Search

Sesame is a labor intensive crop with limited mechanized harvesting mainly due to the seed shattering (SS) trait. In this study, we performed a genetic analysis of the seed-shattering resistance (SR) trait with a SR sesame mutant 12M07. Unlike the SS type, the parenchyma cells in the abscission zone of the 12M07 mutant are arranged loosely but adhere to the seed coat. Inheritance analysis of six generations derived from 12M07 (SR)×Xiangcheng Dazibai (SS) showed that the SR trait is recessive and controlled by a single gene pair. Association mapping of the F2 population with 888,619 variants (single-nucleotide polymorphisms (SNPs) and insertion-deletion (InDels)) and 31,884 structural variations (SVs) determined that only SV12002 in the 5´ upstream region of gene Sindi0765000 (named SiHEC3) in Chr.3 was significantly associated with the SR trait. SiHEC3 encodes the bHLH transcription factor. A 1,049 bp deletion occurred in the 5´ UTR of Sihec3 in 12M07. SiHEC3 is mainly expressed in developing placental tissues, with the expression peaking in capsules at 45 days after pollination. A dual-luciferase reporter assay in tobacco confirmed that the promoter activity of Sihec3 was reduced because of the deletion of the 1,049 bp promoter sequence. Protein–protein interaction network analysis showed that HEC3 is co-expressed with nine key proteins, such as SHATTERPROOF1 (SHP1) and SEEDSTICK (STK) which participate in the secondary wall biosynthesis of the abscission layer in plants. The findings of this study show the important function of Sihec3 corresponding with the SR trait and supply the genetic information for breeding new varieties that are amenable to mechanized harvesting in sesame and other crops.

The loss of sesame capsule seed prior to harvest poses a significant economical challenge in mechanized production. The metabolites involved in capsule closure are still unclear. Using comparative metabolome and transcriptome analysis, this work investigated the molecular regulation and enrichment pathways in two sesame types of indehiscent capsule WanZhi28 (ND) and dehiscent capsule WanZhi2 (WZ2). The findings demonstrated that genes and metabolites were significantly enriched in lignin synthesis-related pathways. Furthermore, data suggests that lipid and sugar metabolism may have an impact on capsule closure. Apart from its function in cell signaling, the latter may contribute to the glycosylation of lignin monomers, while the former may provide ATP for cellular microtubule movement. This work concurrently focused on a large number of differentially expressed transcription factors linked to the sesame capsule's anti-cleft mechanism, providing new evidence for the discovery and use of functional markers and genes for capsule dehiscence. The identification of key pathways and regulatory mechanisms offers valuable information for developing strategies to mitigate seed loss during harvest, ultimately contributing to more efficient and profitable sesame production.

Sesame (Sesamum indicum L.) is an important oilseed crop widely cultivated in subtropical and tropical areas. Low genetic yield potential and susceptibility to disease contribute to low productivity in sesame. However, the genetic basis of sesame yield- and disease-related traits remains unclear. Here, we represent the construction of a high-density bin map of sesame using whole genome sequencing of an F2 population derived from ‘Yizhi’ and ‘Mingdeng Zhima’. A total of 2766 Bins were categorized into 13 linkage groups. Thirteen significant QTLs were identified, including ten QTLs related to yield, two QTLs related to Sesame Fusarium wilt (SFW) disease, and one QTL related to seed color. Among these QTLs, we found that SFW-QTL1.1 and SFW-QTL1.2 were major QTLs related to Fusarium wilt disease, explaining more than 20% of the phenotypic variation with LOD > 6. SCC-QTL1.1 was related to seed coat color, explaining 52% of the phenotypic variation with LOD equal to 25.3. This suggests that seed color traits were controlled by a major QTL. Candidate genes related to Fusarium wilt disease and seed color in the QTLs were annotated. We discovered a significant enrichment of genes associated with resistance to late blight. These genes could be spectral disease resistance genes and may have a role in the regulation of Fusarium wilt disease resistance. Our study will benefit the implementation of marker-assisted selection (MAS) for the genetic improvement of disease resistance and yield-related traits in sesame.

