Search

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP) 2 phen]Cl 2 and [Ru(dppz) 2 phen](PF 6 ) 2 have also been obtained. It is well-known that compound [Ru(dppz)(phen) 2 ]Cl 2 binds to DNA by intercalation. Therefore, we used [Ru(dppz) 2 phen]Cl 2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC 50 in the micro- or even nanomolar range (0.06-7 μM). Confocal microscopy studies showed that [Ru(DIP) 2 phen]Cl 2 and [Ru(DIP) 2 TAP]Cl 2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn) 2 phen](PF 6 ) 2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn) 2 phen](PF 6 ) 2 stands out for its very good IC 50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen) 2 (qdppz)] 2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG ( htel21 T 18 ), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T 10 -T 11 -A 12 . The two remaining wide lateral loops are linked through a third K + ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

[Ru(TAP) 2 (dppz)] 2+ (TAP = 1,4,5,8-tetraazaphenanthrene; dppz = dipyrido[3,2- a:2',3'- c]phenazine) is known to photo-oxidize guanine in DNA. Whether this oxidation proceeds by direct photoelectron transfer or by proton-coupled electron transfer is still unknown. To help distinguish between these mechanisms, spectro-electrochemical experiments have been carried out with [Ru(TAP) 2 (dppz)] 2+ in acetonitrile. The UV-vis and mid-IR spectra obtained for the one-electron reduced product were compared to those obtained by picosecond transient absorption and time-resolved infrared experiments of [Ru(TAP) 2 (dppz)] 2+ bound to guanine-containing DNA. An interesting feature of the singly reduced species is an electronic transition in the near-IR region (with λ max at 1970 and 2820 nm). Density functional and time-dependent density functional theory simulations of the vibrational and electronic spectra of [Ru(TAP) 2 (dppz)] 2+ , the reduced complex [Ru(TAP) 2 (dppz)] + , and four isomers of [Ru(TAP)(TAPH)(dppz)] 2+ (a possible product of proton-coupled electron transfer) were performed. Significantly, these predict absorption bands at λ > 1900 nm (attributed to a ligand-to-metal charge-transfer transition) for [Ru(TAP) 2 (dppz)] + but not for [Ru(TAP)(TAPH)(dppz)] 2+ . Both the UV-vis and mid-IR difference absorption spectra of the electrochemically generated singly reduced species [Ru(TAP) 2 (dppz)] + agree well with the transient absorption and time-resolved infrared spectra previously determined for the transient species formed by photoexcitation of [Ru(TAP) 2 (dppz)] 2+ intercalated in guanine-containing DNA. This suggests that the photochemical process in DNA proceeds by photoelectron transfer and not by a proton-coupled electron transfer process involving formation of [Ru(TAP)(TAPH)(dppz)] 2+ , as is proposed for the reaction with 5'-guanosine monophosphate. Additional infrared spectro-electrochemical measurements and density functional calculations have also been carried out on the free TAP ligand. These show that the TAP radical anion in acetonitrile also exhibits strong broad near-IR electronic absorption (λ max at 1750 and 2360 nm).

Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fiber diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)](2+) (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyrido[3,2-a:2',3'-c]phenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven data sets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.

The o-palladated, chloro-bridged dimers [Pd{2-phenylpyridine(-H)}-μ-Cl]2 and [Pd{N,N-dimethylbenzylamine(-H)}-μ-Cl]2 react with cyanuric acid in the presence of base to afford closed, chiral cage-molecules in which 12 organo-Pd(II) centers, located in pairs at the vertices of an octahedron, are linked by four tetrahedrally arranged cyanurato(3-) ligands. Incomplete (Pd10) cages, having structures derived from the corresponding Pd12 cages by replacing one pair of organopalladium centers with two protons, have also been isolated. Reaction of [Pd{2-phenylpyridine(-H)}-μ-Cl]2 with trithiocyanuric acid gives an entirely different and more open type of cage-complex, comprising only nine organopalladium centers and three thiocyanurato(3-) ligands: cage-closure in this latter system appears to be inhibited by steric crowding of the thiocarbonyl groups.

We report an atomic resolution X-ray crystal structure containing both enantiomers of rac-[Ru(phen)2dppz](2+) with the d(ATGCAT)2 DNA duplex (phen = phenanthroline; dppz = dipyridophenazine). The first example of any enantiomeric pair crystallized with a DNA duplex shows different orientations of the Λ and Δ binding sites, separated by a clearly defined structured water monolayer. Job plots show that the same species is present in solution. Each enantiomer is bound at a TG/CA step and shows intercalation from the minor groove. One water molecule is directly located on one phenazine N atom in the Δ-enantiomer only.

