Search

The type II secretion system (T2SS) is widely exploited by proteobacteria to secrete enzymes and toxins involved in bacterial survival and pathogenesis. The outer membrane pore formed by the secretin OutD and the inner membrane protein OutC are two key components of the secretion complex, involved in secretion specificity. Here, we show that the periplasmic regions of OutC and OutD interact directly and map the interaction site of OutC to a 20-residue peptide named OutCsip (secretin interacting peptide, residues 139-158). This peptide interacts in vitro with two distinct sites of the periplasmic region of OutD, one located on the N0 subdomain and another overlapping the N2-N3' subdomains. The two interaction sites of OutD have different modes of binding to OutCsip. A single substitution, V143S, located within OutCsip prevents its interaction with one of the two binding sites of OutD and fully inactivates the T2SS. We show that the N0 subdomain of OutD interacts also with a second binding site within OutC located in the region proximal to the transmembrane segment. We suggest that successive interactions between these distinct regions of OutC and OutD may have functional importance in switching the secretion machine.

The Erwinia chrysanthemi genome is predicted to encode three systems, Nif, Isc and Suf, known to assist Fe/S cluster biogenesis and the CsdAE cysteine desulphurase. Single iscU, hscA and fdx mutants were found sensitive to paraquat and exhibited reduced virulence on both chicory leaves and Arabidopsis thaliana. Depletion of the whole Isc system led to a pleiotropic phenotype, including sensitivity to both paraquat and 2,2'-dipyridyl, auxotrophies for branched-chain amino acids, thiamine, nicotinic acid, and drastic alteration in virulence. IscR was able to suppress all of the phenotypes listed above in a sufC-dependent manner while depletion of the Isc system led to IscR-dependent activation of the suf operon. No virulence defects were found associated with csdA or nifS mutations. Surprisingly, we found that the sufC mutant was virulent against A. thaliana, whereas its virulence had been found altered in Saintpaulia. Collectively, these results lead us to propose that E. chrysanthemi possess the Fe/S biogenesis strategy suited to the physico-chemical conditions encountered in its host upon infection. In this view, the IscR regulator, which controls both Isc and Suf, is predicted to play a major role in the ability of E. chrysanthemi to colonize a wide array of different plants.

Erwinia chrysanthemi strain 3937 is a necrotrophic bacterial plant pathogen. Pectinolytic enzymes and, in particular, pectate lyases (Pels) play a key role in soft rot symptoms but the efficient colonization of plants by E. chrysanthemi requires additional factors. These factors include the harpin HrpN, the cellulase Cel5, proteases (Prts), flagellar proteins and the Sap system, involved in the detoxification of plant antimicrobial peptides. HrpN and flagellum are mostly involved in the early steps of infection whereas the degradative enzymes (Pels, Cel5, Prts) are mainly required in the advanced stages. Production of these virulence factors is tightly regulated by environmental conditions. This report shows that the nucleoid-associated protein Fis plays a pivotal role in the expression of the main virulence genes. Its production is regulated in a growth phase-dependent manner and is under negative autoregulation. An E. chrysanthemi fis mutant displays a reduced motility and expression of hrpN, prtC and the sap operon. In contrast, the expression of the cel5 gene is increased in this mutant. Furthermore, the induction of the Pel activity is delayed and increased during the stationary growth phase in the fis mutant. Most of these controls occur through a direct effect because purified Fis binds to the promoter regions of fis, hrpN, sapA, cel5 and fliC. Moreover, potassium permanganate footprinting and in vitro transcription assays have revealed that Fis prevents transcription initiation at the fis promoter and also transcript elongation from the cel5 promoter. Finally, the fis mutant has a decreased virulence. These results suggest a co-ordinated regulation by Fis of virulence factors involved in certain key steps of infection, early (asymptomatic) and advanced (symptomatic) phases.