Sesame Fusarium wilt (SFW), caused by Fusarium oxysporum f. sp. sesami (Fos), is one of the most devastating diseases affecting sesame cultivation. Deciphering the genetic control of SFW resistance is pivotal for effective disease management in sesame. An inheritance study on a cross between the highly resistant variety Yuzhi 11 and the highly susceptible accession Sp1 using a Fos pathogenicity group 1 isolate indicated that resistance was conferred by a single dominant allele. The target locus was located in a 1.24 Mb interval on chromosome 3 using a combination of cross-population association mapping and bulked segregant analysis. Fine genetic mapping further narrowed the interval between 21,350 and 21,401 kb. The locus Sindi_0812400 was identified as the SFW resistance gene and officially designated SiRLK1. This gene encodes a specific malectin/receptor-like protein kinase with three putative tandem kinase domains and is considered a kinase fusion protein. Sequence analysis revealed that a high proportion (49.44%) of variants within the locus was located within the kinase domain III, and several of which were evidently associated with the diversity in SFW response, indicating the critical role of kinase domain III in expression of disease resistance. These findings provide valuable information for further functional analysis of SFW resistance genes and marker-assisted resistance breeding in sesame.

Abstract Background Sesame charcoal rot caused by Macrophomina phaseolina is one of the most serious fungal diseases in sesame production, and threatens the yield and quality of sesame. WAKL genes are important in the plant response to biotic stresses by sensing and transmitting external signals to the intracellular receptor. However, there is still a lack about the WAKL gene family and its function in sesame resistance to M. phaseolina. The aim of this study was to interpret the roles of WAKL genes in sesame resistance to M. phaseolina. Results In this study, a comprehensive study of the WAKL gene family was conducted and 31 WAKL genes were identified in the sesame genome. Tandem duplication events were the main factor in expansion of the SiWAKL gene family. Phylogenetic analysis showed that the sesame SiWAKL gene family was divided into 4 groups. SiWAKL genes exhibited different expression patterns in diverse tissues. Under M. phaseolina stress, most SiWAKL genes were significantly induced. Notably, SiWAKL6 was strongly induced in the resistant variety “Zhengzhi 13”. Functional analysis showed that SiWAKL6 was induced by salicylic acid but not methyl jasmonate in sesame. Overexpression of SiWAKL6 in transgenic Arabidopsis thaliana plants enhanced their resistance to M. phaseolina by inducing the expression of genes involved in the salicylic acid signaling pathway and reconstructing reactive oxygen species homeostasis. Conclusions Taken together, the results provide a better understanding of functions about SiWAKL gene family and suggest that manipulation of these SiWAKL genes can improve plant resistance to M. phaseolina. The findings contributed to further understanding of functions of SiWAKL genes in plant immunity.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) can participate in the regulation of plant growth and development, immunity and signal transduction. Sesamum indicum, one of the most important oil crops, has a significant role in promoting human health. In this study, 175 SiLRR-RLK genes were identified in S. indicum, and they were subdivided into 12 subfamilies by phylogenetic analysis. Gene duplication analysis showed that the expansion of the SiLRR-RLK family members in the sesame was mainly due to segmental duplication. Moreover, the gene expansion of subfamilies IV and III contributed to the perception of stimuli under M. phaseolina stress in the sesame. The collinearity analysis with other plant species revealed that the duplication of SiLRR-RLK genes occurred after the differentiation of dicotyledons and monocotyledons. The expression profile analysis and functional annotation of SiLRR-RLK genes indicated that they play a vital role in biotic stress. Furthermore, the protein−protein interaction and coexpression networks suggested that SiLRR-RLKs contributed to sesame resistance to Macrophomina phaseolina by acting alone or as a polymer with other SiLRR-RLKs. In conclusion, the comprehensive analysis of the SiLRR-RLK gene family provided a framework for further functional studies on SiLRR-RLK genes.

Fusarium wilt is a common fungal disease in sesame caused by Fusarium oxysporum f. sp. sesami (FOS). To determine the toxin production profiles of the FOS isolates with different pathogenicity levels under various culture conditions, we assessed the content variation of fusaric acid (FA) and 9, 10-dehydrofusaric acid (9, 10-DFA) produced by the four representative FOS isolates. Results indicated that the concentration of FA reached to a maximum of 2848.66 ​μg/mL in Czapek medium, while 9, 10-DFA was mainly produced in Richard and Low-carbon Richard medium. The concentration of 9, 10-DFA on Richard culture medium varied from 0 ​μg/mL to 716.89 ​μg/mL. Of the five culture media used in this study, Czapek culture medium was the most conductive to produce FA. FA production was significantly affected by culture medium, culture time, and their interactions. Results suggest that there is no correlation between toxin production and pathogenicity level of FOS isolates. These findings provide key information for the mechanism analysis of FOS- sesame interaction and pathogen control.

