Search

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting., (© 2024. The Author(s).)

Significance: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence., Purpose: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases., Case Reports: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism., Conclusions: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations., Competing Interests: Conflict of Interest Disclosure: None of the authors have reported a financial conflict of interest., (Copyright © 2024 American Academy of Optometry.)

Introduction: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations., Methods: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed., Results: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease., Conclusion: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis., (© 2023 The Author(s). Published by S. Karger AG, Basel.)

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation., Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143 . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations., Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia., Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes., (Copyright © 2023 Molecular Vision.)

Background: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA., Materials and Methods: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A ), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development., Results: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2., Conclusions: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.

Background: Albinism is a group of genetic disorders characterized by general skin and retinal hypopigmentation. It is in most cases an autosomal recessive condition. Foveal hypoplasia (FH) is one of the main criteria for the diagnosis of albinism. The aim of this study was to analyze the macular profile of the parents of patients with albinism., Methods: This study included a case series of 27 patients with albinism seen in Rothschild Foundation between April 2017 and February 2020. Spectral-domain optical coherence tomography (SD-OCT) and OCT angiography (OCT-A) were performed in every patient when possible and in every available parents. FH was graded according to Thomas' classification based on OCT. Next generation sequencing-based gene panel testing was performed in parents and children when a FH was detected on OCT in a parent., Results: Twenty-seven patients with albinism were examined. Nine parents had FH based on the OCT B-scan (33%). In parents without FH based on the SD-OCT B-scan (67%), OCT-A showed a reduced avascular zone in the deep vascular plexus in 4 parents. Six parents carried variants that could explain their phenotype, including TYR R402Q hypomorphic alleles., Conclusion: This study showed the presence of FH in parents of patients with albinism, and aimed to genetically explain this phenotype.

This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [ Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.] .

Purpose: To study the retinal and choroidal thickness variations on enhanced depth imaging optical coherence tomography scans in ocular albinism (OA) and compare with age-matched healthy subjects., Methods: This retrospective observational study had 48 eyes of 24 patients diagnosed clinically as OA and age, sex, and axial length-matched control healthy subjects. All patients underwent detailed ophthalmic examination and a single-line horizontal-raster enhanced depth imaging - optical coherence tomography scan (Spectralis, Heidelberg Engineering). Retinal and choroidal thickness was measured, compared, and analyzed between the two groups. Mann-Whitney U test was used for analysis between the two groups. P < 0.05 was considered significant., Results: The mean age was 28.3 ± 11.6 and 29.9 ± 10.6 years in the OA group and control group, respectively. Spherical equivalents ranged from -8.5D to +10.5D in the OA group and from -8.0D to +10.0D in the control group. The mean axial length between the two groups (P = 0.652) were comparable. The average retinal thickness (272 ± 34.3 vs. 213 ± 13.8 μm; P < 0.001) was greater in the OA group as compared to controls. The mean choroidal thickness (184 ± 78.4 vs. 287 ± 46.4 μm; P < 0.001) was significantly thinner in the OA group., Conclusion: Acquisition of OCT scans in OA can be challenging. This study showed that the subfoveal retinal thickness and choroidal thickness measured across the scans were significantly different in the OA group compared to controls. In the future, more studies are required to evaluate the role of the choroid and its relationship to emmetropization in albinism., Competing Interests: None

Purpose: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH)., Design: Multicenter, observational study., Participants: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384)., Methods: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans., Main Outcome Measures: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA)., Results: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH., Conclusions: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value., (Copyright © 2022 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.)