Search

Ferroptosis, a recently identified form of regulated cell death, is characterized by lipid peroxidation and iron accumulation, plays a critical role in early brain injury after subarachnoid hemorrhage. Ginsenoside Rd, an active compound isolated from ginseng, is known for its neuroprotective properties. However, its influence on SAH-induced ferroptosis remains unclear. In this study, we constructed an SAH model using intravascular perforation in vivo and treated HT22 cells with oxyhemoglobin to simulate the condition in vitro. We observed significant changes in ferroptosis markers, including GPX4 and ACSL4, following SAH. Administration of ginsenoside Rd to both rats and HT22 cells effectively inhibited neuronal ferroptosis induced by SAH, alleviating neurological deficits and cognitive dysfunction in rats. Notably, the neuroprotective properties of ginsenoside Rd were countered by the STING pathway agonist 2'3'-cGAMP. Experiments conducted in vitro and in vivo illustrated that the impacts of ginsenoside Rd were counteracted by the BQR inhibitor. Our findings suggest that ginsenoside Rd mitigates EBI after SAH by suppressing neuronal ferroptosis through the cGAS/STING pathway while upregulating DHODH levels. These outcomes emphasize the potential of ginsenoside Rd as a therapeutic candidate for subarachnoid hemorrhage., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Cheng Gao reports financial support was provided by First Affiliated Hospital of Harbin Medical University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2025 Elsevier Inc. All rights reserved.)

Down syndrome (DS), caused by trisomy 21, is characterized by intellectual disability and accelerated aging, with chronic oxidative stress contributing to neurological deficits. REST (Repressor Element-1 Silencing Transcription factor), a crucial regulator of neuronal gene expression implicated in DS neuropathology. This study investigates the neuroprotective potential of lithium, a mood stabilizer with known cognitive-enhancing effects, in restoring levels of REST. Using three pairs of human disomic and trisomic DS induced pluripotent stem cell (iPSC) isogenic lines, we differentiated neurons and treated them with lithium. Nuclear REST expression and reactive oxygen species (ROS) levels were quantified. Results showed the significantly lower nuclear REST expression in DS neurons was restored after 24 h of 10 mM lithium carbonate treatment. Notably, lithium treatment selectively reduced ROS levels in DS neurons to near-baseline levels. When challenged with hydrogen peroxide, DS neurons exhibited increased vulnerability to oxidative stress. The lithium treatment also significantly reduced ROS levels in the stressed control neurons. These findings reveal a positive association between lithium treatment, REST restoration, and oxidative stress reduction, suggesting that repurposing lithium could contribute to developing therapeutic strategies for DS neuropathologies. This study provides novel insights into DS molecular mechanisms and highlights the potential of lithium as a targeted intervention for improving neuronal function in DS., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2025 International Brain Research Organization (IBRO). Published by Elsevier Inc. All rights reserved.)

The occurrence and progression of traumatic brain injury involve a complex process. The pathophysiological mechanisms triggered by neuronal damage include various forms of programmed cell death, including ferroptosis. We observed upregulation of TNFAIP3 in mice after traumatic brain injury. Overexpression of TNFAIP3 inhibits HT-22 proliferation and cell viability through ferroptosis. Mechanistically, TNFAIP3 interacts with the HMOX1 protein and promotes its stability through the deubiquitination pathway. Additionally, TNFAIP3 can enhance lipoperoxidation, mitochondrial damage, and neuronal cell death by promoting ACSL3 degradation via NEDD4-mediated ubiquitination. Mice injected with AAV-shTNFAIP3 exhibited reduced neuronal degeneration and improved motor and cognitive function following cortical impact injury. In conclusion, our findings demonstrate that TNFAIP3 deficiency inhibits neuronal cell ferroptosis and ameliorates cognitive impairment caused by traumatic brain injury and demonstrate its potential applicability in the treatment of traumatic brain injury., Competing Interests: Declaration of competing interest The authors declare no potential conflicts of interest., (Copyright © 2024. Published by Elsevier Inc.)

The experiment was designed to explore the effects and mechanism of Dilong on alleviating cyclophosphamide (CTX)-induced brain injury in mice. Fifty male SPF Kunming mice aged 6-8 weeks were randomly divided into five groups: Group A served as the control group; Group B received intraperitoneal injection of CTX; Groups C, D, and E were administered Dilong at doses of 100, 200, and 400 mg/kg respectively for 14 days after intraperitoneal injection of CTX. Results showed that after modeling, the movement speed of mice significantly decreased (P < 0.05), and the number of neurons in the hippocampus and cortex decreased. Dilong can mitigate the behavioral abnormalities and reduction of brain neuronal cells caused by CTX. CTX had no significant effect on the number of astrocytes, microglia, and microglia M1 and M2 polarization, but it had a significant damaging effect on neuronal cells (P < 0.05). The mechanism of action is that CTX causes a decrease in cellular mitochondrial respiratory enzyme activity (P < 0.05) and abnormal mitochondrial structure, which leads to the activation of the cellular scorching pathway. Dilong significantly increased mitochondrial respiratory enzyme activity (P < 0.05), and the mitochondrial structure was restored to some extent. By significantly reducing NLRP3/TLR4/caspase1/pro caspase1/GSDMD (P < 0.05), it increased neuronal cell survival. This resulted in an increase in neuronal cell survival, thus exerting a protective effect on the brain., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 International Brain Research Organization (IBRO). Published by Elsevier Inc. All rights reserved.)

In this special issue to celebrate the 30th anniversary of the Uruguayan Society for Neuroscience (SNU), we find it pertinent to highlight that research on glial cells in Uruguay began almost alongside the history of SNU and contributed to the understanding of neuron-glia interactions within the international scientific community. Glial cells, particularly astrocytes, traditionally regarded as supportive components in the central nervous system (CNS), undergo notable morphological and functional alterations in response to neuronal damage, a phenomenon referred to as glial reactivity. Among the myriad functions of astrocytes, metabolic support holds significant relevance for neuronal function, given the high energy demand of the nervous system. Although astrocytes are typically considered to exhibit low mitochondrial respiratory chain activity, they possess a noteworthy mitochondrial network. Interestingly, both the morphology and activity of these organelles change following glial reactivity. Despite receiving less attention compared to studies on neuronal mitochondria, recent studies indicate that mitochondria play a crucial role in driving the transition of astrocytes from a quiescent to a reactive state in various neurological disorders. Notably, stimulating mitochondria in astrocytes has been shown to reduce damage associated with the neurodegenerative disease amyotrophic lateral sclerosis. Here, we focus on studies supporting the emerging paradigm that metabolic reprogramming occurs in astrocytes following damage, which is associated with their phenotypic shift to a new functional state that significantly influences the progression of pathology. Thus, exploring mitochondrial activity and metabolic reprogramming within glial cells may provide valuable insights for developing innovative therapeutic approaches to mitigate neuronal damage. In this review, we focus on studies supporting the emerging paradigm that metabolic reprogramming occurs in astrocytes following damage, which is associated with their phenotypic shift to a new functional state that significantly influences the progression of pathology. Thus, exploring mitochondrial activity and metabolic reprogramming within glial cells may provide valuable insights for developing innovative therapeutic approaches to mitigate neuronal damage., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Inc.)

Traumatic brain injury (TBI) remains a principal factor in neurological disorders, often resulting in significant morbidity due to secondary neuroinflammatory and oxidative stress responses. While circular RNAs are recognized for their high expression levels in the nervous system and play crucial roles in various neurological processes, their specific contributions to the pathophysiology of TBI remain underexplored. In this study, the possible molecular mechanisms through which circMETTL9 modulated oxidative stress and neurological outcomes following TBI were investigated. In vitro model of oxidative stress utilizing SH-SY5Y cells revealed that circMETTL9 knockdown significantly attenuated H₂O₂-induced reactive oxygen species (ROS) production, reduced apoptosis, and preserved mitochondrial function. Additionally, CCAR2 has been identified as a circMETTL9-binding protein by mass spectrometry and RNA immunoprecipitation, with circMETTL9 positively regulating CCAR2 expression. Meanwhile, on the basis of silencing CCAR2, it was verified that the regulation of oxidative stress in SH-SY5Y cells by circMETTL9 was mediated by CCAR2. In vivo experiments using a TBI rat model further confirmed that CCAR2 knockdown alleviated central nervous system (CNS) injury, reduced oxidative stress and apoptosis, and protected mitochondrial integrity following TBI. These findings suggest a novel mechanism by which circMETTL9 targets CCAR2 via mitochondria-mediated Bax/Bcl-2/caspase-3 signaling to regulate apoptosis. CircMETTL9 may provide a viable therapeutic target for mitigating neurological dysfunction following TBI, offering new insights into potential interventions aimed at reducing secondary brain injury., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Inc.)