Production of the essential virulence factors, called pectate lyases (Pels), in the phytopathogenic bacterium Erwinia chrysanthemi is controlled by a complex regulation system and responds to various stimuli, such as the presence of pectin or plant extracts, growth phase, temperature and iron concentration. The presence of pectin and growth phase are the most important signals identified. Eight regulators modulating the expression of the pel genes (encoding Pels) have been characterized. These regulators are organized in a network allowing a sequential functioning of the regulators during infection. Although many studies have been carried out, the mechanisms of control of Pel production by growth phase have not yet been elucidated. Here we report that a fis mutant of E. chrysanthemi showed a strong increase in transcription of the pel genes during exponential growth whereas induction of expression in the parental strain occurred at the end of exponential growth. This reveals that Fis acts to prevent an efficient transcription of pel genes at the beginning of exponential growth and also provides evidence of the involvement of Fis in the growth-phase regulation of the pel genes. By using in vitro DNA-protein interactions and transcription experiments, we find that Fis directly represses the pel gene expression at the transcription initiation step. In addition, we show that Fis acts in concert with KdgR, the main repressor responding to the presence of pectin compounds, to shut down the pel gene transcription. Finally, we find that active Fis is required for the efficient translocation of the Pels in growth medium. Together, these data indicate that Fis tightly controls the availability of Pels during pathogenesis by acting on both their production and their translocation in the external medium.

Full virulence of the pectinolytic enterobacterium Erwinia chrysanthemi strain 3937 depends on the production in planta of the catechol-type siderophore chrysobactin. Under iron-limited conditions, E. chrysanthemi synthesizes a second siderophore called achromobactin belonging to the hydroxy/carboxylate class of siderophore. In this study, we cloned and functionally characterized a 13 kb long operon comprising seven genes required for the biosynthesis (acs) and extracellular release (yhcA) of achromobactin, as well as the gene encoding the specific outer membrane receptor for its ferric complex (acr). The promoter of this operon was negatively regulated by iron. In a fur null mutant, transcriptional fusions to the acsD and acsA genes were constitutively expressed. Band shift assays showed that the purified E. chrysanthemi Fur repressor protein specifically binds in vitro to the promoter region of the acsF gene confirming that the metalloregulation of the achromobactin operon is achieved directly by Fur. The temporal production of achromobactin in iron-depleted bacterial cultures was determined: achromobactin is produced before chrysobactin and its production decreases as that of chrysobactin increases. Pathogenicity tests performed on African violets showed that achromobactin production contributes to the virulence of E. chrysanthemi. Thus, during infection, synthesis of these two different siderophores allows E. chrysanthemi cells to cope with the fluctuations of iron availability encountered within plant tissues. Interestingly, iron transport mediated by achromobactin or a closely related siderophore probably exists in other phytopathogenic bacterial species such as Pseudomonas syringae.

Erwinia chrysanthemi causes soft-rot diseases of various plants by enzymatic degradation of the pectin in plant cell walls. The linear regions of pectin are composed of an acidic sugar, D-galacturonic acid. The ramified regions of pectin also include neutral sugars, and are rich in L-rhamnose residues. E. chrysanthemi is able to degrade these polysaccharides, polygalacturonate and rhamnogalacturonate. In E. chrysanthemi, the production of pectinases acting on linear regions is induced in the presence of polygalacturonate by a mechanism involving the repressor KdgR. The induction of the two adjacent E. chrysanthemi genes, designated rhiT and rhiN, is maximal after the simultaneous addition of both polygalacturonate and L-rhamnose. The rhiT product is homologous to the oligogalacturonide transporter TogT of E. chrysanthemi. The rhiN product is homologous to various proteins of unknown function, including a protein encoded by the plant-inducible locus picA of Agrobacterium tumefaciens. Both rhiT and rhiN are highly induced during plant infection. Various data suggest that RhiT and RhiN are involved in rhamnogalacturonate catabolism. RhiN is able to degrade the oligomers liberated by the rhamnogalacturonate lyase RhiE. The induction of the rhiTN operon in the presence of polygalacturonate results from control by the repressor KdgR. The additional induction of these genes by rhamnose is directly mediated by RhaS, a protein homologous to the activator of rhamnose catabolism in Escherichia coli. The virulence of an E. chrysanthemi rhaS mutant towards different host plants was clearly reduced. In this phytopathogenic bacterial species, RhaS positively regulates the transcription of the rhaBAD operon, involved in rhamnose catabolism, of the rhiE gene and of the rhiTN operon. The regulator RhaS plays a larger role in E. chrysanthemi than in other enterobacteria. Indeed, the RhaS control is not restricted to the catabolism of rhamnose but is extended to the degradation of plant polysaccharides that contain this sugar.

