Search

The aqueous extracts of 30 out of 67 Chinese medicinal herbs were shown to have inhibitory effects on growth of Xanthomonas euvesicatoria by a paper disc diffusion assay. The inhibitory substances with the strongest antibacterial activity were extracted from Chinese sumac gallnut and black myrobalan. The aqueous extract of gallnut inhibited the growth of eight of the tested plant-pathogenic bacteria, and that of black myrobalan inhibited five. The gallnut extract produced at least an 8-mm inhibition zone against Acidovorax citrulli, Ralstonia solanacearum, X. citri pv. citri, and X. euvesicatoria at a 10-fold dilution, and it was still active at 800- to 1,600-fold dilutions. The aqueous extract of gallnut was more inhibitory than the acetone-water extract. To identify the inhibitory compounds in the gallnut aqueous extract, the crude extract was chromatographed over a silica column, and the primary compounds in fractions 3 and 8 were identified by nuclear magnetic resonance as gallic acid and methyl gallate, respectively. The inhibitory effect of methyl gallate on the growth of four plant-pathogenic bacteria was 10 to 80 times that of gallic acid. The minimum inhibition and minimum bactericidal concentration tests showed that the inhibition effect of the original aqueous was higher than that of methyl gallate. These results indicate that methyl gallate in gallnut is an important compound that is inhibitory to plant-pathogenic bacterial growth, and there are other unidentified compounds that are also responsible for the antibacterial effects. This is the first report regarding the antibacterial effects of gallnut extract and its chemical components on plant-pathogenic bacteria.

Many Calathea species in the family Marantaceae are beautiful ornamental plants with variegated foliage. Among them, C. picturata 'Argentea', an evergreen perennial that has pale green leaves with dark green margins and a red underside, is a popular houseplant in Taiwan. In 2004, a new foliage disease that caused leaf blight of C. picturata 'Argentea' was first observed in a nursery in southern Taiwan. Initial symptoms were tiny, brown spots that appeared on the leaves of all ages, which quickly enlarged and coalesced. These necrotic lesions spread to cover the entire leaves in high temperature and moisture conditions and caused leaves to shrivel and eventually die. A dematiaceous hyphomycete with multicelled conidia was consistently isolated from the diseased leaves after being surfaced sterilized with 10% Clorox and placed on vegetable juice agar (10% V8 juice, 0.02% CaCO 3 , and 2% agar [VJA]). Pathogenicity of the isolate was tested by spraying 'Argentea' calathea leaves with a conidia suspension (1.6 × 10 5 conidia/ml) prepared from a culture grown on VJA at 28°C for 7 days. Plant leaves sprayed with distilled water were used as a control. Three pots of 15-cm high 'Argentea' calathea plants were inoculated with 10 ml of a conidia suspension and the experiment was conducted twice at 28°C and 90% relative humidity in a growth chamber. Tiny, brown spots started to show on all inoculated leaves 5 days after inoculation and the progression of symptom development was similar to that observed in nature. Control leaves remained asymptomatic. The same dematiaceous hyphomycete fungus was reisolated from 13 of 16 disease tissues taken from four symptomatic leaves. A colony of the calathea isolate was olive green when grown on potato dextrose agar (PDA) and conidia production was observed 7 days after incubation in darkness. The conidiophores were either branches from or the ends of normal mycelium, some of them geniculate with conidium produced at each bend measuring 142 to 602 (340) × 3 to 6 (4) μm on disease tissues and 51 to 150 (103) × 3 to 5 (4) μm on PDA. Conidia were multicelled with protruding hilum at the base, terminal cells thickened, olivaceous brown or golden brown in fusiform shape with blunt tips, 5 to 11 septate on disease tissues and 6 to 11 septate on PDA, measuring 46 to 166 (95) × 8 to 19 (13) μm on disease tissues and 58 to 145 (94) × 6 to 15 (11) μm on PDA, germinating by producing germ tubes semiaxially from each end. Morphological characteristics of the calathea isolate fit the description of the genus Exserohilum (2). Comparison of rDNA internal transcribed spacer (ITS) sequence of the calathea isolate with those in GenBank revealed that it shared 99.5% (549 of 552) similarity with a published sequence (GenBank Accession No. EU571210) (3) and Exserohilum rostratum was its closest species. ITS sequence analysis was done as previously described (1). Morphological and molecular data identified the pathogen as E. rostratum (Drechs.) Leonard & Suggs (= Bipolaris rostrata (Drechs.) Shoemaker). To our knowledge, this is the first report of leaf blight caused by E. rostratum on C. picturata in Taiwan. References: (1) L. L. Chern et al. Plant Dis. 94:1164, 2010. (2) K. J. Leonard. Mycologia 68:402, 1976. (3) R. Sappapan et al. J. Nat. Prod. 71:1657, 2008.