Perioperative neurocognitive disorders (PND) are common complications following surgery and anesthesia, especially in the elderly. These disorders are associated with disruptions in neuronal energy metabolism and mitochondrial function. This study explores the potential of intranasal insulin administration as a therapeutic strategy to prevent PND by targeting the calcium transport protein complex IP3R/GRP75/VDAC1 on mitochondria-associated endoplasmic reticulum membranes (MAMs)., Methods: Male C57BL/6J mice underwent partial hepatectomy to induce PND and were subsequently treated with either intranasal insulin or saline. Cognitive function was evaluated using the Morris water maze test, and hippocampal tissue was analyzed for calcium transport protein complex IP3R/GRP75/VDAC1 expression and apoptosis markers. In vitro, HT22 and BV2 cell co-cultures were utilized to simulate surgical injury, with IP3R knockdown employed to assess its effects on oxidative stress and apoptosis., Results: Intranasal insulin effectively alleviated cognitive impairment as demonstrated by improved performance in the Morris water maze. It significantly reduced neuronal apoptosis and modulated the expression of the IP3R/GRP75/VDAC1 complex, enhancing mitochondrial ATP production and stabilizing MAMs. Furthermore, insulin administration also increased PI3K/AKT signaling, counteracting the impact of surgical stress. In vitro experiments confirmed that IP3R knockdown mitigated inflammation-induced oxidative stress and neuronal apoptosis, while insulin's beneficial effects were blocked by inhibition of the PI3K/AKT pathway., Conclusion: Intranasal insulin mitigates PND by modulating the IP3R/GRP75/VDAC1 complex and enhancing mitochondrial function through the PI3K/AKT signaling pathway. This study supports the potential of intranasal insulin as a promising therapeutic strategy for preventing and managing PND, potentially leading to improved surgical outcomes for elderly patients., Competing Interests: Declaration of competing interest All authors have contributed significantly to this work and approve of its submission. And all authors are in agreement with the content of the manuscript and agree to submission to CNS Neuroscience & Therapeutics. The manuscript has not been published elsewhere and is not under consideration by any other publication. We have no conflicts of interest to disclose., (Copyright © 2025 Elsevier Inc. All rights reserved.)

Dodecyl creatine ester (DCE) is a creatine prodrug currently developed for brain diseases, including creatine transporter deficiency (CTD), an incurable rare genetic disease. A dual strategy combining a prodrug to bypass the non-functional creatine transporter and its delivery via the nose-to-brain pathway has been proposed to replenish creatine levels in cerebral cells, particularly in neurons of CTD patients. In vitro and in vivo studies in various animal models, including wild-type non-human primates and creatine transporter deficient mice, show that formulated DCE, when administered intranasally, achieves significant cerebral distribution up to the target cells, the neurons, and modulates the expression of neuronal markers related to cognitive function at doses intended for patients. These compelling results contribute to a better understanding of the pharmacokinetics and pharmacodynamics of DCE after nasal administration, with a particular focus on the crucial role of the nose-to-brain pathway in DCE distribution., Competing Interests: Declaration of competing interest Aloise Mabondzo reports financial support was provided by Ceres Brain Therapeutics. Aloise Mabondzo reports a relationship with Ceres Brain Therapeutics that includes: consulting or advisory and equity or stocks. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Anne-Cécile Guyot reports financial support was provided by Ceres Brain Therapeutics. Anne-Cecile Guyot reports a relationship with Ceres Brain Therapeutics that includes: equity or stocks. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Clara Lhotellier reports financial support was provided by Ceres Brain Therapeutics. Clara Lhotellier reports a relationship with Ceres Brain Therapeutics that includes: employment. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Clémence Disdier reports financial support was provided by Ceres Brain Therapeutics. Clemence Disdier reports a relationship with Ceres Brain Therapeutics that includes: employment and equity or stocks. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Thomas Joudinaud reports financial support was provided by Ceres Brain Therapeutics. Thomas Joudinaud reports a relationship with Ceres Brain Therapeutics that includes: consulting or advisory and equity or stocks. Thomas Joudinaud has patent pending to Assignee. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Henri Benech reports a relationship with Ceres Brain Therapeutics that includes: employment and equity or stocks. Henri Benech has patent pending to Assignee. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Masson SAS. All rights reserved.)

Many patients with liver diseases are exposed to the risk of hepatic encephalopathy (HE). The incidence of HE in liver patients is high, showing various symptoms ranging from mild symptoms to coma. Liver transplantation is one of the ways to overcome HE. However, not all patients can receive liver transplantation. Moreover, patients who have received liver transplantation have limitations in that they are vulnerable to hepatocellular carcinoma, allograft rejection, and infection. To find other therapeutic strategies, it is important to understand pathological factors and mechanisms that lead to HE after liver disease. Oxidative stress, inflammatory response, hyperammonaemia and metabolic disorders seen after liver diseases have been reported as risk factors of HE. These are known to affect the brain and cause HE. These peripheral pathological factors can impair the blood-brain barrier, cause it to collapse and damage the neurovascular unit component of multiple cells, including vascular endothelial cells, astrocytes, microglia, and neurons, leading to HE. Many previous studies on HE have suggested the impairment of neurovascular unit and cell-cell communication in the pathogenesis of HE. This review focuses on pathological factors that appear in HE, cell type-specific pathological mechanisms, miscommunication/incorrect relationships, and therapeutic candidates between brain cells in HE. This review suggests that regulating communications and interactions between cells may be important in overcoming HE., Competing Interests: Declaration of competing interest The authors have no conflicts of interest to declare. The funders had no role in the design of the study, in the writing of the manuscript, or in the decision to publish this article., (Copyright © 2025 Elsevier Inc. All rights reserved.)

Introduction: Hyperglycemia is common in acute ischemic stroke, and associated with unfavorable outcome. However, the optimal glucose level is not known and cellular effects of hyperglycemia under hypoxia are largely unclear. We assessed how the extracellular glucose concentration affects cultured neuronal networks under experimental in vitro conditions, to provide a starting point for assessment of mechanisms at the neuronal network and cellular levels., Methods: We used in vitro cultured rat neuronal networks on micro-electrode arrays (MEAs) and glass coverslips. Twenty-four hours of controlled hypoxia was induced. We measured neuronal network activity during baseline (normoxia, 6 h), 24 h of hypoxia, and 6 h after reoxygenation, defined as the summed number of action potentials in 1 h bins. Apoptosis was determined intermittently with caspase 3/7 staining and microscopy. We compared groups of networks under glucose concentrations of 5.0 mmol/L, 7.0 mmol/L, 9.0 mmol/L, and 12.0 mmol/L., Results: Overall, during hypoxia, a gradual decrease in neuronal network activity and increase in apoptosis was found. There were faster decrease in activity (p < 0.01) and more apoptosis after 24 h of hypoxia under glucose levels of 12 mmol/L in a single-well MEA set-up (p < 0.05), and more apoptosis in glass coverslips with glucose levels of 12.0 mmol/L in comparison with 5 mmol/L (p = 0.03). These differences were not observed in multi-well MEAs, in which effects of hypoxia were much smaller than in single-well MEAs., Conclusion: Hyperglycemia was associated with a more rapid decrease of neuronal network activity during and more apoptosis after 24 h of hypoxia in cultured neuronal networks. Loss of neuronal activity and apoptosis probably play a role in poorer outcomes of stroke patients under hyperglycemia. Our model provides a starting point for further assessment of pathomechanisms., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ischemic stroke (IS) is a severe and sudden cerebrovascular event, associated with notably high rates of mortality and morbidity. The process of apoptosis, a genetically orchestrated form of programmed cell death, is divided into two pathways: intrinsic and extrinsic. The intricate involvement of long non-coding RNA (lncRNA) in the pathobiology of IS, particularly in modulating neuronal apoptosis, is a burgeoning area of research. This review synthesizes the current understanding of the regulatory mechanisms of lncRNA on neuronal apoptosis in the context of ischemic stroke. Specifically, we highlight the roles of lncRNA such as ANRIL, C2dat1/2, H19, TUG1, MEG3, SNHG, and GAS5, which have been implicated in the facilitation of neuronal apoptosis. Conversely, the lncRNA N1LR has been shown to exert an inhibitory effect on this process. The role of MALAT1 in neuronal apoptosis remains a subject of ongoing debate, as its function oscillates between pro-apoptotic and anti-apoptotic roles, thus highlighting the need for further elucidation., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Artemisinin (ART), a natural product isolated from the traditional Chinese plant Artemisia annua L., has shown neuroprotective properties in addition to its well-established antimalarial activities. This study investigates the therapeutic effect of ART in ischemic stroke (IS) and delves into its functional mechanism. Bioinformatics analyses revealed lysine demethylase 1A (KDM1A) as a promising target of ART aberrantly overexpressed in the context of IS. Increased KDM1A expression was detected in oxygen-glucose deprivation/reoxygenation (OGD/R)-treated hippocampal neurons and transient middle cerebral artery occlusion (tMCAO)-challenged mice. Treatment with ART reduced KDM1A protein level, thus protecting mouse hippocampal neurons from OGD/R-induced oxidative stress and apoptosis. In vivo, ART reduced infarct size, reduced brain content, enhanced neurological function, and enhanced neuronal survival in tMCAO. Regarding the downstream cascade, KDM1A was found to repress transcription of sphingosine kinase 2 (SPHK2) by removing H3K4me2 modification near the SPHK2 promoter. Either KDM1A overexpression or SPHK2 knockdown abrogated the neuroprotective effects of ART. The ample evidence of this study suggests that ART fulfills neuroprotective functions in the context of IS by protecting SPHK2 from KDM1A-mediated transcription repression, highlighting ART as a promising regimen for the treatment of IS., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Gulf War Illness (GWI) has been consistently linked to exposure to pyridostigmine (PB), N,N-Diethyl-meta-toluamide (DEET), permethrin (PER), and traces of sarin. In this study, diisopropylfluorophosphate (DFP, sarin surrogate) and the GWI-related chemicals were found to reduce the number of functionally active neurons in rat hippocampal slices. These findings confirm a link between GWI neurotoxicants and N-Methyl-D-Aspartate (NMDA)-mediated excitotoxicity, which was successfully reversed by Edelfosine (a phospholipase Cβ (PLCβ3) inhibitor) and Flupirtine (a Kv7 channel agonist). To test whether 4R-cembranoid (4R), a nicotinic α7 acetylcholinesterase receptor (α7AChR) modulator known for its neuroprotective properties, can restore hippocampal neurons from glutamate-induced neurotoxicity, we exposed rat hippocampal slices with DFP for 10 min followed by 60 min treatment with 4R. We investigated the 4R mechanisms of neuroprotection after preincubation with LY294002, PD98059, and KN-62. The inhibition of the phosphatidylinositol 3-kinase (PI3K), mitogen-activated protein kinase (MEK1/2), and calcium/calmodulin-dependent protein kinase (CaMKII) abrogated the protective effect of 4R against DFP-induced neurotoxicity. In separate experiments, after incubation with DFP, followed by 4R for 1 h, cellular extracts were prepared for Western blotting of phospho-Akt, phospho-GSK3β, phosphorylated extracellular signal-regulated kinase (ERK)1/2, CaMKII and cAMP response element-binding protein (CREB). Our results show that DFP induces neuronal dysfunction by dephosphorylation, while 4R restores the phosphorylation of Akt, GSK3, ERK1/2, CREB, and CaMKII. Moreover, our proteomics analysis supported the notion that 4R activates additional signaling pathways related to enhancing neuronal signaling, synaptic plasticity, and apoptotic inhibition to promote cell survival against DFP, offering biomarkers for developing treatment against GWI., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Nadezhda Sabeva reports financial support, article publishing charges, equipment, drugs, supplies, travel, and writing assistance were provided by the National Institutes of Health. Pedro A. Ferchmin has a patent issued to Universidad Central del Caribe. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier Ltd.)

