Search

This study describes the development of a SNP typing system for human identification in the Thai population, in particular for extremely degraded DNA samples. A highly informative SNP marker set for forensic identification was identified, and a multiplex PCR-based Invader assay was developed. Fifty-one highly informative autosomal SNP markers and three sex determination SNP markers were amplified in two multiplex PCR reactions and then detected using Invader assay reactions. The average PCR product size was 71 base pairs. The match probability of the 54-SNP marker set in 124 Thai individuals was 1.48×10(-21), higher than that of STR typing, suggesting that this 54-SNP marker set is beneficial for forensic identification in the Thai population. The selected SNP marker set was also evaluated in 90 artificially degraded samples, and in 128 naturally degraded DNA samples from real forensic casework which had shown no profiles or incomplete profiles when examined using a commercial STR typing system. A total of 56 degraded samples (44%) achieved the matching probability (PM) equivalent to STR gold standard analysis (successful genotyping of 44 SNP markers) for human identification. These data indicated that our novel 54-SNP marker set provides a very useful and valuable approach for forensic identification in the Thai population, especially in the case of highly to extremely degraded DNA. In summary, we have developed a set of 54 Thai-specific SNPs for human identification which have higher discrimination power than STR genotyping. The PCRs for these 54 SNP markers were successfully combined into two multiplex reactions and detected with an Invader assay. This novel SNP genotyping system also yields high levels of genetic information from naturally degraded samples, even though there are much more difficult to recover than artificially degraded samples., (Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.)

Background & Aims: We performed a genome-wide association study (GWAS) of hepatitis C virus (HCV)-induced liver cirrhosis (LC) to identify predictive biomarkers for the risk of LC in patients with chronic hepatitis C (CHC)., Methods: A total of 682 HCV-induced LC cases and 1045 CHC patients of Japanese origin were genotyped by Illumina Human Hap 610-Quad bead Chip., Results: Eight SNPs which showed possible associations (p<1.0 × 10(-5)) at the GWAS stage were further genotyped using 936 LC cases and 3809 CHC patients. We found that two SNPs within the major histocompatibility complex (MHC) region on chromosome 6p21, rs910049 and rs3135363, were significantly associated with the progression from CHC to LC (pcombined=9.15 × 10(-11) and 1.45 × 10(-10), odds ratio (OR)=1.46 and 1.37, respectively). We also found that HLA-DQA1(*)0601 and HLA-DRB1(*)0405 were associated with the progression from CHC to LC (p=4.53 × 10(-4) and 1.54 × 10(-4) with OR=2.80 and 1.45, respectively). Multiple logistic regression analysis revealed that rs3135363, rs910049, and HLA-DQA1(*)0601 were independently associated with the risk of HCV-induced LC. In addition, individuals with four or more risk alleles for these three loci have a 2.83-fold higher risk for LC than those with no risk allele, indicating the cumulative effects of these variations., Conclusions: Our findings elucidated the crucial roles of multiple genetic variations within the MHC region as prognostic/predictive biomarkers for CHC patients., (Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.)

We performed a replication study of the 2 genetic variants, rs2814707 on 9p21.2 and rs12608932 on 19p13.3 that are recently reported to be most significantly associated with sporadic amyotrophic lateral sclerosis (ALS) in Caucasians. Both rs12608932 and rs2814707 showed no evidence of association in Japanese and Chinese (rs12608932, combined p = 0.58, odds ratio [OR] = 1.03, 95% confidence interval [CI] 0.93-1.13; rs2814707, combined p = 0.88, OR = 1.10, 95% CI 0.93-1.30). The association of these loci with susceptibility to sporadic ALS is considered negative in East Asians., (Copyright © 2011 Elsevier Inc. All rights reserved.)

Glutathione S-transferases (GSTs) play a vital role in the phase II biotransformation of many chemicals, including anticancer drugs. In this study, to elucidate the haplotype structures of the two closely related alpha-class genes GSTA1 and GSTA2, we screened for genetic variation in 214 Japanese colorectal cancer patients who received oxaliplatin-based chemotherapy. By direct resequencing of the 5'-flanking region, all the exons, and their flanking introns for 107 patients, 29 and 27 variants were identified in GSTA1 and GSTA2, respectively. The known functional single nucleotide polymorphisms (SNPs) -567T>G, -69C>T, and -52G>A in GSTA1*B were found at allele frequencies of 0.140. Of the four major GSTA2 allelic variants reported previously (GSTA2*A, *B, *C, and *E), only GSTA2*B (frequency = 0.154), *C (0.706), and *E (0.140) were detected. Following linkage disequilibrium analysis, haplotypes of both genes were separately estimated. Then, rapid genotyping methods for 7 and 6 SNPs tagging common haplotypes of GSTA1 and GSTA2, respectively, were developed using the single-base extension assay, and an additional 107 patients were genotyped. Finally, haplotype combinations of both genes were classified into 3 major types: GSTA1*A-GSTA2*C, GSTA1*A-GSTA2*B, and GSTA1*B-GSTA2*E. These findings will be useful in pharmacogenomic studies on xenobiotics including anticancer drugs.