Plant U-box (PUB) proteins belong to a class of ubiquitin ligases essential in various biological processes. Sesame (Sesamum indicum L.) is an important and worldwide cultivated oilseed crop. However few studies have been conducted to explore the role of PUBs in drought tolerance in sesame. This study identified a total of 56 members of the sesame PUB family (SiPUB) genes distributed unevenly across all 13 chromosomes. Based on phylogenetic analysis, all 56 SiPUB genes were classified into six groups with various structures and motifs. Cis-acting element analysis suggested that the SiPUB genes are involved in response to various stresses including drought. Based on RNA-seq analysis and quantitative real-time PCR, we identified nine SiPUB genes with significantly different expression profiles under drought stress. The expression patterns of six SiPUB genes in root, leaf and stem tissues corroborated the reliability of the RNA-seq datasets. These findings underscore the importance of SiPUB genes in enhancing drought tolerance in sesame plants. Our study provides novel insights into the evolutionary patterns and variations of PUB genes in sesame and lays the foundation for comprehending the functional characteristics of SiPUB genes under drought-induced stress conditions.

Seed coat color is an important seed quality trait in sesame. However, the genetic mechanism of seed coat color variation remains elusive in sesame. We conducted a QTL mapping of the seed coat color trait in sesame using an F2 mapping population. With the aid of the newly constructed superdense genetic linkage map comprised of 22,375 bins distributed in 13 linkage groups (LGs), 17 QTLs of the three indices (i.e., L, a, and b values) of seed coat color were detected in seven intervals on four LGs, with a phenotype variance explanation rate of 4.46–41.53%. A new QTL qSCa6.1 on LG 6 and a QTL hotspot containing at least four QTLs on LG 9 were further identified. Variants screening of the target intervals showed that there were 84 genes which possessed the variants that were high-impact and co-segregating with the seed coat color trait. Meanwhile, we performed the transcriptome comparison of the developing seeds of a white- and a black-seeded variety, and found that the differentially expressed genes were significantly enriched in 37 pathways, including three pigment biosynthesis related pathways. Integration of variants screening and transcriptome comparison results suggested that 28 candidate genes probably participated in the regulation of the seed coat color in sesame; of which, 10 genes had been proved or suggested to be involved in pigments biosynthesis or accumulation during seed formation. The findings gave the basis for the mechanism of seed coat color regulation in sesame, and exhibited the effects of the integrated approach of genome resequencing and transcriptome analysis on the genetics analysis of the complex traits.

Abstract Background Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. Results For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. Conclusions SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Sesame is an important oil crop for the high oil content and quality. The seed oil and protein contents are two important traits in sesame. To identify the molecular markers associated with the seed oil and protein contents in sesame, we systematically performed the association mapping among 369 worldwide germplasm accessions under 5 environments using 112 polymorphic SSR markers. The general linear model (GLM) was applied with the criteria of logP ≥ 3.0 and high stability under all 5 environments. Among the 369 sesame accessions, the oil content ranged from 27.89%-58.73% and the protein content ranged from 16.72%-27.79%. A significant negative correlation of the oil content with the protein content was found in the population. A total of 19 markers for oil content were detected with a R2 value range from 4% to 29%; 24 markers for protein content were detected with a R2 value range from 3% to 29%, of which 19 markers were associated with both traits. Moreover, partial markers were confirmed using mixed linear model (MLM) method, which suggested that the oil and protein contents are controlled mostly by major genes. Allele effect analysis showed that the allele associated with high oil content was always associated with low protein content, and vice versa. Of the 19 markers associated with oil content, 17 presented near the locations of the plant lipid pathway genes and 2 were located just next to a fatty acid elongation gene and a gene encoding Stearoyl-ACP Desaturase, respectively. The findings provided a valuable foundation for oil synthesis gene identification and molecular marker assistant selection (MAS) breeding in sesame.