Recently, we have reported that pyridoxal-5'-phosphate phosphatase/chronophin (PLPP/CIN) selectively dephosphorylates neurofibromin 2 (NF2, also known as merlin) at serine (S) 10 site. Since NF2 inhibits p21-activated kinase 1 (PAK1)-mediated nuclear factor-κB (NF-κB) activation, in the present study, we investigated the role of PLPP/CIN-mediated NF2 S10 dephosphorylation in lipopolysaccharide (LPS)-induced neuroinflammation and explored its related signaling pathways in the mouse hippocampus. PLPP/CIN overexpression increased NF2 S10 dephosphorylation and PAK1 S204 autophosphorylation under physiological condition, which were reversed by PLPP/CIN deletion. Following LPS injection, PLPP/CIN overexpression exacerbated microglial activation, although microglial PLPP/CIN expression was undetectable. In addition, PLPP/CIN overexpression enhanced PAK1 and NF-κB phosphorylations, and upregulated cyclooxygenase-2 (COX-2) and prostaglandin E synthase 2 (PTGES2) expressions in CA1 neurons. PLPP/CIN overexpression also augmented microglial interleukin-1β induction. PLPP/CIN ablation and 1,1'-dithiodi-2-naphthtol (IPA-3, a PAK1 inhibitor) pretreatment ameliorated these LPS-induced neuroinflammatory responses. These findings indicate that PLPP/CIN-mediated NF2 S10 dephosphorylation may facilitate PAK1-NF-κB-COX-2-PTGES2 signaling pathway in CA1 neurons, which would subsequently exaggerate immune response of microglia following LPS treatment. Therefore, our findings suggest that this PLPP/CIN-mediated neuron-microglia interaction may play an important role in the pathogenesis of inflammation-related neurological diseases., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Background: In its tetrameric form, pyruvate kinase M2 isoform (PKM2) catalyzes the last step of glycolysis and plays a key role in the metabolic reprogramming via regulating the signaling of pentose phosphate pathway (PPP). But the role of PKM2 in cerebral ischemia-reperfusion (I/R) injury remains unknown., Methods: Mice model of middle cerebral artery occlusion (MCAO) and model of oxygen-glucose deprivation (OGD) injury in cultured neurons were established. PKM2 activator or inhibitor were used to test the effects of PKM2 in wild-type and PKM2 (-/-) mice after I/R injury. Biochemical and molecular approach were used to detect the level of PKM2 tetramers and PPP metabolites., Results: We showed for the first time that ischemia-induced increase of PKM2 activity promoted neuronal death via the suppression of PPP-dependent antioxidant capacity. To identify therapeutic approach that suppresses ischemia-induced increase of PKM2 activity, we tested the effect of bilateral transcranial direct-current stimulation (BtDCS), a newly established BtDCS approach by us, on PKM2 activity after mouse I/R. Our data demonstrated that BtDCS inhibited PKM2 activity in the ischemic neurons. BtDCS also reduced the cerebral infarct volume and the neurological deficits in stroke mice. We found that BtDCS-induced neuroprotection was mediated through the suppression of PKM2 activity after I/R., Conclusions: Together, this study provided novel evidence that supported PKM2 as a crucial regulator of neuronal metabolism after cerebral I/R injury, and revealed the molecular mechanism by which BtDCS protects against mouse cerebral I/R injury through regulating PKM2-mediated metabolic reprogramming., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ethnopharmacological Relevance: Cognitive dysfunction is a common complication of chronic insomnia. Liuwei Anshen Capsule (LAC), a traditional Chinese patent medicine clinically prescribed for insomnia, has been proved to possess good efficacy in reducing insomnia complications including dementia and anxiety in clinic. However, the active substances in LAC and their mechanisms in treating cognitive deficit associated with sleep disorders remain unclear., Aim of the Study: This study aims to explore the potential material basis and therapeutic mechanisms of LAC on cognitive impairment caused by sleep deprivation (SD) through an integrative approach involving serum pharmacochemistry, network pharmacology and experimental validation., Methods: The active ingredients of LAC in vitro and in vivo were screened and identified by liquid chromatography-mass spectrometry (LC-MS) technology. The potential targets and signaling pathways of LAC against cognitive impairment were predicted based on network pharmacology and molecular docking. Subsequently, MWM and NOR were employed to evaluate the efficacy of LAC on cognitive impairment in SD rats, and the mechanism was further validated from pathological and molecular biology perspectives., Results: Totally 85 active ingredients in LAC were accurately identified and 8 components absorbed into blood were found by LC-MS. Network pharmacology and molecular docking analysis predicted potential targets involving caspase-3, MAPK3, MAPK1, and Bcl-2. LAC (192, 384, and 768 mg/kg, i.g.) could improve spatial learning and memory of SD rats in a dose-dependent manner, restrain hippocampal neuronal apoptosis and microglia activation, and diminish TNF-α, IL-1β, and IL-6 expression levels, which were achieved by regulating apoptosis-related proteins (caspase-3, Bax, and Bcl-2) and MAPK (p-ERK and p-P38) signaling pathway., Conclusion: The findings provide evidence that LAC alleviates cognitive abnormality and pathological alterations in sleep-deprived rats by regulating the expression of apoptosis related proteins and MAPK signaling pathway, indicating its potential therapy for the cognitive complaints caused by insomnia or other neurological diseases., Competing Interests: Declaration of competing interest The authors have declared no conflict of interest., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ethnopharmacological Relevance: Previous study has demonstrated lancao decoction (LC), a traditional Chinese medicine (TCM) fomula and recorded in "Huangdineijing", has a therapeutic effect on cognitive impairment (early clinical manifestations of alzheimer's disease (AD), which suggests that LC may have potential therapeutic advantages for AD. Whether LC has the therapeutic effect on AD and its potential mechanisms were still further indicated., Aim of the Study: In this study, we aimed to uncover the potential advantage and neuronal mechanisms of LC in the treatment of AD in APP/PS1 mice in the hippocampus., Methods and Materials: We chose APP/PS1 mice to combing with behavioral tests including morris water maze (MWM) or y-maze to determine the role of LC in the therapeutic actions of AD. Network pharmacology was used to screen potential targets and pathways involving in LC's treatments of AD. Western blot was used to detect the phosphorylated expressions of proteins in hippocampus in APP/PS1 mice in the hippocampus. Pharmacological interventions were used to elucidate the relationship between the role of LC in the treatment of AD and the pathway, as well as the upstream and downstream interactions with neuronal activities., Results: According to our previous LC effective dose (2.5 g/kg), the dose was also able to significantly reduce the latency to the platform, and significantly increase the number of crossing times and time spend in the target quadrant in APP/PS1 mice in MWM, which was consistent with donepezil (DON) after 14 days chronic treatments. Network pharmacology showed that PI3K/AKT and MAPK pathways were closely associated with LC's treatments of AD, and protein autophosphorylation played a role in this process. The phosphorylated expressions of PI3K and AKT were obviously reduced in APP/PS1 mice in the hippocampus, which were both reversed by LC or DON. The phosphorylated expressions of MAPK including P38, JNK and ERK were also significantly reduced in APP/PS1 mice hippocampus, but only the phosphorylated expression of ERK was reversed by LC or DON. Inhibiting the activities of PI3K/AKT pathway by LY294002 blocked LC's improvement of behavioral deficits in APP/PS1 mice, including reducing latency to platform and increasing the number of crossings time in MWM in APP/PS1 mice, which also blunted LC's up-regulated phosphorylated expressions of PI3K, AKT and ERK in the hippocampus. Moreover, suppressing the activities of ERK by PD98059 also blocked LC's improvement of AD-related behavioral deficits including decreasing latency to new arm and increasing time in new arm in y-maze test, which also inhibited LC's enhancement of synaptic proteins (PSD95 and synapsin1) in the hippocampus and the number of EGR1-positive cells in the hippocampal dentate gyrus (DG)., Conclusions: Take together, our study revealed that LC had the therapeutic effects on AD by activating the PI3K/AKT pathway to enhance ERK activity and further strengthened neuronal activities in the hippocampus., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Ethnopharmacological Relevance: Epilepsy (EP) is one of the most prevalent chronic neurological disorders in children, characterised by a prolonged course and a propensity for recurrence. Banxia Baizhu Tianma Decoction (BBTD), a traditional Chinese medicine formula, is commonly employed in the clinical management of EP and has demonstrated satisfactory therapeutic effects., Aim of the Study: This study aimed to evaluate the anti-epileptic effects of BBTD and to explore its molecular mechanisms., Materials and Methods: EP rat model was induced by pentylenetetrazol (PTZ) and treated with BBTD. Parameters such as seizure grade and duration were recorded to evaluate the improvement of BBTD on epileptic behavior. Nissl staining was used to observe the pathological changes in the cerebral motor cortex. The expression levels of the Bax and Bcl-2 in the motor cortex were measured by western blot analysis to assess neuronal damage and apoptosis. The therapeutic action of BBTD was evaluated by examining the levels of neurotransmitters γ-aminobutyric acid (GABA) and glutamate (Glu) in the brain tissue of EP rats, along with assessments of neuronal damage and apoptosis. Non-targeted metabolomics techniques were employed to conduct a comprehensive analysis of serum and urine metabolites, and network analysis of metabolite-related targets was performed to enhance understanding of the anti-epileptic effects and mechanisms of BBTD., Results: After BBTD treatment, the EP model rats exhibited reduced seizure severity and shortened seizure duration. Moreover, BBTD mitigated PTZ-induced neuronal damage, as evidenced by a significant increase in the number of Nissl bodies in the motor cortex following treatment. At the same time, BBTD inhibited neuronal apoptosis, as demonstrated by the up-regulation of the anti-apoptotic protein Bcl-2 and down-regulation of the pro-apoptotic protein Bax in the brain tissue of treated rats. In addition, BBTD reversed the decreased levels of GABA and the increased levels of Glu in the brain tissue of the model group. Metabolomics analyses suggested that BBTD treatment for EP may be closely associated with alterations in urinary metabolites related to vitamin B6 and pyrimidine metabolism, as well as serum metabolites involved in purine metabolism, glycerophospholipid metabolism and vitamin B6 metabolism. Finally, network analysis of metabolite targets indicated that dopamine and alpha-linolenic acid metabolites may play significant roles in the therapeutic effects of BBTD on EP., Conclusion: BBTD demonstrated anti-epileptic effects in PTZ-induced seizure rats by regulating neurotransmitter balance, reducing neuronal damage and inhibiting apoptosis, suggesting its potential for the development of novel AEDs. This is the first time that UHPLC-MS-based urine and serum metabolomics have been used to elucidate the anti-epileptic mechanism of BBTD, providing insights into the underlying mechanisms of BBTD's action., Competing Interests: Declaration of competing interest The authors declare that they have no conflicts of interest., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Mitochondrial dysfunction contributes to the pathology of hypoxia-ischemia (HI) brain damage by aberrant production of ROS. Hydrogen sulfide (H 2 S) has been demonstrated to exert neuroprotective effects through antioxidant mechanisms. However, the diffusion of H 2 S in vivo is not specifically targeted and may even be systemically toxic. In this study, based on mitochondria-targeted H 2 S donor AP39, we fabricated liposomes encapsulating AP39 (AP39@Lip) via intranasal delivery to improve functional recovery after HI brain injury. This study presents that intranasal administration of AP39@Lip was capable of attenuating acute brain injury by inhibiting mitochondrial dysfunction, apoptosis, neuroinflammation, and ROS production in the lesional cortex 3 days after HI brain injury. Similarly, AP39@Lip was observed to restore both short- and long-term function following HI injury without obvious toxicity. Mechanistically, the therapeutic effects of AP39@Lip mainly relied on its colocalization with neuronal mitochondria 24 h after administration and reversed H 2 S levels in the lesional cortex. Moreover, molecular docking and cellular thermal shift assay suggest that AP39 inhibited the activation of ERK1/2 and caspase-1 by directly binding to ERK1/2 or caspase-1. These results indicate that intranasal administration of AP39@Lip selectively delivered H 2 S to neuronal mitochondria and mitigated mitochondrial damage following HI insult by targeting ERK1/2 and caspase-1.