We have studied the role of acidic pH as a barrier for the colonization of the plant apoplast by Erwinia chrysanthemi. A minitransposon containing a promoterless reporter gene, gus, was used for random mutagenesis of the bacterial genome. An acid-sensitive mutant, named BT119, was isolated and had the following differential features with respect to the wild-type strain: (i) inability to grow at pH

Production of the main virulence determinant pectate lyases (Pels) of the phytopathogenic bacterium Erwinia chrysanthemi is modulated by a complex regulatory network involving the repressor proteins KdgR, PecS and PecT and the activator systems Pir, ExpI-ExpR and CRP. Of these regulators, CRP and PecT are particularly important since the absence of CRP or a slight overproduction of PecT leads to a drastic reduction in synthesis of Pel species. Recently, it has been shown that production of Pel species is strongly reduced in an E. chrysanthemi hns mutant, suggesting an activator function of the nucleoid-associated protein H-NS in the expression of the pel genes. Here, we report that the reduced synthesis of Pel species in the hns mutant results from a negative control, exerted by H-NS, on the transcription of the regulatory gene pecT. This H-NS/PecT cascade regulation is one of the first elucidations of a positive effect of H-NS on target gene expression. Moreover, we found that H-NS also represses the expression of expI, expR and pel genes. H-NS control is the result of H-NS binding to extended regions within the pecT, expI, expR and pel genes. Investigation of the simultaneous binding of CRP, RNA polymerase (RNAP) and H-NS on the pelD gene revealed that these three proteins form a nucleoprotein com-plex. Together, these data indicate that, by exerting a negative control at multiple levels, H-NS plays a crucial role in the E. chrysanthemi pel regulatory network.

The bacterium Erwinia chrysanthemi, which causes soft rot disease on various plants, is able to use pectin as a carbon source for growth. Knowledge of the critical step in pectin catabolism which allows the entry of pectic oligomers into the cells is scarce. We report here the first example of a transport system involved in the uptake of pectic oligomers. The TogMNAB transporter of E. chrysanthemi is a member of the ATP-binding cassette (ABC) superfamily. TogM and TogN are homologous to the inner membrane components, TogA exhibits the signature of ABC ATPases and TogB shows similarity with periplasmic ligand-binding proteins. The TogMNAB transporter is a new member of the carbohydrate uptake transporter-1 family (CUT1, TC no. 3.1.1), which is specialized in the transport of complex sugars. The four genes, togM, togN, togA and togB, are apparently co-transcribed in a large operon which also includes the pectate lyase gene pelW. The transcription of the tog operon is induced in the presence of pectic derivatives and is affected by catabolite repression. It is controlled by the KdgR repressor and the CRP activator. The TogMNAB system is able to provide Escherichia coli with the ability to transport oligogalacturonides. In E. chrysanthemi, the TogMNAB system seems to play a major role in switching on the induction of pectin catabolism. TogB also acts as a specific receptor for chemotaxis towards oligogalacturonides. The decreased capacity of maceration of a togM mutant indicates the importance of transport and/or attraction of oligogalacturonides for E. chrysanthemi pathogenicity.

Erwinia chrysanthemi causes soft rot of plants by secreting pectinases which cleave pectin, a polysaccharide cementing the plant cell wall constituents. We demonstrated that two transporters mediate the uptake of the extracellularly formed oligomers in E. chrysanthemi. TogMNAB, a multicomponent transporter member of the ATP-binding cassette (ABC) superfamily, is only partially responsible for the uptake of pectic oligomers. Its action is completed by that of the second transporter, TogT, a member of the glycoside-pentoside-hexuronide (GPH) family (TC no. 2.2) which includes transporters involved in the uptake of complex sugars, mostly oligosaccharides and glycosides. Each transport system, TogMNAB and TogT, is able to independently mediate the transport of oligogalacturonides and the simultaneous inactivation of both is necessary to give a total absence of growth with pectin as the carbon source. The togT gene constitutes an independent transcriptional unit. Its expression is induced in the presence of pectic derivatives and it is subject to catabolite repression. In vitro, the repressor KdgR and the activator CRP both interact directly with the togT regulatory region. The decreased pathogenicity of single and double togT, togM mutants indicated that a deficiency in uptake of pectic oligomers leads to reduced bacterial multiplication which, in turn, limits plant maceration.