Angelica (Angelica acutiloba (Siebold. & Zucc.) Kitag.) is one of the most important traditional Chinese medicines in Taiwan. The medicinal herb has been mainly imported from China, but cultivation at a commercial scale has also been established in recent years in Hualien County, Taiwan. In September 2008, angelica plants in a field at Liou-shih-dan Mountain displayed symptoms of yellowing, stunting, rotting of roots and basal stem, and wilting. A severe brown discoloration of vascular tissue along the stems of infected plants was observed. One or more Fusarium spp. was consistently isolated from the roots and stems of diseased plants. Isolates R3, R4, and R5 were incubated for 14 days on celery tissues to produce chlamydospores, and 33 g of celery tissue with chlamydospores were mixed with 500 ml of soil per pot as inoculum. One 4-month-old angelica seedling was planted per pot. Three angelica plants were inoculated with each isolate in the first test and nine plants were inoculated with each isolate in the second test. Other seedlings were inoculated with water as checks. Pathogenicity tests were conducted twice. Incidence of diseased plants was 66, 100, and 33% in the first test, and 66, 100, and 44% in the second test for the R3, R4, and R5 isolates, respectively. Symptoms similar to those on the diseased plants in the field were produced, with leaves turning yellow starting 7 days after inoculation and wilt and discoloration of roots 14 days after inoculation. Fusarium spp. also were reisolated from the diseased plants. Genomic DNA was extracted from mycelium with a fungal genomic DNA purification kit, and the internal transcribed spacer (ITS) rDNA region was amplified and sequenced with primers ITS-4 and ITS-5. The sequence of the resulting ~550-bp amplicon was compared with those in GenBank. The ITS sequences of the R3, R4, and R5 isolates shared 98.7, 98.7, and 97.9% similarity with F. solani isolate AF129104 (3), respectively. Phylogenetic analysis also showed that the three isolates were closer to F. solani than to other Fusarium species. Both macroconidia and microconidia of the R4 isolate were produced on potato dextrose agar. Macroconidia were three to five septate and 27.2 to 37.8 × 4.4 to 6.2 μm; microconidia were zero to one septate and 9.3 to 14.7 × 2.9 to 4.8 μm. Chlamydospores produced on celery juice agar were terminal or intercalary, solitary, in pairs or in chains, and 9.3 to 12.1 μm. Morphological characteristics identified the three isolates as F. solani (Martius) Snyder & Hansen according to Fu and Chang (2) and Chung et al. (1), which agrees with the ITS comparison. To our knowledge, this is the first report of root and basal rot caused by F. solani on angelica in Taiwan. References: (1) W. C. Chung et al. Plant Prot. Bull. 40:177, 1998. (2) C. H. Fu and T. T. Chang. Taiwan J. For. Sci. 14:223, 1999. (3) H. Suga et al. Mycol. Res. 104:1175, 2000.

Among 65 species of oriental medicinal plants tested, 39 contained substances inhibitory to conidial germination of Alternaria brassicicola, with the most inhibitory extract from speedweed (Polygonum perfoliatum). The inhibitory substances in dried speedweed were insoluble in water. However, the inhibitors were readily extracted with ethanol or methanol, but not with acetone, ether, or chloroform. The ethanol extract was very effective in controlling black leaf spot of spoon cabbage, Brassica campestris subsp. chinensis, caused by A. brassicicola. The inhibitory effect of the extract was not affected by treatment with anion exchange resins, but was partially reduced by cation exchange resins, indicating the presence of two inhibitory substances in the extract, one with a positive charge and the other with no charge on its molecule. The inhibitory substances in the extract were dialyzable with molecular weight minimums of 10,000 or 1,000, but not 500 or 100, suggesting that both inhibitors have molecular weights between 500 and 1,000.