Three chondroitin sulfate (CS) analogues with predominant subtypes (A, C, and E) were prepared from engineered Escherichia coli K4 combined with regioselective sulfation. CS with the designed sulfates as the main components was characterized by nuclear magnetic resonance spectroscopy, elementary analysis, and disaccharide analysis. CS prepared from the native or degraded capsular polysaccharide had molecular weights of 1.55 × 10 4 -1.90 × 10 4 and 5.6 × 10 3 -7.4 × 10 3 , respectively. We found that CS with dual sulfates promoted the outgrowth and survival of hippocampal neurons, whereas CS with monosulfate had an inhibitory effect. CS interacted with the nerve growth factor (NGF) and tyrosine kinase (TrkA), which activated the extracellular signal-regulated kinase (ERK) signaling pathway to modulate the outgrowth of hippocampal neurons. This work clarified the multiple effects of CS on neurite outgrowth based on nonanimal-sourced glycosaminoglycans, which would benefit efforts in discovering their novel functions and therapeutic applications.

Obesity is a complex disease marked by increased adiposity and impaired metabolic function. While diet and lifestyle are primary causes, endocrine-disrupting chemicals (EDCs), such as bisphenol A (BPA), significantly contribute to obesity. BPA, found in plastic consumer products, accumulates in the hypothalamus and dysregulates energy homeostasis by disrupting the neuropeptide Y (NPY)/agouti-related peptide (AgRP) and pro-opiomelanocortin (POMC) neurons. However, the precise molecular mechanisms of how BPA disrupts neuropeptide expression remains unclear. We hypothesized that microRNAs (miRNAs), which regulate approximately 60% of the human protein-coding genome and are crucial for hypothalamic energy regulation, may mediate the effects of BPA on Agrp. Using the TargetScanMouse 8.0 and DIANA microT bioinformatics tools, we identified miR-501-5p as a potential miRNA that directly regulates Agrp and the miR-34 family as miRNAs that indirectly regulate Agrp through its transcription factor krüppel-like factor 4 (KLF4). We found that in an immortalized NPY/AgRP-expressing cell line, mHypoE-41, miR-501-5p unexpectedly upregulated Agrp, while miR-34a-5p reduced Klf4 and Agrp mRNA levels. Serum starvation reduced miR-34a-5p levels and elevated Agrp mRNA levels, suggesting a potential role in AgRP regulation. Inhibiting the miR-34a-5p interaction with the Klf4 3'UTR using a specific target site blocker prevented the downregulation of both Klf4 and Agrp, suggesting miR-34a-5p alters Agrp mRNA levels via regulation of KLF4. BPA treatment increased Agrp and Klf4 expression while simultaneously decreasing miR-34a-5p levels, indicating miR-34a-5p may play a role in BPA-mediated dysregulation of Agrp. Overall, this study highlights indirect miRNA-based regulation of Agrp, which can also be dysregulated by obesogens, such as BPA., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Author(s). Published by Elsevier B.V. All rights reserved.)

Cerebral ischemic stroke, neuronal death, and inflammation bring difficulties in neuroprotection and rehabilitation. In this study, we developed and designed the ability of natural lactoferrin-polyethylene glycol-polyphenylalanine-baicalein nanomicelles (LF-PEG-PPhe-Bai) to target and reduce these pathological processes, such as neurological damage and cognitive impairment in the stages of poststroke. Nanomicelles made from biocompatible materials have improved bioavailability and targeted distribution to afflicted brain areas. The results showed that LF-PEG-PPhe-Bai greatly improved the antioxidation, antiapoptosis, and anti-inflammation activity in vitro . Meanwhile, LF-PEG-PPhe-Bai improved the behavioral and cognitive impairment of 2-VO model mice, protected nerve cells in the hippocampus, and reduced inflammation at the brain injury site in vivo . In conclusion, LF-PEG-PPhe-Bai nanomicelles are employed for enhancing neuroprotection and poststroke rehabilitation. The development of this technology might provide a new technique for neural repair after ischemia in the future.