Erwinia chrysanthemi causes soft-rot disease in a great variety of plants. In addition to the depolymerizing activity of plant cell wall-degrading enzymes, iron acquisition and resistance to oxidative stress contribute greatly to the virulence of this pathogen. Here, we studied the pin10 locus originally thought to encode new virulence factors. The sequence analysis revealed six open reading frames that were homologous to the Escherichia coli sufA, sufB, sufC, sufD, sufS and sufE genes. Sequence similarity searching predicted that (i) SufA, SufB, SufD, SufS and SufE proteins are involved in iron metabolism and possibly in Fe-S cluster assembly; and (ii) SufC is an ATPase of an ABC transporter. The reverse transcription-polymerase chain reaction procedure showed that the sufABCDSE genes constitute an operon. Expression of a sufB:uidA fusion was found to be induced in iron-deficient growth conditions and to be repressed by the iron-sensing Fur repressor. Each of the six suf genes was inactivated by the insertion of a cassette generating a non-polar mutation. The intracellular iron level in the sufA, sufB, sufC, sufS and sufE mutants was higher than in the wild type, as assessed by increased sensitivity to the iron-activated antibiotic streptonigrin. In addition, inactivation of sufC and sufD led to increased sensitivity to paraquat. Virulence tests showed that sufA and sufC mutants exhibited reduced ability to cause maceration of chicory leaves, whereas a functional sufC gene was necessary for the bacteria to cause systemic invasion of Saintpaulia ionantha. The E. coli sufC homologue was inactivated by reverse genetic. This mutation was found to modify the soxR-dependent induction of soxS gene expression. We discuss the possibility that SufC is a versatile ATPase that can associate either with the other Suf proteins to form a Fe-S cluster-assembling machinery or with membrane proteins encoded elsewhere in the chromosome to form an Fe-S ABC exporter. Overall, these results stress the importance of the connection between iron metabolism and oxidative stress during the early steps of infection by E. chrysanthemi.

The expI-expR locus drives a quorum-sensing system in the phytopathogenic bacterium, Erwinia chrysanthemi. Purified ExpR, an N-acyl homoserine lactone-responsive regulatory protein, binds to the promoter/operator region of the expI and expR genes. DNase I footprinting experiments showed that ExpR protects the regions between -66 and -40 from the P1 transcription initiation site of expl and between -54 and -18 from the expR transcription initiation site P1. The protected region overlaps the two expR promoters, P1 and P2, suggesting that ExpR exerts a negative control on its own gene expression. This assertion is reinforced by the fact that the addition of OHHL dissociates the ExpR-expR DNA complex. In contrast, the location of the ExpR binding site on the expI gene suggests an activator function, as reported for the pel genes. Moreover, ExpR is able to induce DNA bending. In vivo and in vitro studies revealed that CRP functions as an activator of expR expression, but as a repressor of expI transcription. A second level of control of expR and expI occurs through the PecS repressor, a regulator of pectinase synthesis. PecS represses expI expression, while ExpR activates pecS transcription, suggesting the existence of a mutual control between pecS and the expI-expR system in E. chrysanthemi. Regulation of pectinase synthesis in soft rot Erwinia appears to be a complex network of multiple cross-acting regulatory elements. A model that integrates these regulatory elements is proposed.

