Search

Maf proteins are basic-leucine zipper transcription factors belonging to the AP1 superfamily. Several developmental processes require Maf proteins yet, the redundancy or complementarity of their respective roles in common processes has been only partially investigated. We present for the first time a complete comparative analysis of maf gene expression patterns in vertebrates. Expression of c-maf, mafB/kreisler, mafA/L-maf, mafF, mafG and mafK was analyzed by whole-mount in situ hybridization within chick embryos and their extraembryonic tissues ranging from embryonic day (E) 1 to 7. We carefully examined the extent of overlap between distinct maf genes and report that the developing lens, kidney, pancreas and apoptotic zones of limb buds show sustained co-expression of large maf genes. Small maf genes also exhibit overlap, for example in the dermomyotome. We also describe so far unidentified sites of maf gene expression. mafA is found in the developing neural tube and dorsal root ganglia. c-maf hybridization is detected in the neuroretina, the notochord and the endothelium of extraembryonic blood vessels.

TCF11 (also known as Nrf1 and LCR-F1) is a basic-region leucine-zipper (b-ZIP) transcription factor that is essential during embryonic development. We have carried out expression analysis at a number of developmental stages and find that while there is some localized elevated expression between 8 and 9 days post coitum (dpc), the gene is widely expressed with a constant level of mRNA transcripts detectable in all tissues and at all stages examined. However, this does not reflect the specific nature of a TCF11 mutant phenotype (EMBO J. 17 (1998) 1779) which shows an essential role in foetal liver haematopoiesis. The specificity of TCF11 function may be controlled at a post-transcriptional level including availability of, and specific interaction with, a range of potential heterodimerization partners. We therefore carried out expression analysis of four candidate partner molecules; the three small Maf genes and another bZIP transcription factor found to bind to TCF11 in a two-hybrid screen, ATF4. We show different patterns of expression for the three Maf genes during development with MafG being widely expressed, MafK expressed only later in development and in specific tissues, and no detection of MafF. ATF4 shows evidence of complex regulation during development and shows elevated expression in many of the same sites as TCF11.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term., (Copyright 1999 Academic Press.)