Search

von Willebrand disease (VWD) is the common bleeding disorder with a clinically relevant bleeding prevalence of 1:10,000. von Willebrand disease patients lack both von Willebrand factor (VWF) and factor VIII (FVIII), which are critical for normal haemostasis. The conventional treatment for VWD includes desmopressin and replacement therapy with plasma derived FVIII with VWF concentrates or recombinant VWF. Development of alloantibodies is a rare occurrence, there is a paucity in the literature of treatment modalities in these patients. Not many reports are available in literature on the efficacy of emicizumab in VWD patients with or without alloantibodies to VWF.To do systematic review of literature on emicizumab in VWD and report our experience of emicizumab in two patients of VWD METHODS: We used electronic search engines till May 2021 in 'Google scholar' and 'PubMed', to collect the case reports or case series on use of emicizumab for management of VWD. Two of our severe VWD patients were successfully treated with emicizumab. A systematic review was performed and the results discussed.The electronic search revealed six case reports using emicizumab for treatment of VWD. Two were in vitro studies and four in patients with VWD type 3 disease. In vitro studies and in VWD patients on emicizumab, showed improvement in thrombin generation and fibrin formation. Among four patients, three had alloantibodies to VWD and one was negative. All these patients were treated with emicizumab for 6-12 m. After starting emicizumab, none of them had spontaneous bleeding requiring treatment. During treatment with emicizumab, one patient had trauma-associated soft tissue hematoma, which was treated with rFVIIa and another patient had bleeding following dental exfoliation treated with Humate P. We treated two of our VWD patients one with and one without inhibitors with emicizumab after failure of other therapies. Both the patients showed marked improvement and continued to remain well and free of bleeding episodes. None of the patients had any thrombosis or thrombotic microangiopathy (TMA) during treatment with emicizumab.In conclusion, this review supports the safety and efficacy of emicizumab in type 3 VWD patients with or without alloantibodies. Further large studies are required to confirm the safety and efficacy of emicizumab in VWD.

BACKGROUND The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. OBJECTIVE In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. METHOD A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. RESULTS Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P

Cerebral venous thrombosis (CVT) is an uncommon neurological disease with high morbidity and mortality. Even after extensive thrombophilia screening, majority of the thrombosis cases remain with unknown etiology. Hypofibrinolysis due to acquired or congenital deficiencies or abnormalities in factors in the fibrinolytic cascade is a known cause of thrombosis at any site. In the present study 104 cases of radiologically confirmed CVT cases were investigated for the conventional thrombophilia along with factors in the fibrinolytic cascade to find a possible etiology for the clinical manifestation. Conventional thrombophilia markers which included PC, PS, AT and FVL mutation were detected in 16.3% of the patients. Approximately 19% cases had grossly elevated plasma PAI-1 levels. PAI-1 4G/4G genotype was found to be strongly associated with high PAI-1 levels. 2.9% cases had reduced tPA levels, 1.9% had plasminogen deficiency and 1.9% cases had increased alpha-2-antiplasmin levels. Along with conventional thrombophilia, dysfunctional fibrinolysis is found to be strongly associated with CVT. Understanding the role of risk factors is important for appropriate treatment of this serious disorder.

BACKGROUND Thrombotic thrombocytopenia purpura (TTP) is a rare and life-threatening thrombotic microangiopathy characterized by thrombocytopenia and microangiopathic hemolytic anemia. It is caused by deficiency of ADAMTS13 metalloprotease, which cleaves ultra-large von Willebrand factor into smaller functional units. TTP may be congenital or acquired, and the congenital form is caused by inherited mutations in the ADAMTS13 gene, leading to deficiency of protein or reduced protein activity. CASE REPORT We report a 5-year-old male patient who manifested with thrombocytopenia and microangiopathic hemolytic anemia at the age of 1 year. CONCLUSION ADAMTS13 activity in the patient was below 5%, and ADAMTS13 antibody was absent. Subsequent genetic analysis of the ADAMTS13 gene revealed a novel homozygous mutation (i.e., frameshift insertion mutation A237GfsX153 [c.708_709insG] in Exon 7 of ADAMTS13). Both parents were heterozygous for this mutation.