The plant pathogen Erwinia chrysanthemi produces three acyl-homoserine lactones (acyl-HSLs). One has been identified as N-(3-oxohexanoyl)-homoserine lactone (OHHL), and the two others were supposed to be N (hexanoyl)-homoserine lactone (HHL) and N-(decanoyl)-homoserine lactone (DHL). The genes for a quorum-sensing signal generator (expI) and a response regulator (expR) were cloned. These genes are convergently transcribed and display high similarity to the expI-expR genes of Erwinia carotovora. ExpI is responsible for both OHHL and HHL production. Inactivation of expl had little effect on pectinase synthesis in E. chrysanthemi, as expression of only two of the pectate lyase genes, pelA and pelB, was decreased. E. chrysanthemi expR mutants still produced acyl-HSL and pectinases. However, gel shift and DNAse I footprinting experiments showed that the purified E. chrysanthemi ExpR protein binds specifically to the promoter regions of the five major pel genes. Addition of OHHL modified the ExpR-DNA bandshift profiles, indicating that ExpR interacts with OHHL and binds to DNA in different ways, depending on the OHHL concentration. Localization of the ExpR binding sites just upstream of promoter regions suggests that ExpR functions as an activator of pel expression in the presence of OHHL. The absence of a phenotype in expR mutants strongly suggests that at least an additional interchangeable ExpR homologue exists in E. chrysanthemi. Finally, transcription of expI::uidA and expR::uidA fusions is dependent on the population density, suggesting the existence of a quorum-sensing hierarchy in E. chrysanthemi. These results suggest that the expI-expR locus is part of a complex autoregulatory system that controls quorum sensing in E. chrysanthemi.

The type II or Sec-dependent secretion system is used by diverse Gram-negative bacteria for secretion of extracellular proteins. Of the 12-15 proteins involved in secretion, the requirement for many has not been demonstrated and little is known about their functions in the secretion process. The plant pathogens Erwinia chrysanthemi and Erwinia carotovora secrete extra-cellular pectate lyases (Pels) using the type II or Out pathway. However, these two bacteria cannot secrete Pels encoded by heterologously expressed genes from the other species, suggesting the presence of species-specific recognition factors in the Out systems of the two Erwinia species. We previously reported the isolation of a cosmid clone, pCPP2OO6, from E. chrysanthemi EC16, which enables Escherichia coil to secrete heterologously expressed E. chrysanthemi Pels. Sequencing in a region required for secretion revealed the presence of 12 genes, outC-M and outO. We report here the construction of functionally non-polar mutations in each gene in the outC-M operon and outS and outB using a polA(ts) strain of E. coli to facilitate homologous recombination between out genes carrying deletions and their wild-type copies on pCPP2006. By testing for complementation of each deletion with wild-type out genes from E. chrysanthemi EC16 and E. carotovora SCRI193 we have demonstrated that: (i) each out gene is required for secretion of E. chrysanthemi PelE from E. coli with the exception of outH; (ii) each mutation can be complemented by its homologue from E. carotovora, except for outC and outD; (iii) outC and outD from E. carotovora do not confer secretion of Pel1 on the E. chrysanthemi Out system; and (iv) Pel1 secretion can be conferred on the E. chrysanthemi Out system by the presence of outC-M, S and B from E. carotovora. The data suggest that OutC and OutD are gatekeepers of the Out system involved in recognition of Pels targeted for secretion but that OutC and OutD from E. carotovora cannot be successfully assembled into the E. chrysanthemi Out system.

The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE-anion exchange and TSK-heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (pl = 6.5). Gel-filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS-regulated genes. The interaction between the PecS protein and its DNA-binding site was characterized by a relatively low affinity (about 10(-8) M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS-regulated genes. Alignment of these PecS-binding sites did not show a well-conserved consensus sequence. Immunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi-specific factors able to potentiate PecS protein activity in vivo.

In planta expression of a high-affinity iron-uptake system involving the siderophore chrysobactin in Erwinia chrysanthemi 3937 contributes greatly to invasive growth of this pathogen on its natural host, African violets. A previous study reported that global regulation by iron in this strain was mediated at the transcriptional level via the cbr locus which, when inactivated by insertional mutation, prevents the chrysobactin system from being tightly repressed by FeCl3. Herein, we report the nucleotide sequence of this locus and the functional analysis of its encoded products. Sequence analysis of a 4.8 kb genomic segment of a plasmid encompassing the cbr locus and characterization of the cognate translated products made it possible to uncover a system exhibiting similarity with prokaryotic transporters implicated in the transport of iron complexes. Accordingly, the CbrA product was shown to be the periplasmic component of a permease complex also including two integral membrane proteins, CbrB and CbrC, and the ATP-binding unit CbrD. This system allowed internalization of Fe(III) when supplied to bacterial cells as 59FeCl3 or 59Fe dicitrate, via complexation to a second siderophore recently detected in strain 3937. Most notably, we demonstrate that this second siderophore-mediated iron-acquisition system is operational in bacterial cells grown in the presence of FeCl3. The regulatory effect of cbr was further assessed on a lacZ chrysobactin operon fusion indicating that the transcriptional control exerted by cbr on expression of the chrysobactin system is of homeostatic nature. in conclusion, E. chrysanthemi provides an interesting model in which iron acquisition involves an inductive process resulting in differential expression of two siderophore-mediated pathways in relation to external iron accessibility.