Neuronal differentiation and maturation are crucial for developing research models and therapeutic applications. Brain-derived neurotrophic factor (BDNF) is a widely used biochemical stimulus for promoting neuronal maturation. However, the broad effects of biochemical stimuli on multiple cellular functions limit their applicability in both in vitro models and clinical settings. Electrical stimulation (ES) offers a promising physical method to control cell fate and function, but it is hampered by lack of standard and optimised protocols. In this study, we demonstrate that ES outperforms BDNF in promoting neuronal maturation in human neuroblastoma SH-SY5Y. Additionally, we address the question regarding which ES parameters regulate biological responses. The neuronal differentiation and maturation of SH-SY5Y cells were tested under several pulsed ES regimes. We identified accumulated charge and effective electric field time as novel criteria for determining optimal ES regimes. ES parameters were obtained using electrochemical characterisation and equivalent circuit modelling. Our findings show that neuronal maturation in SH-SY5Y cells correlates with the amount of accumulated charge during ES. Higher charge accumulation (~ 50 mC/h) significantly promotes extensive neurite outgrowth and ramification, and enhances the expression of synaptophysin, yielding effects exceeding those of BDNF. In contrast, fewer charge injection to the culture (~ 0.1 mC/h) minimally induces maturation but significantly increases cell proliferation. Moreover, ES altered the concentration and protein cargo of secreted extracellular vesicles (EV). ES with large enough accumulated charge significantly enriched EV proteome associated with neural development and function. These results demonstrate that each ES regime induces distinct cellular responses. Increased accumulated charge facilitates the development of complex neuronal morphologies and axonal ramification, outperforming exogenous neurotrophic factors. Controlled ES methods are immediately applicable in creating mature neuronal cultures in vitro with minimal chemical intervention., Competing Interests: Declarations. Competing interests: The authors declare no competing interests. Consent for publication: All authors agree with the content of the manuscript and give their consent forpublication. The authors have read the Nature Portfolio journal policies on authorresponsibilities and submit this manuscript in accordance with those policies., (© 2025. The Author(s).)

Prion diseases are fatal transmissible neurodegenerative diseases that affect many mammals, including humans, caused by the templated misfolding of the prion protein. Different conformations of misfolded prions can occur, leading to distinct disease phenotypes or strains and the accumulation of prions in distinct brain regions. How prion structure influences this brain tropism is not clear, but the transmissible nature of prion diseases has allowed for the development of ex vivo brain slice models of disease. To date, work has been done in cerebellar cultures, but prion diseases are known to differentially affect many other brain regions. We have adapted this approach to a coronally sliced whole brain organotypic culture and demonstrate distinct profiles of cytotoxicity and neuronal loss upon exposure to four mouse-adapted scrapie strains. We were able to induce infection both diffusely through submersion of slice cultures in infectious media and locally through contact with prion-coated stainless-steel wires. Moreover, we observed consistent strain-specific regional differences in prion deposition by 8 weeks of infection, recapitulating what is seen in vivo. We predict that coronal whole brain organotypic slice cultures can be a powerful tool for elucidating strain-specific mechanisms of prion spread and pathology., Competing Interests: Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

The paired box 6 (Pax6) gene encodes a highly conserved transcription factor, involved in the development of eyes, brain, and endocrine glands. Homozygous loss of Pax6 resulted in neonatal death in mice, plus loss of eyes and malformation of cerebral cortex. In patients with heterozygous Pax6 mutations, a reduction in thickness of the frontoparietal cortex was detected, which was also observed in small eye mice. In this study, we found that Pax6 overexpression increased the cortical thickness, especially in the intermediate zone of the cortex, which conflicts with the report of Manuel et al. Pax6 overexpression appears to detain neurons in the intermediate zone while promoting cell proliferation. It is worth noting that the impact of Pax6 overexpression on cortical thickness and neuronal migration was temporal, explaining the differences with other reports. We postulated that the alteration of Pax6 isoform ratio by autoregulation might be responsible for this. JASPAR analysis together with the results of qPCR, Western blot, CUT&Tag, and rescue experiments revealed that Pax6 regulates neuronal migration and cell proliferation by indirectly mediating Wnt3a expression. Therefore, we propose that Pax6 participates in corticogenesis via interaction with Wnt3a in regulating neuronal migration and cell proliferation., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Rett syndrome (RTT) is a severe neurodevelopmental disorder primarily caused by loss-of-function mutations in the MECP2 gene, resulting in diverse cellular dysfunctions. Here, we investigated the role of the long noncoding RNA (lncRNA) NEAT1 in the context of MeCP2 deficiency using human neural cells and RTT patient samples. Through single-cell RNA sequencing and molecular analyses, we found that NEAT1 is markedly downregulated in MECP2 knockout (KO) cells at various stages of neural differentiation. NEAT1 downregulation correlated with aberrant activation of the mTOR pathway, abnormal protein metabolism, and dysregulated autophagy, contributing to the accumulation of protein aggregates and impaired mitochondrial function. Reactivation of NEAT1 in MECP2-KO cells rescued these phenotypes, indicating its critical role downstream of MECP2. Furthermore, direct RNA-RNA interaction was revealed as the key process for NEAT1 influence on autophagy genes, leading to altered subcellular localization of specific autophagy-related messenger RNAs and impaired biogenesis of autophagic complexes. Importantly, NEAT1 restoration rescued the morphological defects observed in MECP2-KO neurons, highlighting its crucial role in neuronal maturation. Overall, our findings elucidate lncRNA NEAT1 as a key mediator of MeCP2 function, regulating essential pathways involved in protein metabolism, autophagy, and neuronal morphology., (© The Author(s) 2025. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Previously, we reported final-instar lepidopteran larvae exposed to low doses of imidacloprid, clothianidin, and thiamethoxam had arrest in pupal ecdysis, which is a novel adverse outcome for neonicotinoid insecticides. Since neonicotinoids disrupt acetylcholine signaling, we hypothesized that the excitatory neurotransmitter acetylcholine plays a critical role in regulation of pupal ecdysis, likely by modulating the release of peptides from crustacean cardioactive peptide (CCAP) neurons. In this paper, using two lepidopteran species, we undertook studies with five additional nicotinic acetylcholine receptor (nAChR) agonists and three muscarinic acetylcholine receptor (mAChR) agonists to hypothesize the putative nAChR subunits that mediate pupal ecdysis. We also explored the potential role of mAChRs in regulation of pupal ecdysis. These findings, along with toxicokinetic analyses, suggest that pupal ecdysis may be mediated by the α1, β1, and β2 subunits of nAChRs without involvement of mAChRs. An analysis of ecdysis movements showed that neonicotinoid-treated lepidopteran larvae exhibited similar disruptions as observed in CCAP neuron-knockout Drosophila larvae. Based on findings to date, we hypothesize that acetylcholine regulates lepidopteran pupal ecdysis directly through CCAP neurons or by activating their upstream efferent inhibitory (likely GABA-releasing) neurons. Further studies are needed to elucidate the interplay between neuroendocrine hormones and neurotransmitters in lepidopteran pupal ecdysis., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22 cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis., Competing Interests: Declaration of competing interest The authors declared no conflict of interest., (Copyright © 2025 Elsevier Inc. All rights reserved.)