Seed coat color is an important agronomic trait in sesame, as it is associated with seed biochemical properties, antioxidant content and activity and even disease resistance of sesame. Here, using a high-density linkage map, we analyzed genetic segregation and quantitative trait loci (QTL) for sesame seed coat color in six generations (P1, P2, F1, BC1, BC2 and F2). Results showed that two major genes with additive-dominant-epistatic effects and polygenes with additive-dominant-epistatic effects were responsible for controlling the seed coat color trait. Average heritability of the major genes in the BC1, BC2 and F2 populations was 89.30%, 24.00%, and 91.11% respectively, while the heritability of polygenes was low in the BC1 (5.43%), in BC2 (0.00%) and in F2 (0.89%) populations. A high-density map was constructed using 724 polymorphic markers. 653 SSR, AFLP and RSAMPL loci were anchored in 14 linkage groups (LG) spanning a total of 1,216.00 cM. The average length of each LG was 86.86 cM and the marker density was 1.86 cM per marker interval. Four QTLs for seed coat color, QTL1-1, QTL11-1, QTL11-2 and QTL13-1, whose heritability ranged from 59.33%-69.89%, were detected in F3 populations using CIM and MCIM methods. Alleles at all QTLs from the black-seeded parent tended to increase the seed coat color. Results from QTLs mapping and classical genetic analysis among the P1, P2, F1, BC1, BC2 and F2 populations were comparatively consistent. This first QTL analysis and high-density genetic linkage map for sesame provided a good foundation for further research on sesame genetics and molecular marker-assisted selection (MAS).

Sesame (Sesamum indicum L.) is one of the oldest oilseed crops. In order to investigate the evolutionary characters according to the Sesame Genome Project, apart from sequencing its nuclear genome, we sequenced the complete chloroplast genome of S. indicum cv. Yuzhi 11 (white seeded) using Illumina and 454 sequencing. Comparisons of chloroplast genomes between S. indicum and the 18 other higher plants were then analyzed. The chloroplast genome of cv. Yuzhi 11 contains 153,338 bp and a total of 114 unique genes (KC569603). The number of chloroplast genes in sesame is the same as that in Nicotiana tabacum, Vitis vinifera and Platanus occidentalis. The variation in the length of the large single-copy (LSC) regions and inverted repeats (IR) in sesame compared to 18 other higher plant species was the main contributor to size variation in the cp genome in these species. The 77 functional chloroplast genes, except for ycf1 and ycf2, were highly conserved. The deletion of the cp ycf1 gene sequence in cp genomes may be due either to its transfer to the nuclear genome, as has occurred in sesame, or direct deletion, as has occurred in Panax ginseng and Cucumis sativus. The sesame ycf2 gene is only 5,721 bp in length and has lost about 1,179 bp. Nucleotides 1-585 of ycf2 when queried in BLAST had hits in the sesame draft genome. Five repeats (R10, R12, R13, R14 and R17) were unique to the sesame chloroplast genome. We also found that IR contraction/expansion in the cp genome alters its rate of evolution. Chloroplast genes and repeats display the signature of convergent evolution in sesame and other species. These findings provide a foundation for further investigation of cp genome evolution in Sesamum and other higher plants.

Sesame (Sesamum indicum L.) is one of the most important oilseed crops. Accurate and efficient means to identify each variety of sesame are needed for improvement of the sesame production market. In this study, three kinds of molecular markers were used for DNA fingerprinting of 151 sesame cultivars released in China since 1960: single nucleotide polymorphisms (SNPs), insertions or deletions (InDels), and simple sequence repeats (SSRs). The 140 polymorphic markers used (47 SNPs, 47 InDels, and 46 SSRs) revealed a narrow range of genetic variation among the 151 Chinese sesame cultivars. Clustering analysis classified them into three main groups, which were consistent with the cultivars' geographical distribution. Three of the 151 cultivars (AH03, AH04, and AH05 from the Anhui Province) were considered synonymous cultivars because of their high genetic similarity coefficients ( > 98%). Overall, 15 SNPs, 14 InDels, and 9 SSRs were sufficient to distinguish all sesame cultivars and the DNA fingerprints generated from these markers allowed establishing two-dimensional graphical barcodes to accurately and rapidly identify sesame cultivars. Thus, we have provided a useful protocol for the identification and authentication of various sesame cultivars and revealed the usefulness of SNPs, InDels, and SSRs in cultivar identification and intellectual property protection; the fingerprinting codes obtained for the 151 sesame cultivars should be useful in sesame breeding and marketing seed. [ABSTRACT FROM AUTHOR]