Systemic virulence of the phytopathogen Erwinia chrysanthemi 3937 requires a functional iron assimilation system which, in this enterobacterium, is mediated by the siderophore chrysobactin and the outer membrane transport protein Fct. We investigated the regulation of this system by iron. No direct similarity with the Escherichia coli fur gene was found. Insertional mutagenesis allowed isolation of a regulatory mutant which expressed chrysobactin and two other high-affinity iron transport systems previously characterized in strain 3937, regardless of the iron level. RNA/DNA hybridization analysis established that regulation of chrysobactin by iron occurs at the transcriptional level. From a wild-type gene library, a recombinant cosmid able to restore normal regulation in the mutant strain was isolated. By generating a series of subclones and mini-Mulac insertions, we identified a regulatory locus (cbr) extending beyond c. 2.5kb which encodes two polypeptides, CbrA and CbrB, with molecular weights of 34,000 and 55,000 respectively. Functional analysis of the locus suggests that the cognate genes cbrA and cbrB are clustered within an operon. Their expression was studied through chromosomal lac gene fusions, in the presence of plasmid-borne wild-type constructions, under high- and low-iron conditions. In summary, the data show that in the presence of iron, cbr negatively regulates the chrysobactin biosynthetic and transport genes, while under conditions of depletion, cbr is subject to negative autogeneous regulation.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

Erwinia chrysanthemi, a Gram-negative phythopathogenic bacterium, secretes two related extracellular metalloproteases, B and C, which do not have N-terminal signal sequences. The specific pathway by which they are secreted, which has been reconstituted in Escherichia coli, comprises three proteins -- PrtD, PrtE and PrtF. Hybrid proteins containing segments of these proteins fused to the C-terminus of protease B were purified and used to immunize rabbits. The antisera thus obtained were used to study the location and membrane topology of the three proteins. PrtD and PrtE were found to cofractionate almost exclusively with the cytoplasmic membrane, whereas PrtF was found to co-fractionate mostly with the outer membrane. Proteinase K accessibility experiments as well as sequence data lead us to propose that PrtF has one or both ends exposed to the periplasm, that PrtE has one transmembrane segment with its amino-terminus facing the cytoplasm and its C-terminal hydrophilic domain exposed to the periplasm, and that PrtD has six transmembrane segments with its N-terminus and its C-terminal hydrophilic domain in the cytoplasm.

Twenty of the twenty-two MudII1734 insertions impairing the chrysobactin iron-assimilation system of Erwinia chrysanthemi 3937 were localized to a 50 kbp genomic insert contained in the R-prime plasmid, R'4 (Enard et al., 1988). Using the conjugative plasmid pULB110 (RP4::mini-Mu) and the generalized transducing phage phi EC2, we located this iron-transport region and the two unlinked mutations on the chromosome linkage map. Chrysobactin is a catechol-type siderophore and, as we have previously observed with the entA locus of Escherichia coli, the E. chrysanthemi-derived R'4 was found to complement E. coli entB and entE mutations. A 2.9 kb EcoRi and a 4.8 kb BamHI fragment in the R'4 sharing homology with the E. coli entCEBAP15 operon DNA were subcloned. These fragments were used as DNA/DNA hybridization probes to screen a wild-type gene library, yielding a recombinant cosmid (pEC7) able to complement mutations disrupting the 2,3-dihydroxybenzoic acid biosynthetic pathway in both Erwinia and Escherichia spp. as well as the E. coli entE mutation. Physical mapping of the genomic MudII1734 insertions corresponding to these mutations led to the identification of a cluster of genes confined to a DNA sequence of about 10 kb required for both biosynthetic and receptor functions.