The different triplet sequences in high molecular weight aromatic copolyimides comprising pyromellitimide units ("I") flanked by either ether-ketone ("K") or ether-sulfone residues ("S") show different binding strengths for pyrene-based tweezer-molecules. Such molecules bind primarily to the diimide unit through complementary π-π-stacking and hydrogen bonding. However, as shown by the magnitudes of (1)H NMR complexation shifts and tweezer-polymer binding constants, the triplet "SIS" binds tweezer-molecules more strongly than "KIS" which in turn binds such molecules more strongly than "KIK". Computational models for tweezer-polymer binding, together with single-crystal X-ray analyses of tweezer-complexes with macrocyclic ether-imides, reveal that the variations in binding strength between the different triplet sequences arise from the different conformational preferences of aromatic rings at diarylketone and diarylsulfone linkages. These preferences determine whether or not chain-folding and secondary π-π-stacking occurs between the arms of the tweezer-molecule and the 4,4'-biphenylene units which flank the central diimide residue., (© 2011 American Chemical Society)

The synthesis of a dithiol-functionalized pyrene derivative is reported, together with studies of interactions between this receptor (and other related pyrenes) and nitroaromatic compounds (NACs), in both solution and in the solid state. Spectroscopic analysis in solution and X-ray crystallographic analysis of cocrystals of pyrene and NACs in the solid state indicate that supramolecular interactions lead to the formation of defined π-π stacked complexes. The dithiol-functionalized pyrene derivative can be used to modify the surface of a gold quartz crystal microbalance (QCM) to create a unique π-electron rich surface, which is able to interact with electron poor aromatic compounds. For example, exposure of the modified QCM surface to the nitroaromatic compound 2,4-dinitrotoluene (DNT) in solution results in a reduction in the resonant frequency of the QCM as a result of supramolecular interactions between the electron-rich pyrenyl surface layer and the electron-poor DNT molecules. These results suggest the potential use of such modified QCM surfaces for the detection of explosive NACs.

Pseudoacid chlorides of 2,5-bis(4-fluorobenzoyl) terephthalic acid and 4,6-bis(4-fluorobenzoyl) isophthalic acid condense with primary amines to afford diastereomeric bis(hydroxyindolinone)s in good isolated yields and with diamines to give high molecular weight poly(hydroxyindolinone)s. Bis-N-pyrenemethyl bis(hydroxyindolinone)s assemble, even in dipolar solvents such as DMSO, with macrocyclic diimide-sulfones to give [3]pseudorotaxanes stabilized by electronically complementary aromatic pi-pi-stacking and shape-complementary van der Waals interactions.

Cyclocondensations of aromatic diamines with 1,1'-bis(2,4-dinitrophenyl)-4,4'-bipyridinium salts afford doubly or quadruply charged, macrocyclic, N,N'-diarylbipyridinium cations. These are tolerant of a wide range of acids, bases, and nucleophiles, although they appear to undergo reversible, one-electron reduction by tertiary amines. Single-crystal X-ray analysis demonstrates the presence of a macrocycle conformation in which the 4,4'-bipyridinium and 4,4'-biphenylenedisulfonyl residues are suitably spaced and aligned for complexation with pi-donor arenes, and NMR studies in solution indeed confirm binding to 1,5-bis[hydroxy(ethoxy)ethoxy]naphthalene.

Sequence-specific binding is demonstrated between pyrene-based tweezer molecules and soluble, high molar mass copolyimides. The binding involves complementary pi-pi stacking interactions, polymer chain-folding, and hydrogen bonding and is extremely sensitive to the steric environment around the pyromellitimide binding-site. A detailed picture of the intermolecular interactions involved has been obtained through single-crystal X-ray studies of tweezer complexes with model diimides. Ring-current magnetic shielding of polyimide protons by the pyrene "arms" of the tweezer molecule induces large complexation shifts of the corresponding 1H NMR resonances, enabling specific triplet sequences to be identified by their complexation shifts. Extended comonomer sequences (triplets of triplets in which the monomer residues differ only by the presence or absence of a methyl group) can be "read" by a mechanism which involves multiple binding of tweezer molecules to adjacent diimide residues within the copolymer chain. The adjacent-binding model for sequence recognition has been validated by two conceptually different sets of tweezer binding experiments. One approach compares sequence-recognition events for copolyimides having either restricted or unrestricted triple-triplet sequences, and the other makes use of copolymers containing both strongly binding and completely nonbinding diimide residues. In all cases the nature and relative proportions of triple-triplet sequences predicted by the adjacent-binding model are fully consistent with the observed 1H NMR data.