A 40 year old female presented with branch retinal vein occlusion in the right eye followed by a second episode, a year later, of central retinal vein occlusion in the left eye. The patient was found to be heterozygous for factor V Leiden and factor V HR2 haplotype G5380A. She had a history of use of oral contraceptives, had reduced levels of tissue plasminogen activator, positive for lupus anticoagulant and diagnosed with hypertension post second episode of RVO. Presence of both heritable and acquired thrombophilia along with hypofibrinolysis induced by reduced levels of tissue plasminogen activator might have led to the recurrence of retinal vein occlusion in this patient. This case illustrates the contribution of multiple hereditary and acquired risk factors in the clinical manifestation of recurrent retinal vein occlusion thereby warranting the application of a more thorough work-up in such cases. The case also briefly touches on the fact that treatment for every RVO cannot be the same and should be decided by taking into consideration the associated risk factors.

Dear Editor, The human von Willebrand factor gene (VWF) is located on the short arm of chromosome 12 and spans approximately 178 kb, comprising of 52 exons. The mRNA has a length of 8.7 kb coding for precursor protein of 2813 amino acids that includes a 22 amino acid signal peptide, a pro-peptide of 741 amino acids and a mature subunit of 2050 amino acids [1]. The gene is highly polymorphic with more than 2000 polymorphisms reported in different ethnic populations [2]. Single nucleotide variations (SNVs) contribute to normal phenotypic variations and diseases as well. A chance combination of two SNVs in a single codon changing the nature of the mutation though uncommon, yet higher prevalence of the variant alleles across populations, makes such a deleterious combination possible resulting in the disease phenotype. We report here a severe VWD patient (VWF TGA) by the presence of two heterozygous changes (c.2878C>T, rs370984712; c.2880G>A, rs1800380) in the same codon. The single change c.2878C>T results in a variant (p.R960W), while c.2880G>A results in a synonymous change (p.R960=). The effect of SNV c.2878C>T on the function of VWF is unclear though it has been reported as a polymorphism in the single nucleotide polymorphism database (NCBI dbSNP. NM_000552.3); the prediction softwares however showed the effect of this change as deleterious. Only one such case has been reported earlier wherein the patient was found to have two mutations, i.e., a partial deletion extending the whole gene, i.e., exons 1–52 in heterozygous condition and R960* in homozygous condition, though the details of the second mutation are not discussed in this report [4]. The allelic frequencies of c.2880G>A are quite high varying between 0 and 32 % in different populations, while the frequency of c.2878C>T has been reported to be quite low, i.e., 0.05 % (http://asia.ensembl.org/Homo_sapiens/Info/ Index). One limitation here is that the parents were unavailable for mutation studies, but it is logical to presume that both the variants were in cis position, as the whole gene was sequenced and the patient was found to carry only two single nucleotide variations in heterozygous state. In conclusion, we report an interesting mechanism of two single nucleotide variations occurring together in cis in a single codon changing the nature of the pathogenic mutation. In the presence of the first variant, it would have been a missense variant, probably pathogenic, but the coexistence of a second SNV has changed the nature of the mutation, i.e., from a missense to a premature termination codon mutation. The two SNVs are mutually * Shrimati Shetty shrimatishetty@yahoo.com

Erratum to: Annals of Hematology 91(6): 917–921. DOI 10.1007/s00277-011-1390-1 . The authors inadvertently omitted 2 fellow authors from the author list: Dr. Diego Butera should be listed as the fourth author. His affiliation is Lowy Cancer Research Centre and Prince of Wales Clinical School, University of New South Wales, Sydney, NSW, Australia. His contributions are as follows: Designed, synthesized and produced EcAPv. He has no competing interests to declare. Dr. Geraldo S. Magalhaes should be listed as the fifth author. His affiliation is Laboratory of Immunopathology, Butantan Institute, Sao Paulo, SP, Brazil. His contributions are as follows: Produced more EcAPv when requested in October 2009. He has no competing interests to declare.

