Search

Ephedrine (EPH) and cocaine (COC) are illegal stimulant drugs, and have been frequently detected in aquatic environments. EPH and COC have negative effects on the nervous system and cause abnormal behaviors in mammals and fish at high concentrations, but their mechanisms of neurotoxicity remain unclear in larvae fish at low concentrations. To address this issue, zebrafish embryos were exposed to EPH and COC for 14 days post-fertilization (dpf) at 10, 100, and 1000 ng L -1 . The bioaccumulation, development, behavior, cell neurotransmitter levels and apoptosis were detected to investigate the developmental neurotoxicity (DNT) of EPH and COC. The results showed that EPH decreased heart rate, while COC increased heart rate. EPH caused cell apoptosis in the brain by AO staining. In addition, behavior analysis indicated that EPH and COC affected spontaneous movement, touch-response, swimming activity and anxiety-like behaviors. EPH and COC altered the levels of the neurotransmitters dopamine (DA) and γ-aminobutyric acid (GABA) with changes of the transcription of genes related to the DA and GABA pathways. These findings indicated that EPH and COC had noticeable DNT in the early stage of zebrafish at environmentally relevant concentrations., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Ephedra sinica is one of the most famous Chinese medicinal plants. The insufficient supply of wild resources has led to the increased use of cultivated products. However, the related medicinal quality differs significantly. Although the influence of external environment on the quality of E. sinica has been studied, the impact of endophytic microbes on it remains vague. This study characterized differential metabolites and microbial community compositions in wild and cultivated E. sinica by combining metabolomics with microbiomics, and explored the effect of endophytes on the formation of differential metabolites further. The results showed that the difference in quality between wild and cultivated E. sinica was mainly in the productions of alkaloids, flavonoids, and terpenoids. The associated endophytes had special compositional characteristics. For instance, the distribution and abundance of dominant endophytes varied between wild and cultivated E. sinica. Several endophytes had significant or highly significant correlations with the formations of ephedrine, pseudoephedrine, D-cathinone, methcathinone, coumarin, kaempferol, rhamnetin, or phenylacetic acid. This study will deepen our understanding of the plant-endophyte interactions and provide a strategy for the quality control of E. sinica products., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Purpose: It was aimed to investigate the biochemical and immunohistochemical effects of ephedrine (EPH) in bilateral ovariectomized rats., Methods: Twenty-four Sprague Dawley female rats were divided into three groups: control group: The abdomen was opened and closed without any treatment; ischemia-reperfusion (IR) group: 2 h of ischemia followed by 2 h of reperfusion were allowed to cause IR injury; IR+EPH group: oral EPH solution (5 mg/kg) was administered for 28 days., Results: Biochemical parameters were statistically significant in group comparisons. Increased interleukin-6 (IL-6) expression, degenerative preantral and antral follicle cells and inflammatory cells around blood vessels were seen in IR group. Negative IL-6 expression was observed in seminal epithelial cells, preantral and antral follicle cells in IR+EPH group. While caspase-3 activity increased in granulosa cells and stromal cells in IR group, caspase-3 expression was negative in preantral and antral follicle cells in the germinal epithelium and cortex in IR+EPH group., Conclusions: The effect of apoptosis, which occurs with the signaling that starts in the cell nucleus, caused the cessation of the stimulating effect at the nuclear level after EPH administration, and a decrease in the antioxidative effect in IR damage and inflammation in the apoptotic process.