The structure of the duplex d[CG(5-BrU)ACG](2) bound to 9-bromophenazine-4-carboxamide has been solved through MAD phasing at 2.0 A resolution. It shows an unexpected and previously unreported intercalation cavity stabilized by the drug and novel binding modes of Co(2+) ions at certain guanine N7 sites. For the intercalation cavity the terminal cytosine is rotated to pair with the guanine of a symmetry-related duplex to create a pseudo-Holliday junction geometry, with two such cavities linked through the minor groove interactions of the N2/N3 guanine sites at an angle of 40 degrees, creating a quadruplex-like structure. The mode of binding of the drug is shown to be disordered, with the major conformations showing the side chain bound to the N7 position of adjacent guanines. The other end of the duplex exhibits a terminal base fraying in the presence of Co(2+) ions linking symmetry-related guanines, causing the helices to intertwine through the minor groove. The stabilization of the structure by the intercalating drug shows that this class of compound may bind to DNA junctions as well as duplex DNA or to strand-nicked DNA ('hemi-intercalated'), as in the cleavable complex. This suggests a structural basis for the dual poisoning of topoisomerase I and II enzymes by this family of drugs.

Palladium-rhodium and platinum-rhodium heterobimetallic bridged dithiolate complexes of general formula [(P-P)M(&mgr;-S-S)Rh(COD)]ClO(4) (COD = 1,5-cyclooctadiene. For M = Pt: P-P = (PPh(3))(2) and S-S = EDT(2)(-) (1,2-ethanedithiolate) (1), PDT(2)(-) (1,3-propanedithiolate) (2), and BDT(2)(-) (1,4-buthanedithiolate) (3); P-P = dppb (1,4-bis(diphenylphosphino)butane) and S-S = EDT(2)(-) (4), PDT(2)(-) (5), and BDT(2)(-) (6); P-P = dppp (1,3-bis(diphenylphosphino)propane) and S-S = EDT(2)(-) (7), PDT(2)(-) (8), and BDT(2)(-) (9). For M = Pd: P-P = dppb and S-S = EDT(2)(-) (10), PDT(2)(-) (11), and BDT(2)(-) (12); P-P = dppp and S-S = EDT(2)(-) (13), PDT(2)(-) (14), and BDT(2)(-) (15)) have been prepared. The crystal structures for complexes 1-3, 6, 9, and 12 have been determined, and hinged structures were found with angles between local coordination planes MS(2)Rh ranging from 111.27 degrees for complex 1 to 151.34 degrees for complex 3. Metal-metal distances show nonbonding interactions between metals. X-ray data for 1: triclinic, P&onemacr;, a = 11.311(6) Å, b = 12.991(6) Å, c = 16.140(6) Å, alpha = 84.86(6) degrees, beta = 75.73(6) degrees, gamma = 86.43(6) degrees, Z = 2, R = 0.0427 (R(w) = 0.1151). X-ray data for 2: triclinic, P&onemacr;, a = 11.084(5) Å, b = 13.094(6) Å, c = 16.338(6) Å, alpha = 86.06(6) degrees, beta = 75.67(6) degrees, gamma = 88.55(6) degrees, Z = 2, R = 0.0470 (R(w) = 0.1264). X-ray data for 3: orthorhombic, Pbca, a = 14.439(6) Å, b = 19.807(6) Å, c = 38.156(6) Å, Z = 8, R = 0.0864 (R(w) = 0.2457). X-ray data for 6: monoclinic, P2(1)/c, a = 20.338(6) Å, b = 14.227(6) Å, c = 14.570(6) Å, beta = 100.94(6) degrees, Z = 4, R = 0.0536 (R(w) = 0.1449). X-ray data for 9: monoclinic, P2(1)/c, a = 20.326(6) Å, b = 14.109(6) Å, c = 14.368(6) Å, beta = 100.90(6) degrees, Z = 4, R = 0.0380 (R(w) = 0.0990). X-ray data for 12: monoclinic, P2(1)/c, a = 20.365(6) Å, b = 14.186(6) Å, c = 14.592(6) Å, beta = 101.04(6) degrees, Z = 4, R = 0.0507 (R(w) = 0.1500).