Neurogenesis is an active process of creating new neurons in the neurogenic zone. It is influenced by many factors, including the circadian system, which is synchronized by light. Neurogenesis in laboratory rodents peaks at night, and the rodents are nocturnal, contrary to humans that are active during the day. Here, we studied whether proliferation and apoptosis exhibit a daily rhythm in the brain of the diurnal songbird zebra finch (Taeniopygia guttata) and whether the cell proliferation peaks during the dark phase of the day, as in rodents. We injected the birds with the cell proliferation marker 5-ethynyl-2´-deoxyuridine (EdU; thymidine analog), quantified the number of dividing cells in the neurogenic ventricular zone (VZ), and measured mRNA expression of clock genes as well as genes indicating cell proliferation or apoptosis. First, we confirmed the daily rhythms of the clock genes. Next we found that proliferation along the whole VZ did not exhibit a daily rhythm. However, proliferation in the central ventral part of the VZ, i.e. "the hot-spot" area, showed a daily rhythm of proliferation. The highest number of newborn cells was detected in the dark phase of the day. The relative expression of the apoptotic genes caspase 3, Bcl-2, and Bax as well as the proliferating cell nuclear antigen (PCNA) did not show any rhythm. In summary, our results show that cell proliferation in the "hot-spot" region of the VZ in diurnal songbirds shows rhythmic activity over a period of 24 h and that the maximum cell proliferation occurs in the passive phase. This study may have implications for understanding the mechanisms underlying the daily regulation of brain cell proliferation in different species., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Organotypic slice cultures (OTCs) are versatile tools for studying long-term structure-function relationships of neurons within a defined network (e.g. hippocampus). We developed a method for repeated experimenter-controlled activation of hippocampal granule cells (GCs) in OTCs within the incubator. After several days of contact-free photonic stimulation, we were able to ameliorate entorhinal denervation-induced structural damage in GCs. To achieve this outcome, we had to calibrate the intensity and duration of optogenetic (light) pulses using whole-cell electrophysiological recordings and multi-cell calcium imaging. Our findings showed that ChR2-expressing cells generated action potentials (APs) or calcium transients in response to illumination but were otherwise functionally indistinguishable from non-transduced GCs within the same neural circuit. However, the threshold for AP firing in single GCs varied based on the stimulus light intensity and the expression levels of ChR2. This information allowed us to calibrate light intensity for chronic stimulations. Denervated GCs exhibited significant spine loss four days post-denervation, but this detrimental effect was mitigated when AP firing was induced at a physiological GC bursting rate. Phototoxic damage caused by chronic light exposure was significantly reduced if illuminated with longer wavelength and by adding antioxidants to the culture medium. Our study presents a versatile approach for concurrent non-invasive manipulation and observation of neural circuit activity and remodeling in vitro., Competing Interests: Declarations. Competing interests: Thomas Deller received honoraria from Novartis for lectures on human brain anatomy. All other authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (© 2025. The Author(s).)

Nucleus accumbens (NAc) dopamine D1 receptor-expressing neurons are known to be critical for processing reward and regulating food intake. However, the role of D2-expressing neurons in this nucleus remains less understood. This study employed optogenetic manipulations to investigate the role of NAc D2-expressing neurons in reward processing and sucrose consumption. Optogenetic activation of these neurons decreased sucrose preference (at 20 Hz), disrupted licking patterns (particularly at 8 and 20 Hz), and increased self-stimulation. Conversely, synchronizing stimulation with the animal licking rhythm mitigated licking disruption and even increased sucrose intake, suggesting a rewarding effect. Furthermore, 20 Hz stimulation (but not 8 Hz) induced place preference in a real-time place preference (RTPP) test. In contrast, inhibiting D2 neurons produced a negative hedonic state, although not reaching complete aversion, influencing food choices in specific contexts. For instance, while the RTPP test per se was not sensitive enough to observe place aversion when mice could choose between consuming a high-fat diet (HFD) pellet in a context associated with or without inhibition of D2 neurons, they preferred to consume HFD on the non-inhibited side. This suggests that the palatability of HFD can unmask (but also overshadow) the negative hedonic state associated with D2 neuron inhibition. A negative reinforcement paradigm further confirmed the active avoidance behavior induced by D2 neuron inhibition. In conclusion, NAc D2 neuron inhibition induces a negative hedonic state, while activation has a dual effect-it is rewarding yet disrupts licking behavior-highlighting its complex role in reward and consummatory behavior. Importantly, self-paced stimulation, where the animal controls the timing of the stimulation through its licking behavior, offers a more efficient and natural approach for stimulating NAc activity., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2025 Requejo-Mendoza et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Jiawei Chaihu Shugan decoction (JWCHSGD) is a traditional Chinese medicine well-known for its beneficial effects in treating epilepsy (Xianzheng in ancient Chinese), but the molecular mechanism of its action remains unclear. To investigate the molecular mechanism of JWCHSGD's prevention of epilepsy-mediated neuron from necroptosis and inflammation via the circRNA-Csnk1g3/Csnk1g3-85aa/ CK1γ3/TNF-α signal pathway. In vitro, murine neuronal HT22 cells were treated in six groups: control, model, carbamazepine, and three JWCHSGD doses (high, medium, low). Viability and apoptosis were assessed via CCK-8 and flow cytometry. In vivo, 60 C57BL/6J mice were divided into six groups: control, model, carbamazepine, JWCHSGD, JWCHSGD + Sh Circ&#95;Csnk1g3, and JWCHSGD + Sh NC. An epilepsy model was induced, and treatments were administered for two weeks. Outcomes included EEG, hippocampal histopathology, apoptosis (TUNEL), and mRNA/protein expression of key pathway markers. In HT22 cells, the model group showed reduced viability, increased apoptosis, and elevated mRNA/protein levels of Csnk1g3-85aa, RIP1, RIP3, MLKL, TNF-α, IL-6, and IL-1β (P < 0.05). JWCHSGD and carbamazepine increased viability and decreased apoptosis, reversing these molecular changes (P < 0.05). In mice, the model group had heightened epileptic discharges, neuronal damage, and apoptosis, along with increased expression of the same markers (P < 0.05). JWCHSGD and carbamazepine mitigated these effects (P < 0.05). JWCHSGD reduces epileptic events by regulating the circRNA-Csnk1g3/Csnk1g3-85aa/CK1γ3/TNF-α signaling pathway, impacting necroptosis and inflammation in hippocampal neurons and HT22 cells., Competing Interests: Declarations. Competing interests: The authors declare no competing interests. Ethics statement: Animal experiments in this study were performed in accordance with the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines and approved by the Animal Care Committee of Guangxi University of Chinese Medicine (Approval No. DW20231016-225). The experimental protocols of this study complied with the regulations of the ethics committee., (© 2025. The Author(s).)

In neurons, the quantities of mRNAs and proteins are traditionally assumed to be determined by functional, electrical or genetic factors. Yet, there may also be global, currently unknown computational rules that are valid across different molecular species inside a cell. Surprisingly, our results show that the energy for molecular turnover is a significant cellular expense, en par with spiking cost, and which requires energy-saving strategies. We show that the drive to save energy determines transcript quantities and their location while acting differently on each molecular species depending on the length, longevity and other features of the respective molecule. We combined our own data and experimental reports from five other large-scale mRNA and proteomics screens, comprising more than ten thousand molecular species to reveal the underlying computational principles of molecular localisation. We found that energy minimisation principles explain experimentally-reported exponential rank distributions of mRNA and protein copy numbers. Our results further reveal robust energy benefits when certain mRNA classes are moved into dendrites, for example mRNAs of proteins with long amino acid chains or mRNAs with large non-coding regions and long half-lives proving surprising insights at the level of molecular populations., Competing Interests: Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Lactation is a crucial phase of brain development, and the events and nutrients during this period have long-term consequences for the occurrence of depression. This study investigated the effect and mechanism of lactoferrin (LF) deficiency during lactation on depression in adulthood. Lactation LF-deficient mice were established by nursing wild-type mice using LF systemic knockout mother mice. Additionally, 14-day-old mice were injected with lipopolysaccharide (LPS) and subjected to chronic unpredictable mild stress when they reached 6 weeks of age. The results show that lactation lactoferrin deficiency increases depression-like behavior in adult mice, and the mechanism is associated with heightened neuronal damage, abnormal microglial activation, and decreased BDNF in the hippocampus. In contrast, recombinant human lactoferrin promotes neuronal proliferation by upregulating ERK 1 and 2 phosphorylation and attenuates LPS-induced neuronal injury and microglial activation by inhibiting the activation of Toll-like receptor 4-nuclear factor-kappa B pathway in vitro. Our findings suggest that lactoferrin intake during lactation protects neurons by regulating microglial activation, thereby effectively reducing depressive symptoms in adults., Competing Interests: Declarations. Ethics approval and consent to participate: The guidelines of the Institutional Animal Care and Use Committee (SYXK 2020-0052) were followed for the treatment of all mice. Additionally, experiments were approved by the Animal Experimentation Committee of China Agricultural University (Beijing, China), the issue number is AW40702202-4-6. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Neurodegenerative diseases such as Alzheimer's disease exhibit pathological changes in the brain that proceed in a stereotyped and regionally specific fashion. However, the cellular underpinnings of regional vulnerability are poorly understood, in part because whole-brain maps of a comprehensive collection of cell types have been inaccessible. Here, we deployed a recent cell-type mapping pipeline, Matrix Inversion and Subset Selection (MISS), to determine the brain-wide distributions of pan-hippocampal and neocortical cells in the mouse, and then used these maps to identify general principles of cell-type-based selective vulnerability in PS19 mouse models. We found that hippocampal glutamatergic neurons as a whole were significantly positively associated with regional tau deposition, suggesting vulnerability, while cortical glutamatergic and GABAergic neurons were negatively associated. We also identified oligodendrocytes as the single-most strongly negatively associated cell type. Further, cell-type distributions were more predictive of end-time-point tau pathology than AD-risk-gene expression. Using gene ontology analysis, we found that the genes that are directly correlated to tau pathology are functionally distinct from those that constitutively embody the vulnerable cells. In short, we have elucidated cell-type correlates of tau deposition across mouse models of tauopathy, advancing our understanding of selective cellular vulnerability at a whole-brain level., Competing Interests: Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Aspirin is a potent lysine acetylation inducer, but its impact on lysine ubiquitination and ubiquitination-directed protein degradation is unclear. Herein, we develop the reversed-pulsed-SILAC strategy to systematically profile protein degradome in response to aspirin. By integrating degradome, acetylome, and ubiquitinome analyses, we show that aspirin impairs proteasome activity to inhibit proteasomal degradation, rather than directly suppressing lysine ubiquitination. Interestingly, aspirin increases lysosomal degradation-implicated K63-linked ubiquitination. Accordingly, using the major pathological protein of Parkinson's disease (PD), α-synuclein (α-syn), as an example of protein aggregates, we find that aspirin is able to reduce α-syn in cultured cells, neurons, and PD model mice with rescued locomotor ability. We further reveal that the α-syn aggregate clearance induced by aspirin is K63-ubiquitination dependent in both cells and PD mice. These findings suggest two complementary mechanisms by which aspirin regulates the degradation of soluble and insoluble proteins, providing insights into its diverse pharmacological effects that can aid in future drug development efforts., Competing Interests: Competing interests: Y.Z., J.G. and K.H. have filed a patent application related to the use of aspirin or its derivatives for treating diseases associated with abnormal aggregation of α-syn. All other authors declare no competing interests. Ethics: All animal experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee at the Interdisciplinary Research Center on Biology and Chemistry, Chinese Academy of Sciences, and are in accordance with the Guide for the Care and Use of Laboratory Animals of the Chinese Academy of Sciences., (© 2025. The Author(s).)