Sir, Isolated coagulation factor V (FV) deficiency (parahaemphilia) is a rare autosomal recessive bleeding disorder affecting both sexes with a prevalence of about one in one million1. Patients with FV deficiency exhibit mild to severe bleeding symptoms with clinical manifestations ranging from ecchymosis, menorrhagia, epistaxis to haemarthrosis and intracranial bleeds1,2. The factor V (F5) gene is located on chromosome 1q23, spans about 80 kb and has 25 exons and 24 introns with a 7 kb mRNA which encodes a protein of 2224 amino acids. The complete F5 cDNA sequence has already been published3,4. More than 100 mutations and 700 polymorphisms have been reported in the F5 mutation database5. Among all coagulation disorders, FV deficiency is the least characterized disorder at the molecular level. Patients with FV deficiency generally exhibit a bleeding tendency of variable severity; intracranial and gastrointestinal haemorrhages, haematomas and haemarthroses are also reported in a few patients. Major phenotypic determinant in FV deficiency has been reported to be platelet FV levels6. Though the disease is rare in countries like India where consanguineous marriages are common, there is a high prevalence of autosomal recessive disorders including FV deficiency. Except one report7, there is no published study on the molecular characterization of FV deficient cases from India. Direct sequencing of the gene though accurate, is not cost-effective due to the large size of the gene and heterogeneity of mutations and is thus difficult to implement in many laboratories. Indirect method of gene tracking is an extremely simple and accurate method, when it is based on intragenic markers. However, assessing the informativeness of the marker in each population is important as there is a considerable variation in the heterozygotic frequency of these markers in different populations8,9,10. In the present study, polymorphisms in F5 were analysed in a group of healthy individuals with an objective to utilize them for genetic diagnosis in FV deficient families by direct DNA sequencing. The study was conducted at the Department of Haemostasis and Thrombosis, National Institute of Immunohaematology, Mumbai, India, including 65 unrelated healthy subjects from the Institute. After obtaining informed written consent, 10 ml blood sample was collected from each participant in EDTA and DNA was extracted from these samples using commercial kits (Invitrogen, CA, USA). PCR amplification was performed using primers designed by primers 3 and UCSC genome browser (Sigma Aldrich, India). The PCR reaction mixture consisted of 1U Taq polymerase (Bioron, Ludwigshafen, Germany), 1.5 mmol/l magnesium chloride, 1 μmol/l of the forward and reverse primers and 150 ng of DNA. The primer sequences and PCR conditions for exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms were as follows: Exon 13 (637 bp) - forward (5’-3’) TGCTGACTATGATTACCAGA, reverse (5’-3’) GAGTAACAGATCACTAGGAGG. PCR conditions: Denaturation at 94°C for 5 min followed by 35 cycles of denaturation (95°C, 40 sec), annealing (56°C, 40 sec), and extension (72°C for 40 sec) along with a final extension at 72°C for five minutes. Exon 16 (286 bp) - forward (5’-3’) GAGGCAATACAATTTACTC, reverse (5’-3’) CAGTGTGATTTAATTAGGAG. PCR conditions: Denaturation at 94°C for 5 min followed by 30 cycles of denaturation (95°C, 1 min), annealing (55°C, 2 min), extension (72°C for 1 min), followed by a final extension at 72°C for seven minutes. Amplified products were subjected to direct sequencing of the exons and the intron - exon boundaries of F5 using an ABI 3130 genetic analyzer (Applied Biosystems, USA). The study protocol was approved by the Institutional Ethics Committee. A total of 12 polymorphisms were detected, of which three showed high heterozygosity frequency in our population i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) (Table). The cumulative heterozygosity frequency of these three markers was 67.69 per cent. Table Heterozygosity frequencies of polymorphic markers of F5 During the course of the study, a family was referred from Uttar Pradesh for antenatal diagnosis in the first trimester of pregnancy. After obtaining a detailed medical and family history, blood samples of both parents and index case were collected and the chorionic villus sampling (CVS) was done at 11th weeks of pregnancy in the mother. DNA from blood samples and CVS was isolated using commercial kits (Invitrogen, USA) and subjected to gene tracking analysis by direct DNA sequencing technique using the above three markers i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms. The diagnosis could be successfully offered to this family using exon 13 A2663G (K830R) polymorphism. The family was non-informative for exon 13 A2684G (H837R) and exon 16 A5380G (M1736V) markers. As the mother was homozygous for this marker, the foetus is either normal or a carrier of the mutation. Thus the diagnosis of an ‘unaffected’ foetus was offered. The child was subsequently followed up after delivery and was found to be normal for factor V levels with a normal genotype. The present study shows that these three markers can successfully be used in carrier diagnosis and prenatal diagnosis in majority of the FV deficient families in India. Due to the high cost involved in direct DNA or mRNA analysis involved in mutation detection, indirect linkage analysis using such highly informative polymorphic markers may be considered as the method of choice for genetic diagnosis in developing countries.