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5' GCGGTTGTTCACCAGGTGTTTT 3') and 5B (5' ATGCACGCTACCTGGAAGTAT 3') specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 10 8 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.

Zamioculcas zamiifolia (Lodd.) Engl., commonly called 'ZZ' plant, is a monocotyledonous plant in the Araceae. It is a new introduction in the foliage plant industry worldwide and is an increasing popular ornamental foliage plant in Taiwan. In 2003, basal petiole rot and death of ZZ plants were found in two nurseries in southern Taiwan with 18% of the plants diseased at one nursery. Early symptoms were water soaking of the petiole base and a slight yellowing of the leaflets followed by browning of leaflets. As the disease progressed, the petiole base became dark brown, shriveled, collapsed, and eventually rotted. The surface of the roots and rhizomes of diseased plants were initially blackish brown followed by root rots and mortality of plants. A Phytophthora species was consistently isolated from diseased petioles, rhizomes, and roots on a selective medium (4). Two single zoospore isolates (2), each from a different nursery, were used for morphological and pathogenicity tests. The isolates were grown on vegetable juice agar (10% V8 juice, 0.02% CaCO 3 , and 2% agar [VJA]) at 28°C with 12-h irradiation for 10 days. Sporangia were nondeciduous, terminal or intercalary, and attached to irregularly or sympodially branched sporangiophores. Papillate sporangia were spherical to broadly ovoid or obpyriform, averaged 37.3 × 30.2 μm, and ranged from 23 to 55 μm in length by 17 to 46 μm in diameter, with a length/breadth ratio of 1.24 and a range of 1.1 to 1.4. Chlamydospores with walls 1 to 4 μm thick were terminal or intercalary, spherical, averaged 30.6 μm in diameter, and ranged from 18 to 46 μm. On the basis of the morphological characteristics above, Phytophthora nicotianae Breda de Haar. (synonym P. parasitica Dastur) was identified (1). Paired with known A1 and A2 mating types of P. cinnamomi on VJA, both P. nicotianae cultures were A2, forming oospores after 14 days in darkness at 28°C. Disease-free ZZ plants were propagated by rhizomes in 242-cm 3 round pots with 500 g of sterilized potting medium (vermiculite/peat moss/perlite = 1:2:1). Plants with 30 cm long petiole were used for inoculation. For the pathogenicity test, both isolates were grown on VJA plates sealed with Parafilm at 28°C in darkness. After 10 days, aerial mycelia with sporangia were scraped off the plates, placed in 10 ml of sterile distilled water at 8°C for 15 min to release zoospores. A zoospore suspension was adjusted to 10 4 zoospores/ml following enumeration with a microliter pipette (3) and 200 ml of the suspension was added to each pot, or rhizomes and roots were dipped in 400 ml of the suspension for 60 min and planted immediately. Ten plants were inoculated with either method and water was added to inoculated control plants. Water soaking of the petiole bases developed in 7 days and mortality occurred in 10 days in a screenhouse after plants were inoculated with either method. Control plants remained healthy and no petiole, root, or rhizome rots developed. P. nicotianae was isolated from the advancing lesions of the inoculated plants and both experiments were repeated. To our knowledge, this is the first report of basal petiole rot and plant kill of Zamioculcas zamiifolia caused by P. nicotianae. References: (1) D. C. Erwin and O. K. Ribeiro. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN, 1996. (2) W. C. Ho and W. H. Ko. Bot. Bull. Acad. Sin. 38:41, 1997. (3) W. H. Ko et al. Phytopathology 63:1206, 1973. (4) W. H. Ko et al. Trans. Br. Mycol. Soc. 71:496, 1978.

More than 21% of the Chinese herbs tested contained substances in their aqueous extracts inhibitory to conidial germination of the powdery mildew fungus Oidium murrayae. Extracts from Chinese rhubarb and Japanese knotweed were very effective in controlling powdery mildew on cucumber, pumpkin, and eggplant. The inhibitory substance in Chinese rhubarb was soluble in polar solvents and less soluble in nonpolar solvents. The inhibitor in the aqueous extract was not dialyzable in the membrane tubing with molecular weight cut-off of 14,000, but was exchangeable by anion but not cation exchange resins, indicating that the inhibitor has a molecular weight larger than 14,000 and negative charge on its molecule.