Search

Osteoarthritis (OA) pathogenesis involves inflammation, age, weight and other factors. Integrin-linked kinase (ILK) regulates cell apoptosis, metastasis, and growth. However, whether ILK affects bone formation of bone marrow mesenchymal stem cells in an inflammatory environment has not been elucidated. Rat BMSCs were isolated and assigned into control group, inflammation group (lipopolysaccharide was added to cells); and si-ILK group (ILK siRNA was transfected into the inflammation group BMSCs) followed by analysis of cell proliferation by MTT assay, expression of ILK, Runx2 and OP by real time PCR, ALp activity, TNF-α and IL-6 secretion by ELISA and MAPK/AKT signaling protein expression by western blot. Compared to control, ILK in BMSCs cells in inflammatory environment was significantly upregulated, resulting in inhibition of cell proliferation, decreased ALP activity, reduced expression of osteogenic genes Runx2 and OP, increased secretion of TNF-α and IL-6, and downregulated p-AKT (P < 0.05); transfection of ILK siRNA down-regulated ILK in inflammatory environment BMSCs, which significantly increased BMSCs cell proliferation, increased ALP activity and expression of Runx2 and OP, decreased TNF-α and IL-6 secretion and increased p-AKT expression (P < 0.05). ILK expression is increased in BMSCs in an inflammatory environment. Down-regulation of ILK in BMSCs cells in an inflammatory environment can regulate MAPK/AKT signaling, inhibit inflammatory factors secretion, thereby promoting BMSCs proliferation and osteogenesis differentiation.

Enzymatic reaction, as an environmentally friendly approach, has made great progress producing commodity chemicals comparing to the conventional metallo/organo catalysis. However, the reaction compatibility is not satisfactory. The development of biomimetic catalysis balancing both strategies for the green and broad application in synthesis is desirable. Here, we report the design and synthesis of a chiral diamine catalyst fulfilling this requirement. Asymmetric addition reactions using this ligand in water were demonstrated and the corresponding products were produced in excellent yields and enantiomeric ratios. This pluripotent ligand has also shown good reactivity/enantioselectivity on a number of representative reactions in both green and organic solvents. We anticipate that the ligand would allow further development of other catalysts for important yet challenging green stereoselective transformations.

We report our latest discovery of norbornene derivative modulated highly mono-selective ortho-C-H activation alkylation reactions on arenes bearing simple mono-dentate coordinating groups. The reaction features the use of readily available benzamides and alkyl halides. During the study, we prepared 30 mono-alkylated aryl amides in good yields with good mono-selectivity. We have also demonstrated that structurally rigid alkenes such as norbornene and its derivatives are a good class of ligand and could be used for future direct C-H functionalizations. The utilization of norbornene type ligands for assistance in C-H activation processes has opened a new window for future molecular design using direct C-H functionalization strategies.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Coniothyrium minitans is an important biocontrol agent against Sclerotinia diseases. Previously, a conidiation-deficient mutant ZS-1T1000 was screened out from a T-DNA insertional library of C. minitans. CmBCK1, encoding MAP kinase kinase kinase and homologous to BCK1 of Saccharomyces cerevisiae, was disrupted by T-DNA insertion in this mutant. Targeted disruption of CmBCK1 led to the mutants undergoing autolysis and displaying hypersensitivity to the cell wall-degrading enzymes. The △CmBCK1 mutants lost the ability to produce pycnidia and conidia compared to the wild-type strain ZS-1. △CmBCK1 mutants could grow on the surface of sclerotia of Sclerotinia sclerotiorum but not form conidia, which resulted in much lower ability to reduce the viability of sclerotia of S. sclerotiorum. Furthermore, CmSlt2, a homolog of Slt2 encoding cell wall integrity-related MAP kinase and up-regulated by BCK1 in S. cerevisiae, was identified and targeted disrupted. The △CmSlt2 mutants had a similar phenotype to the △CmBCK1 mutants. The △CmSlt2 mutants also had autolytic aerial hyphae, hypersensitivity to cell wall-degrading enzymes, lack of conidiation and reduction of sclerotial mycoparasitism. Taken together, our results suggest that CmBCK1 and CmSlt2 are involved in conidiation and the hyperparasitic activities of C. minitans.

Fusarium wilt caused by Fusarium oxysporum f. sp. niveum (Fon) is one of the major limiting factors for watermelon production worldwide. Rapid and accurate detection of the causal pathogen is the cornerstone of integrated disease management. In this paper, a real-time fluorescence loop-mediated isothermal amplification (RealAmp) assay was developed for the rapid and quantitative detection of Fon in soil. Positive products were amplified only from Fon isolates and not from any other species or formae speciales of F. oxysporum tested, showing a high specificity of the primer sets. The detection limit of the RealAmp assay was 1.2 pg μL(-1) genomic DNA or 10(3) spores g(-1) of artificially inoculated soil, whereas real-time PCR could detect as low as 12 fg μL(-1) or 10(2) spores g(-1). The RealAmp assay was further applied to detect eight artificially inoculated and 85 field soil samples. No significant differences were found between the results tested by the RealAmp and real-time PCR assays. The RealAmp assay is a simple, rapid and effective technique for the quantitative detection and monitoring of Fon in soil under natural conditions.