression of hMafF or MIP alone did not alter basal reporter transcription activity, whereas co-expression of hMafF and MIP activated transcription efficiently. Moreover, truncated MIP, still containing the coiled-coil domain, transactivated as well as the full-length MIP did, and highlighting that MIP acts as a co-activator of hMafF.

The three small Maf proteins, MafF, MafG and MafK, have been implicated in a number of physiological processes, including development, differentiation, haematopoiesis and stress response. Here we report the constitutive expression of mafF, mafG and mafK in six human cell lines derived from various tissues (HepG2, IMR-32, K-562, HEK-293, RD and A549). The expression patterns of mafF, mafG and mafK varied widely among cell lines. Because small Maf proteins have been implicated in electrophile response element (EpRE)-mediated stress response, the ability of three EpRE activators [pyrrolidinedithiocarbamate (PDTC), phenylethyl isothiocyanate (PEITC) and t-butylhydroquinone (tBHQ)] to induce small Maf expression was examined in detail in HepG2 cells. Both PDTC and PEITC induced mafF, mafG and mafK expression, whereas tBHQ failed to markedly induce any of the three small Mafs. Where a response was observed, mafF was induced to the greatest extent compared with mafG and mafK, and this response was transcriptionally mediated. PDTC also induced small Maf expression in the other cell lines examined, with patterns of induction varying among cell lines. The differences in expression among the cell lines examined, coupled with the induction patterns observed, indicate that the three small maf genes are stress-responsive, but may be regulated via differing mechanisms. Furthermore, the fact that tBHQ, PDTC and PEITC induce EpRE activity, but that tBHQ fails to markedly induce any of the small Mafs, suggests that up-regulation of small Mafs is not an absolute requirement for EpRE-mediated gene expression.

The v-maf oncogene of the avian musculoaponeurotic fibrosarcoma virus, AS42, encodes a nuclear protein which contains a characteristic b-Zip domain. By screening a chicken embryo fibroblast (CEF) cDNA library under moderately stringent hybridization conditions, we picked up a series of cDNA clones for a novel maf-related gene which we named mafK. We also identified another maf-related gene named mafF by screening a chicken genomic library using a mafK probe. Structural analyses suggested that the mafK and mafF genes consist of three exons. The exon-intron structures of the two genes resemble each other, but differ from that of the chicken c-maf gene. As compared to the c-Maf protein, the proteins encoded by the mafK and the mafF genes are rather small in size and lack the regions corresponding to the amino terminal acidic domain present in the c-Maf protein. On the other hand, the structures of the b-Zip domain are well conserved among these Maf-related proteins. When overexpressed by using an avian retroviral vector, the two maf-related genes did not induce morphological transformation of CEF cells but induced colony formation in soft agar with very low efficiencies. With a specific antibody, the MafK protein was detected predominantly in the nuclei of the cells infected with the virus which carries the mafK gene. Tissue distributions of these three maf-family genes are different from one another, probably reflecting their different functions in vivo.

Objective To report a novel phenotype of autosomal dominant atypical congenital cataract associated with variable expression of microcornea, microphthalmia, and iris coloboma linked to chromosome 2. Molecular analysis of this phenotype may improve our understanding of anterior segment development. Design Observational case study, genome linkage analysis, and gene mutation screening. Participants Three families, 1 Egyptian and 2 Belgians, with a total of 31 affected were studied. Methods Twenty-one affected subjects and 9 first-degree relatives underwent complete ophthalmic examination. In the Egyptian family, exclusion of PAX6, CRYAA , and MAF genes was demonstrated by haplotype analysis using microsatellite markers on chromosomes 11, 16, and 21. Genome-wide linkage analysis was then performed using 385 microsatellite markers on this family. In the 2 Belgian families, the PAX6 gene was screened for mutations by direct sequencing of all exons. Main Outcome Measures Phenotype description, genome-wide linkage of the phenotype, linkage to the PAX6, CRYAA , and MAF genes, and mutation detection in the PAX6 gene. Results Affected members of the 3 families had bilateral congenital cataracts inherited in an autosomal dominant pattern. A novel form of hexagonal nuclear cataract with cortical riders was expressed. Among affected subjects with available data, 95% had microcornea, 39% had microphthalmia, and 38% had iris coloboma. Seventy-five percent of the colobomata were atypical, showing a nasal superior location in 56%. A positive lod score of 4.86 was obtained at θ = 0 for D2S2309 on chromosome 2, a 4.9-Mb common haplotype flanked by D2S2309 and D2S2358 was obtained in the Egyptian family, and linkage to the PAX6, CRYAA , or MAF gene was excluded. In the 2 Belgian families, sequencing of the junctions and all coding exons of PAX6 did not reveal any molecular change. Conclusions We describe a novel phenotype that includes the combination of a novel form of congenital hexagonal cataract, with variably expressed microcornea, microphthalmia, and atypical iris coloboma, not caused by PAX6 and mapping to chromosome 2. Financial Disclosure(s) The authors have no proprietary or commercial interest in any materials discussed in this article.