Neuronal mitochondria are diverse across cell types and subcellular compartments in order to meet unique energy demands. While mitochondria are essential for synaptic transmission and synaptic plasticity, the mechanisms regulating mitochondria to support normal synapse function are incompletely understood. The mitochondrial calcium uniporter (MCU) is proposed to couple neuronal activity to mitochondrial ATP production, which would allow neurons to rapidly adapt to changing energy demands. MCU is uniquely enriched in hippocampal CA2 distal dendrites compared to proximal dendrites, however, the functional significance of this layer-specific enrichment is not clear. Synapses onto CA2 distal dendrites readily express plasticity, unlike the plasticity-resistant synapses onto CA2 proximal dendrites, but the mechanisms underlying these different plasticity profiles are unknown. Using a CA2-specific MCU knockout (cKO) mouse, we found that MCU deletion impairs plasticity at distal dendrite synapses. However, mitochondria were more fragmented and spine head area was diminished throughout the dendritic layers of MCU cKO mice versus control mice. Fragmented mitochondria might have functional changes, such as altered ATP production, that could explain the structural and functional deficits at cKO synapses. Differences in MCU expression across cell types and circuits might be a general mechanism to tune mitochondrial function to meet distinct synaptic demands., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Background: Microglia polarization plays a crucial role in inflammatory injury of brain following intracerebral hemorrhage (ICH). Heme oxygenase-1 (HO-1) has demonstrated protective properties against inflammation and promote hematoma clearance after ICH. The objective of this study was to explore impacts of HO-1 on microglia polarization and phagocytosis after ICH, along with the underlying mechanism., Methods: ICH model was constructed in C57BL/6 mice. Neurological deficit of ICH mice was evaluated. HE detected pathological changes of mouse brain tissue. Immunofluorescence staining tested co-localization between HO-1 or NF-κB p65 and IBA1. The expressions of gene and proteins were detected by RT-qPCR and Western blot, respectively. Flow cytometry determined microglial polarization phenotype and neuron apoptosis. Cell viability of neuron was assessed by CCK-8. Red blood cells labeled by PKH-26 and co-cultured with microglia for examining microglial erythrophagocytosis., Results: Both HO-1 and NF-κB p65 phosphorylation were elevated in brain tissues of ICH mice. ZnPP, a HO-1 inhibitor, could exacerbate microglial M1 polarization and nerve injury, as well as repress microglial erythrophagocytosis in vitro and hematoma clearance in vivo. On the contrary, Tat-NBD, a NF-κB inhibitor, greatly suppressed microglial M1 polarization, and induced M2 polarization and microglial erythrophagocytosis, thus improving nerve injury and hematoma clearance after ICH. Notably, it was observed that NF-κB p65 could be activated by ZnPP treatment, and the regulatory roles of ZnPP on microglial polarization and erythrophagocytosis after ICH in vivo and in vitro were all diminished by Tat-NBD., Conclusion: Therefore, our data demonstrated that HO-1 alleviated nerve injury and induced M2 polarization and phagocytosis of microglia after ICH via inhibiting NF-κB signaling pathway, which could provide deepen the pathological understanding of ICH and provide potential intervention targets and drug candidate for ICH., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 International Brain Research Organization (IBRO). Published by Elsevier Inc. All rights reserved.)

In a genome-wide association study (GWAS) meta-analysis of 688,808 individuals with major depression (MD) and 4,364,225 controls from 29 countries across diverse and admixed ancestries, we identify 697 associations at 635 loci, 293 of which are novel. Using fine-mapping and functional tools, we find 308 high-confidence gene associations and enrichment of postsynaptic density and receptor clustering. A neural cell-type enrichment analysis utilizing single-cell data implicates excitatory, inhibitory, and medium spiny neurons and the involvement of amygdala neurons in both mouse and human single-cell analyses. The associations are enriched for antidepressant targets and provide potential repurposing opportunities. Polygenic scores trained using European or multi-ancestry data predicted MD status across all ancestries, explaining up to 5.8% of MD liability variance in Europeans. These findings advance our global understanding of MD and reveal biological targets that may be used to target and develop pharmacotherapies addressing the unmet need for effective treatment., Competing Interests: Declaration of interests C.M.L. is a member of the SAB for Myriad Neuroscience and has received consultancy fees from UCB., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

In Huntington's disease (HD), striatal projection neurons (SPNs) degenerate during midlife; the core biological question involves how the disease-causing DNA repeat (CAG) n in the huntingtin (HTT) gene leads to neurodegeneration after decades of biological latency. We developed a single-cell method for measuring this repeat's length alongside genome-wide RNA expression. We found that the HTT CAG repeat expands somatically from 40-45 to 100-500+ CAGs in SPNs. Somatic expansion from 40 to 150 CAGs had no apparent cell-autonomous effect, but SPNs with 150-500+ CAGs lost positive and then negative features of neuronal identity, de-repressed senescence/apoptosis genes, and were lost. Our results suggest that somatic repeat expansion beyond 150 CAGs causes SPNs to degenerate quickly and asynchronously. We conclude that in HD, at any one time, most neurons have an innocuous but unstable HTT gene and that HD pathogenesis is a DNA process for almost all of a neuron's life., Competing Interests: Declaration of interests Patent applications filed by the Broad Institute of MIT and Harvard related to this work include subsets of the authors as inventors. S.A.M. has received compensation for scientific advice to Roche, Pfizer, Biogen, Vertex, and LoQus23 Therapeutics., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

The study aimed to understand the impact of the sonic-hedge signal pathway (SHH) on mouse neural stem cells. We manipulated the pathway using purmorphamine (Pur) and Gant 61 and observed the effects on cell viability, neurosphere formation, and gene expression. We found that activating the SHH pathway with Pur increased cell viability, neurosphere formation, and the expression of specific genes, promoting the differentiation of neural stem cells into mature cells. Conversely, inhibiting the SHH pathway with Gant61 decreased cell viability and neurosphere formation and suppressed differentiation. This suggests that the SHH pathway plays a crucial role in determining the fate of neural stem cells., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Corticotropin-releasing factor (CRF) is an important stress hormone, and because of the different distributions and functions of its receptors, CRF has various effects on the stress response of animals. CRF receptor 2 (CRFR2) is a functional receptor of CRF that may be related to appetite regulation and sex differences. In this study, male and female C57BL/6 mice were exposed to an ambient temperature of 4 °C, and feed intake were determined. Consequently, neuronal excitability, as well as the expression of CRFR2 and related genes in the brain were determined. As a result, 1) there were only significant changes in 2 h feed intake and rectal temperature in males; 2) neuronal excitability was elevated in the paraventricular thalamus (PVT) and paraventricular hypothalamic nucleus (PVH) brain regions of both male and female mice; 3) serum corticosterone and the expression of corticosterone receptors in the PVH were elevated in males but not in females; 4) the activation of the CRFR2 signal in the PVT and PVH brain regions differed by sex: the expression of CRFR2 was upregulated in male mice, and the phosphorylation of protein kinase B (AKT) and cAMP-response element binding protein (CREB) was significantly reduced; and 5) the cold-evoked eating behavior of male mice was abolished when CRFR2 in the PVT was knocked down. In summary, we conclude that male mice are more sensitive to cold stress than are female mice. The CRFR2/AKT/CREB signaling pathway in the PVT and PVH may mediate sex differences in the eating behavior of cold-exposed mice., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 International Brain Research Organization (IBRO). Published by Elsevier Inc. All rights reserved.)