In this paper, electromagnetic (EM) scattering from one-dimensional dielectric soil rough surface with a perfect electric conductor (PEC) embedded in it is investigated by method of moments (MoM) for HH polarization. The soil rough surfaces are modeled as realizations of a Gaussian random process with the exponential spectrum, while the tapered incident wave is chosen to reduce the truncation error. Several numerical results are presented to investigate the impact of rough surface parameters of firms height and correlation length on the bistatic scattering coefficient (BSC), while the influence of the size and position of the object on the BSC is discussed. [ABSTRACT FROM AUTHOR]

Background: Sesame (Sesamum indicum L.) is one of the most important oil crops; however, a lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of samples from different sesame growth and developmental stages, and mining of genic-SSR markers to identify valuable markers for sesame molecular genetics research. Results: In this study, 75 bp and 100 bp paired-end RNA-seq was used to sequence 24 cDNA libraries, and 42,566 uni-transcripts were assembled from more than 260 million filtered reads. The total length of uni-transcript sequences was 47.99 Mb, and 7,324 SSRs (SSRs ≥15 bp) and 4,440 SSRs (SSRs ≥?18 bp) were identified. On average, there was one genic-SSR per 6.55 kb (SSRs ≥15 bp) or 10.81 kb (SSRs ≥18 bp). Among perfect SSRs (≥18 bp), di-nucleotide motifs (48.01%) were the most abundant, followed by tri- (20.96%), hexa- (25.37%), penta- (2.97%), tetra- (2.12%), and mono-nucleotides (0.57%). The top four motif repeats were (AG/CT)n [1,268 (34.51%)], (CA/TG)n [281 (7.65%)], (AT/AT)n [215 (5.85%)], and (GAA/TTC)n [131 (3.57%)]. A total of 2,164 SSR primer pairs were identified in the 4,440 SSR-containing sequences (≥18 bp), and 300 SSR primer pairs were randomly chosen for validation. These SSR markers were amplified and validated in 25 sesame accessions (24 cultivated accessions, one wild species). 276 (92.0%) primer pairs yielded PCR amplification products in 24 cultivars. Thirty two primer pairs (11.59%) exhibited polymorphisms. Moreover, 203 primer pairs (67.67%) yielded PCR amplicons in the wild accession and 167 (60.51%) were polymorphic between species. A UPGMA dendrogram based on genetic similarity coefficients showed that the correlation between genotype and geographical source was low and that the genetic basis of sesame in China is narrow, as previously reported. The 32 polymorphic primer pairs were validated using an F2 mapping population; 18 primer pairs exhibited polymorphisms between the parents, and 14 genic-SSRs could be integrated into 9 main linkage groups. Conclusions: 2,164 genic-SSR markers have been developed in sesame using transcriptome sequencing. 276 of 300 validated primer pairs successfully yielded PCR amplicons in 24 cultivated sesame accessions. These markers increase current SSR marker resources and will greatly benefit genetic diversity, qualitative and quantitative trait mapping and marker-assisted selection studies in sesame. [ABSTRACT FROM AUTHOR]

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1a gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame. [ABSTRACT FROM AUTHOR]

Sesame (Sesamum indicum L., 2n = 26) is a crucial oilseed crop cultivated worldwide. The ancient evolutionary position of the Sesamum genus highlights its value for genomics and molecular genetics research among the angiosperms of other genera. However, Sesamum is considered a small orphan genus with only a few genomic databases for cultivated sesame to date. The urgent need to construct comprehensive, curated genome databases that include genus-specific gene resources for both cultivated and wild Sesamum species is being recognized. In response, we developed Sesamum Genomics Database (SesamumGDB), a user-friendly genomic database that integrates extensive genomic resources from two cultivated sesame varieties (S. indicum) and seven wild Sesamum species, covering all three chromosome groups (2n = 26, 32, and 64). This database showcases a total of 352 471 genes, including 6026 related to lipid metabolism and 17 625 transcription factors within Sesamum. Equipped with an array of bioinformatics tools such as BLAST (basic local alignment search tool) and JBrowse (the Javascript browser), SesamumGDB facilitates data downloading, screening, visualization, and analysis. As the first centralized Sesamum genome database, SesamumGDB offers extensive insights into the genomics and genetics of sesame, potentially enhancing the molecular breeding of sesame and other oilseed crops in the future. Database URL: http://www.sgbdb.com/sgdb/., (© The Author(s) 2024. Published by Oxford University Press.)