The bile salt export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns. Three novel nonsynonymous variations, 361C>A (Gln121Lys), 667C>T (Arg223Cys), and 1460G>T (Arg487Leu), were found as heterozygotes and at 0.004 allele frequencies. These data provide fundamental and useful information for genotyping ABCB11 in the Japanese and probably other Asian populations.

Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences. MAFs of 79A>C (Lys27Gln) were 0.153 in Koreans and 0.327 in Caucasian-Americans, 0.204 in Japanese, 0.155 in Chinese-Americans and 0.087 in African-Americans. MAFs of 208G>A (Ala70Thr) were 0.005 in Koreans and 0.022 in Japanese and the minor allele was not detected in Chinese-Americans, Caucasian-Americans or African-Americans. Thus possibly, MAF of 208G>A in Japanese is likely to be somewhat higher than in Koreans and Chinese-Americans. These data would provide fundamental and useful information for pharmacogenetic studies on cytidine deaminase-catalyzing drugs.

The multidrug resistance-associated protein 2 (MRP2) encoded by the ABCC2 gene is expressed in the liver, intestine and kidneys and preferentially exports organic anions or conjugates with glucuronide or glutathione. In this study, all 32 exons and the 5'-flanking region of ABCC2 in 236 Japanese were resequenced, and 61 genetic variations including 5 novel nonsynonymous ones were detected. A total of 64 haplotypes were determined/inferred and classified into five *1 haplotype groups (*1A, *1B, *1C, *1G, and *1H) without nonsynonymous substitutions and *2 to *9 groups with nonsynonymous variations. Frequencies of the major 4 haplotype groups *1A (-1774delG), *1B (no common SNP), *1C (-24C>T and 3972C>T), and *2 [1249G>A (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. This study revealed that haplotype *1A, which has lowered activity, is quite common in Japanese, and that the frequency of *1C, another functional haplotype, was comparable to frequencies in Asians and Caucasians. In contrast, the haplotypes harboring 3972C>T but not -24C>T (*1G group), which are reportedly common in Caucasians, were minor in Japanese. Moreover, the allele 1446C>T (Thr482Thr), which has increased activity, was not detected in our Japanese population. These findings imply possible differences in MRP2-mediated drug responses between Asians and Caucasians.

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78&#95;+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78&#95; +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.

Transcriptional factor Nrf2 and its cytosolic reservoir protein Keap1 play important roles in induction of the expression of genes for xenobiotic metabolism and disposition, many of which are involved in protection from oxidative stress. In this study, 5 NFE2L2 (encoding Nrf2) and 6 KEAP1 exons and their flanking introns were comprehensively screened for genetic variations in 84 Japanese subjects. As for NFE2L2, 14 genetic variations were found, including 9 novel ones: 7 were located in the 5'-flanking region, 1 in the 5'-untranslated region (5'-UTR), 3 (1 synonymous and 2 nonsynonymous) in the coding exons, 1 in the intron, and 2 in the 3'-UTR. Two novel nonsynonymous variations, 697C>T (Pro233Ser) and 1094G>T (Ser365Ile), were heterozygously found with allele frequencies of 0.012 and 0.006, respectively. Regarding KEAP1, 18 genetic variations were detected, including 13 novel ones: 2 were located in the 5'-flanking region, 4 in the coding exons (4 synonymous), 5 in the introns, 4 in the 3'-UTR, and 3 in the 3'-flanking region. Based on the linkage disequilibrium (LD) profiles, both genes were analyzed as single LD blocks, where 14 (NFE2L2) and 18 (KEAP1) haplotypes were inferred. Six (NFE2L2) and 5 (KEAP1) haplotypes were relatively prevalent (>or=0.03 frequencies) and accounted for >or=88% of the inferred haplotypes. Haplotype-tagging variations of each gene were identified to capture these prevalent haplotypes. These data would be fundamental and useful information for pharmacogenetic studies on Nrf2-regulated genes for xenobiotic metabolism and disposition.