Most drugs, especially those with acidic or neutral moieties, are bound to the plasma protein albumin, whereas basic drugs are preferentially bound to human alpha-1-acid glycoprotein (AGP). The protein binding of the long-established drugs ephedrine and pseudoephedrine, which are used in the treatment of hypotension and colds, has so far only been studied with albumin. Since in a previous study a stereoselective binding of ephedrine and pseudoephedrine to serum but not to albumin was observed, the aim of this study was to check whether the enantioselective binding behavior of ephedrine and pseudoephedrine, in addition to the derivatives methylephedrine and norephedrine, is due to AGP and to investigate the influence of their different substituents and steric arrangement. Discontinuous ultrafiltration was used for the determination of protein binding. Characterization of ligand-protein interactions of the drugs was obtained by saturation transfer difference nuclear magnetic resonance spectroscopy. Docking experiments were performed to analyze possible ligand-protein interactions. The more basic the ephedrine derivative is, the higher is the affinity to AGP. There was no significant difference in the binding properties between the individual enantiomers and the diastereomers of ephedrine and pseudoephedrine., Competing Interests: Conflict of Interests None of the authors of this paper does have a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper., (Copyright © 2022. Published by Elsevier B.V.)

Mast cells (MCs) play an important role in allergies, leading to the development of MC-targeted therapies. Ephedra herb (Mao) has potent anti-allergic activity, but contains ephedrine alkaloids (EAs); therefore, its hazardous effects are taken into consideration during its clinical use. We previously reported that Mao attenuates robust MC degranulation by an allergen through high-affinity immunoglobulin E (IgE) receptor (FcεRI) internalization, in which an EA-independent mechanism was suggested to be at play. This study aimed to deepen our understanding of the potential of Mao against FcεRI internalization using two strains with different EA contents. Mao extracts were administered to bone marrow-derived MCs (BMMCs), and their cellular responses, including FcεRI internalization, were analyzed. In addition, physiological events were evaluated using a passive cutaneous anaphylactic (PCA) reaction mouse model. BMMCs mediate the production of diverse inflammatory mediators. Among these, the potent chemokine CCL2 is thought to be differentially regulated from other pro-inflammatory mediators. We found that Mao significantly induces CCL2 expression in BMMCs despite suppressing robust degranulation through FcεRI internalization. Importantly, this was a distinctly EAs-independent response. In the PCA reaction, local MC activation following allergen challenge was suppressed by Mao treatment, which strengthened the view that Mao sufficiently decreased the rapid activation of MCs and promoted CCL2 secretion. Collectively, these observations provide additional insights into the mechanism of Mao-induced silent FcεRI internalization in MCs and the complex and heterogeneous secretory responses operating in MCs.

Objective: We investigated the protective effects of ephedra herb (HEPH) on adriamycin-induced testicular toxicity in rats and explored the potential mechanisms underlying these effects., Methods: A rat model of adriamycin injury was established, and sperm motility-related indicator and oxidative stress levels in the testis were evaluated. Serum levels of sex hormones and levels of testicular cell apoptosis were detected by enzyme-linked immunosorbent assay and flow cytometry, respectively. Western blotting (WB), immunofluorescence analyses, and reverse transcription-polymerase chain reaction (RT-PCR) were performed to evaluate the gonadotropin-releasing hormone (GnRH) signalling pathway- and meiosis-related genes and proteins. In subsequent in vitro experiments, adriamycin was used to stimulate GC-1 cells, which were treated with HEPH, ephedrine, or pseudoephedrine. Cell viability was assessed using flow cytometry to detect apoptosis and reactive oxygen species, whereas the GnRH signalling pathway and levels of meiosis-related genes and proteins were evaluated by InCell WB, a high-content imaging system, and RT-PCR., Results: Per in vivo experiments, HEPH restored testicular weight and function, sperm characteristics, serum and tissue hormonal levels, and antioxidant defences and significantly activated the GnRH signalling pathway- and meiosis-related protein levels. All protective effects of HEPH against adriamycin-induced injury were antagonised by the GnRH antagonist cetrorelix. In vitro, HEPH, ephedrine, and pseudoephedrine significantly reduced adriamycin-induced GC-1 cell apoptosis and reactive oxygen species levels and increased the expression of GnRH signalling pathway- and meiosis-related proteins. The effect of pseudoephedrine was greater than that of ephedrine, and these findings may be an important basis for understanding the effects of HEPH., (Copyright © 2022 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra -containing products.