Regulation of glutamate through glutamate-glutamine cycling is critical for mediating nervous system plasticity. Blast-induced traumatic brain injury (bTBI) has been linked to glutamate-dependent excitotoxicity, which may be potentiating chronic disorders such as post-traumatic epilepsy. The purpose of this study was to measure changes in the expression of astrocytic and neuronal proteins responsible for glutamatergic regulation at 4-, 12-, and 24 h in the cortex and hippocampus following single blast exposure in a rat model for bTBI. Animals were exposed to a blast with magnitudes ranging from 16 to 20 psi using an Advanced Blast Simulator, and western blotting was performed to compare changes in protein expression between blast and sham groups. Glial fibrillary acidic protein (GFAP) was increased at 24 h, consistent with astrocyte reactivity, yet no other proteins showed significant changes in expression at acute time points following blast (GS, GLT-1, GluN1, GluN2A, GluN2B). Therefore, these glutamate regulators likely do not play a major role in contributing to acute excitotoxicity or glial reactivity when analyzed by whole brain region. Investigation of substructural and subregional effects in future studies, particularly within the hippocampus (e.g., dentate gyrus, CA1, CA2, CA3), may reveal localized changes in expression and/or NMDAR subunit composition capable of potentiating bTBI molecular cascades. Nevertheless, alternative regulators are likely to demonstrate greater sensitivity as acute therapeutic targets contributing to bTBI pathophysiology following single blast exposure., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Background: RNA helicase MOV10 is highly expressed in postnatal brain and associates with FMRP and AGO2, suggesting a role in translation regulation in learning and memory., Results: We generated a brain-specific knockout mouse (Mov10 Deletion) with greatly reduced MOV10 expression in cortex and hippocampus. Behavior testing revealed enhanced fear memory, similar to that observed in a mouse with reduced brain microRNA production, supporting MOV10's reported role as an AGO2 cofactor. Cultured hippocampal neurons have elongated distal dendrites, a reported feature of augmin/HAUS over-expression in Drosophila da sensory neurons. In mitotic spindle formation, HAUS is antagonized by the microtubule bundling protein NUMA1. Numa1 mRNA is a MOV10 CLIP target and is among the genes significantly decreased in Mov10 Deletion hippocampus. Restoration of NUMA1 expression and knockdown of HAUS rescued phenotypes of the Mov10 Deletion hippocampal neurons., Conclusions: This is the first evidence of translation regulation of NUMA1 by MOV10 as a control point in dendritogenesis., Competing Interests: Declarations. Ethics approval and consent to participate: All work with animals was done in compliance with the Institutional Animal Care and Use Committee, IACUC protocols 19112 and 22113. Consent for publication: All authors consent to publication. Competing interests: The authors declare that they have no competing interests., (© 2025. The Author(s).)

The activity of neurons in the vicinity of tumors is linked to a spectrum of cellular mechanisms, including the facilitation of tumor cell proliferation, synapse formation, angiogenesis, and macrophage polarization. This review consolidates the current understanding of neuro-oncological regulation, underscoring the nuanced interplay between neurological and oncological processes (termed as Cancer-Neuroscience). First, we elucidated how the nervous system accelerates tumor growth, metastasis, and the tumor microenvironment both directly and indirectly through the action of signaling molecules. Importantly, neural activity is also implicated in modulating the efficacy of therapeutic interventions, including immunotherapy. On the contrary, the nervous system potentially has a suppressive effect on tumorigenesis, further underscoring a dual-edged role of neurons in cancer progression. Consequently, targeting specific signaling molecules within neuro-oncological regulatory pathways could potentially suppress tumor development. Future research is poised to explore the intricate mechanisms governing neuro-tumor interactions more deeply, while concurrently refining treatment strategies for tumors by targeting the crosstalk between cancer and neurons., Competing Interests: Declarations. Ethics approval and consent to participate: Not applicable. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Heme oxygenase 1 (HO-1), an enzyme involved in heme catabolism, has been shown upregulated in microglia cells and plays a critical roles in neurological damages after intracerebral hemorrhage (ICH). However, the mechanisms by which HO-1 mediates the neuronal damages are still obscure. Here, our findings demonstrate that HO-1 over-expression exacerbates the pro-inflammatory response of microglia and induces neuronal ferroptosis through promoting intracellular iron deposition in the ICH model both in vitro and in vivo. Furthermore, in the co-cultured ICH model in vitro, we verify that HO-1 over-expression disrupts the balance of iron metabolism in microglia, which increases the iron efflux to the extracellular space and promotes iron ion uptake in neurons, leading to lipid peroxidation injury and further contributing to neuronal ferroptosis. Moreover, the specific ferroptosis inhibitor Ferrostatin-1 (Fer-1) treatment could mitigate the damages in the co-cultured HT22 cells that caused by HO-1 over-expression in microglia, and improve the neurological function in the ICH model in mice. By shedding light on the mechanisms of aggravating neuronal ferroptosis due to HO-1 overexpression in the early stages after ICH, our study provides insights into the potential therapy of targeting HO-1 to treat ICH., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

Depression, a prevalent psychiatric disorder of ambiguous etiology and high heterogeneity, has been recently linked to the primary visual cortex (V1). However, the precise circuits mediating the impact of V1 on depressive-like behaviors are poorly understood. Here, we demonstrate that the V1, specifically the lateral posterior nucleus of the thalamus (LP)-projecting V1 glutamatergic subpopulation (Glu V1→LP neurons), shows reduced activity after chronic restraint stress (CRS) in male mice, leading to depressive-like behaviors. Optogenetic or chemogenetic activation of these neurons ameliorated depressive-like behaviors in CRS-depressed mice, whereas reducing activity exacerbated these behaviors. This reduction in Glu V1→LP neurons activity was predominantly due to a decrease in the guanine nucleotide-binding protein subunit gamma-4 (Gγ4). Overexpression of Gγ4 in the Glu V1→LP neurons produced antidepressant-like effects, suggesting that Gγ4 is a crucial regulator of mood. Collectively, these results reveal a V1→LP circuit that modulates depressive-like behaviors, suggesting potential targets for therapeutic interventions., Competing Interests: Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Autism spectrum disorder (ASD) is a neurodevelopmental disability condition arising from a combination of genetic and environmental factors. Despite the blood-brain barrier (BBB) serving as a crucial gatekeeper, conveying environmental influences into the brain parenchyma, the contributions of BBB in ASD pathogenesis remain largely uncharted. Here we report that SHANK3, an ASD-risk gene, expresses in the BBB-forming brain endothelial cells (BECs) and regulates tight junctional (TJ) integrity essential for BBB's barrier function. Endothelium-specific Shank3 (eShank3) knockout (KO) neonatal mice exhibit male-specific BBB-hyperpermeability, reduced neuronal excitability, and impaired ultra-sonic communications. Although BBB permeability is restored during adult age, the male mutant mice display reduced neuronal excitability and impaired sociability. Further analysis reveals that the BBB-hyperpermeability is attributed to the β-Catenin imbalance triggered by eShank3-KO. These findings highlight a pathogenic mechanism stemming from the ASD-risk Shank3, emphasizing the significance of neonatal BECs in the BBB as a potential therapeutic target for ASD., Competing Interests: Competing interests: The authors declare no competing interests., (© 2025. The Author(s).)

Using single-cell technologies on postmortem brains, Handsaker et al. 1 have demonstrated that substantial somatic expansion of the CAG repeat that causes Huntington's disease results in progressive transcriptional dysregulation and drives the loss of spiny projection neurons in the caudate., Competing Interests: Declaration of interests The author declares no competing interests., (Copyright © 2025 Elsevier Inc. All rights reserved.)

Background : Parkinson's disease (PD) is a neurodegenerative disorder characterized by the involvement of ferroptosis in its pathological mechanism. In this study, the effects and mechanism of BRCA1-associated protein 1 (BAP1) on neuronal ferroptosis in PD were evaluated. Methods : A PD mouse model was constructed by injecting mice with MPTP. Nissl staining, immunohistochemistry, immunofluorescence, and Prussian blue staining evaluated histopathology and iron distribution. The PD cell model was constructed by subjecting SK-N-SH cells to MPP + . The m6A level of BAP1 was assessed by MeRIP. mRNA levels of BAP1, FTO, IGF2BP1, METTL3, YTHDF2, and SLC7A11 were evaluated utilizing RT-qPCR. Protein levels of BAP1, FTO, IGF2BP1, METTL3, YTHDF2, SLC7A11, and p53 were measured by Western blot. Cell viability was assessed using CCK-8 assay, and TUNEL was used for assessing apoptosis. The levels of MDA, GSH, SOD, and Fe 2+ were also measured. The interactions among molecules were verified using RIP assay, dual luciferase reporter assay, and ChIP assay. Results : SK-N-SH cells treated with MPP + showed a decrease in overall m6A levels of BAP1. FTO facilitated m6A demethylation of BAP1, leading to an increased level of expression of BAP1. m6A-binding protein, YTHDF2 recognized and decayed methylated mRNA of BAP1, leading to the reduced BAP1 stability. The FTO/BAP1 axis promoted MPP + -induced ferroptosis by suppressing SLC7A11. BAP1, in collaboration with p53, reduced the level of expression of SLC7A11. Knocking down BAP1 mitigated ferroptosis in an MPTP mouse model. Conclusion : m6A-mediated modification of BAP1 regulates neuronal ferroptosis by cooperating with p53 to decrease the level of SLC7A11. Thus, BAP1 may be a potential therapeutic target for PD treatment.