Search

Safety assessment approaches of novel food, currently adopted in the Russian Federation, imply mandatory in vivo reproductive toxicity tests with the study of reproductive function and offspring development in order to obtain comprehensive evidence of the absence of distant adverse effects that may manifest only in the next generation. Comprehensive study of reproductive function, pre- and postnatal offspring development, as a rule, includes the research of a large number of parameters, all of which has a wide range of physiological fluctuations, and the heterogeneous distribution of some parameters' values complicates the interpretation of the results. The purpose of the study was to investigate the efficiency of a reduced adaptive potential model in rats, based on decreased diet protein intake, for the use in reproductive toxicity experiments. Material and methods . The research lasting 155 days was carried out on rats of F0 (180 females and 90 males) and F1 (773 pups, 456 fetuses) generations. Animals of parental generation F0 were divided into 3 groups - control, the 1st and the 2nd test groups, 30 males and 60 females in each. The initial age of F0 rats was 28-35 days. Animals of all groups during growth and sexual maturation (25-90 days of life) received a diet with reduced protein content (9.4 g per 100 g of diet, which is 9% in calorie value). After reaching the age of physiological maturity (100 days) rats were transferred to a diet with lower protein content (6.1 g per 100 g of diet, 6% in calorie value), and received this diet during mating, pregnancy and feeding of F1 offspring. The rats of the test groups received with feed the model herbicide glyphosate (isopropylamine salt, concentration 360 g/l) at a dose of 0.3 g/kg body weight (6% of LD50): the 1st test group - from day 70 of life, the 2nd test group - from day 30 of life throughout the duration of the experiment. Reproductive function was evaluated by the fertility of F0 animals and by the character of prenatal and postnatal development of F1 offspring. Results . The toxic factor's influence on the background of reduced protein supply did not lead to complex changes in the reproductive function of rats, the test groups differed from the control group only by the post-implantation loss and the mean litter size in the postnatal period: post-implantation loss in the 1st and the 2nd test groups was higher than normal, exceeding the value of this indicator in the control group (4.7±1.6%) by 3.1 (p<0.05) и 2.2 (р>0.05) times; the mean litter size in the 1st and the 2nd test groups was by 15.8 and 21.3% (р<0.05) lower than in the control group. Survival rate of offspring during the 1st month of life in all groups was at least 72%, which corresponds to the lower limit of the norm characteristic for Wistar rats. Conclusion . The use of the alimentary model of adaptation potential reduction based on diet protein deficiency does not consider appropriate in reproductive toxicity studies, since it does not increase either the severity of the reaction to toxic effects or the reliability of the results obtained. This model can be recommended for subacute toxicological studies of low-toxicity objects, in particular, when assessing the safety of novel food., Competing Interests: The author declares no conflicts of interest., (Copyright© GEOTAR-Media Publishing Group.)

A promising growth vector of food protein production in the context of the Russian Federation's food sovereignty security is the use of microbial synthesis. Taking into consideration the proven promising use of biotechnological processes in the production of alternative protein sources, modern scientific research is focused, among other issues, on improving the technology of obtaining food microbial protein using a variety of substrates and strains-producers, as well as evaluating the consumer properties, food, biological value and safety of such products. The purpose of the research was to study and comparatively evaluate protein concentrate (PC) from bacteria Methylococcus capsulatus and basic food of animal and plant origin within the development of the technology of optimal in nutritional and biological value PC production. Material and methods . Analysis of the nutritional and biological value of PC obtained from denucleinized and purified from cell walls biomass of methanoxidizing bacteria Methylococcus capsulatus (strain GSB-15) was carried out on 46 indicators, including estimation of protein content and amino acid composition, fat content and fatty acid composition, ash and moisture. Biological studies based on measuring of net protein ratio / net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of PC protein. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Results . The nutritional value study of PC showed high protein content - 69.0%, the share of fat, moisture and ash, accounted for 0.17, 9.5 and 14.4%, respectively. The carbohydrate content was 7.0% (of which mono- and disaccharides were <0.1%). The results of a comparative assessment of Methylococcus capsulatus protein amino acid profile and basic food of animal and plant origin showed a balanced content of the most amino acids, the level of which is comparable with the protein of chicken egg, which is traditionally a standard of quality of complete protein. At the same time, the content of the essential amino acid tryptophan in PC was an order of magnitude lower than in chicken egg protein; the content of this amino acid in PC is comparable with incomplete plant proteins (sunflower, flax, rapeseed). The results of the biological value evaluation of the Methylococcus capsulatus protein in the experiment on rats indicate a relatively low biological value of the microbial synthesis protein, that is caused, most likely, by tryptophan deficiency. Rats of the test group had a significant decrease in body weight gain, feed/protein intake, coefficient of protein efficiency ratio, coefficient of net protein ratio, true protein biological value, true net protein utilization. Conclusion . The results of a comparative evaluation of PC from methanotrophic bacteria Methylococcus capsulatus denucleinized biomass and basic food of animal and plant origin indicate its relatively high nutritional value. However, the characteristics of this PC sample were not optimal in regard of protein biological value by reason of tryptophan deficiency. A single amino acid deficiency is not a valid argument for not using microbially synthesized protein in human nutrition, considering the capabilities of the modern food industry, including ways to enrich foodstuffs with missing components. In addition, there is every cause to believe that adjusting the hydrolysis technology used in the production of PC will allow to eliminate the essential amino acid loss, thereby increasing the biological value of this product., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

Liver morphology, intensity of apoptosis, and activity of xenobiotic metabolism enzymes were studied in a chronic model experiment in rats receiving a mixture of 6 pesticides against the background of life-long diets with adequate and insufficient supply of water-soluble vitamins. The dose of each pesticide in the mixture did not exceed the acceptable daily intake (1 ADI). It was found that chronic exposure to low doses of anthropogenic toxicants in combination with permanent vitamin deficiency provokes a number of liver changes, such as increased apoptosis activity, cytochrome P450 system depletion, steatosis, and inflammatory infiltration, which is a potential health risk factor., (© 2023. Springer Science+Business Media, LLC, part of Springer Nature.)

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods . Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion . The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion . A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)