Multidrug resistance-related protein 1 (MRP1), an ATP-binding cassette transporter encoded by the ABCC1 gene, is expressed in many tissues, and functions as an efflux transporter for glutathione-, glucuronate- and sulfate-conjugates as well as unconjugated substrates. In this study, the 31 exons and their flanking introns of ABCC1 were comprehensively screened for genetic variations in 153 Japanese subjects to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCC1 that is necessary for pharmacogenetic studies of the substrate drugs. Eighty-six genetic variations including 31 novel ones were found: 1 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 20 in the coding exons (9 synonymous and 11 nonsynonymous variations), 4 in the 3'-UTR, and 60 in the introns. Of these, eight novel nonsynonymous variations, 726G>T (Trp242Cys), 1199T>C (Ile400Thr), 1967G>C (Ser656Thr), 2530G>A (Gly844Ser), 3490G>A (Val1164Ile), 3550G>A (Glu1184Lys), 3901C>T (Arg1301Cys), and 4502A>G (Asp1501Gly), were detected with an allele frequency of 0.003. Based on the LD profiles, the analyzed regions of the gene were divided into five LD blocks (Blocks -1 and 1 to 4). The multiallelic repeat polymorphism in the 5'-UTR was defined as Block -1. For Blocks 1, 2, 3 and 4, 32, 23, 23 and 13 haplotypes were inferred, and 9, 7, 7 and 6 haplotypes commonly found on > or = 10 chromosomes accounted for > or = 91% of the inferred haplotypes in each block. Haplotype-tagging single nucleotide polymorphisms for each block were identified to capture the common haplotypes. This study would provide fundamental and useful information for the pharmacogenetic studies of MRP1-dependently effluxed drugs in Japanese.

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122&#95;+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122&#95;+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362&#95;2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173&#95;176delTTAG, IVS5-181&#95;-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362&#95;2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese.

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803&#95;-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703&#95;1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703&#95;1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

Forty-eight single nucleotide variations, including 27 novel ones, were found in the 5'- regulatory region, all of the exons and their surrounding introns of CYP2C19 in 253 Japanese subjects (134 diabetic patients and 119 healthy volunteers). Identified novel variations were as follows: -2772G>A, 2767&#95;-2760delGGTGAACA, -2720T>C, -2547delG, -2545G>T, -2545&#95;-2544 delGC, and -2040C>T in the enhancer region; -778C>T, -777G>A, -529G>C, -189C>A, and -185A>G in the promoter region; 151A>G (S51G), 481G>C (A161P), 986G>A (R329H), 1078G>A (D360N), and 1119C>T (D373D) in the exons, and IVS1+128T>A, IVS3+163G>A, IVS4+271A>G, IVS5-49A>G, IVS6-210C>T, IVS6-196T>A, IVS6-32T>A, IVS7+84G>A, IVS7-174C>T, and IVS8+64C>T in the introns. Since we found no significant differences in the variation frequencies between healthy volunteers and diabetic patients, the data for all subjects were treated as one group in further analysis. The allele frequencies were 0.265 for IVS6-196T>A, 0.045 for -2772G>A and -2720T>C, 0.024 for -2040C>T, 0.014 for IVS7-174C>T, 0.010 for -529G>C, 0.006 for IVS1+128T>A and 481G>C (A161P), 0.004 for -2767&#95;-2760delGGTGAACA and IVS6-210C>T, and 0.002 for the other 17 variations. In addition, the two known nonsynonymous single nucleotide polymorphisms, 681G>A (splicing defect, (*)2 allele) and 636G>A (W212X; (*)3 allele) were detected at 0.267 and 0.128 frequencies, respectively. No variation was detected in the known binding sites for constitutive androstane receptor and glucocorticoid receptor. Linkage disequilibrium analysis showed several close linkages of variations throughout the gene. By using the variations, thirty-one haplotypes of CYP2C19 and their frequencies were estimated. Our results would provide fundamental and useful information for genotyping CYP2C19 in the Japanese and probably other Asian populations.

Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its flanking region of the UDP-glucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include -217T>G and -36G>A in the 5'-flanking region, 30G>A (P10P), 127delA (43fsX22; frame-shift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271C>T (R91C), 325A>G (R109G), and 357T>C (N119N) in exon 1, and IVS1+1G>T, IVS1+98A>G and IVS1+101G>T in the following intron. Among them, 127delA and 175delG can confer early termination of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1+1G>T is located at a splice donor site and thus may lead to aberrant splicing. Since we did not find any significant differences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1+101G>T, 0.004 for 30G>A (P10P) and 357T>C (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31C>T (R11W) and 142T>G (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70C>A (P24T), mostly linked with 142T>G (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identified or inferred, and some haplotypes were confirmed by cloning and sequencing. It was shown that most of 142T>G (L48V) was linked with -219C>T, -163G>A, 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T, comprising haplotype *3a; haplotype *4a harbors 31C>T (R11W); 127delA (43fsX22) and 142T>G (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325A>G (R109G) (*6a haplotype); and -219C>T, -163G>A, 142T>G (L48V), 271C>T (R91C), 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations.

In order to identify genetic polymorphisms and haplotype frequencies of CYP1A2 in a Japanese population, the enhancer and promoter regions, all the exons with their surrounding introns, and intron 1 were sequenced from genomic DNA from 250 Japanese subjects. Thirty-three polymorphisms were found, including 13 novel ones: 2 in the enhancer region, 5 in the exons, and 6 in the introns. The most common single nucleotide polymorphism (SNP) was -163C>A (CYP1A2*1F allele) with a 0.628 frequency. In addition to six previously reported non-synonymous SNPs, three novel ones, 125C>G (P42R, CYP1A2*15 allele, MPJ6&#95;1A2032), 1130G>A (R377Q, *16 allele, MPJ6&#95;1A2033), and 1367G>A (R456H, *8 allele, MPJ6&#95;1A2019), were found with frequencies of 0.002, 0.002, and 0.004, respectively. No polymorphism was found in the known nuclear transcriptional factor-binding sites in the enhancer region. Based on linkage disequilibrium analysis, the CYP1A2 gene was analyzed as one haplotype block. Using the 33 detected polymorphisms, 14 haplotypes were unambiguously identified, and 17 haplotypes were inferred by aid of an expectation-maximization-based program. Among them, the second major haplotype CYP1A2*1L is composed of -3860G>A (*1C allele), -2467delT (*1D allele), and -163C>A (*1F allele). Network analysis suggested that relatively rare haplotypes were derived from three major haplotypes, *1A, *1M, and *1N in most cases. Our findings provide fundamental and useful information for genotyping CYP1A2 in the Japanese, and probably Asian populations.

Thirteen single nucleotide polymorphisms (SNPs), including 6 novel ones, were found in exon 1 and its flanking region of UDP-glucuronosyltransferase (UGT) 1A6 from 195 Japanese subjects. Several novel SNPs were identified, including 269G>A (R90H), 279A>G (S93S), and 308C>A (S103X) in exon 1, and IVS1+109C>T, IVS1+120A>G, and IVS1+142C>T in the intron downstream of exon 1. Among these SNPs, 308C>A confers termination of translation at codon 103, resulting in the production of an immature protein that probably lacks enzymatic activity. The allele frequencies were 0.003 for all the 6 SNPs. In addition, the 3 known nonsynonymous SNPs were detected: 19T>G (S7A), 541A>G (T181A), and 552A>C (R184S) with frequencies of 0.226, 0.218, and 0.226, respectively. High linkage disequilibrium was observed among 19T>G (S7A), 315A>G (L105L), 541A>G (T181A), 552A>C (R184S), and IVS1+130G>T, as reported in Caucasian and African-American populations. Then, 11 haplotypes in UGT1A6 were estimated. The novel nonsynonymous variant, 269A or 308A, was shown to be located on the same DNA strand together with 19G, 315G, 541G, 552C, and IVS1+130T. Our results provide fundamental and useful information for genotyping UGT1A6 in the Japanese, and probably Asian populations.

Aryl hydrocarbon receptor (AhR), encoded by the AHR gene, is a transcriptional factor that induces various drug metabolizing enzymes in response to diverse endogenous and exogenous ligands. In order to identify genetic variations of the AHR gene, genomic DNA from 242 Japanese individuals was sequenced. We identified 32 single nucleotide variations, including 25 novel ones [7 were in the coding exons, 7 in the introns, 1 in the 5'-untranslated region (UTR), 5 in the 3'-UTR, 2 in the 5'-flanking region, and 3 in the 3'-flanking region] and a GGGGC repeat polymorphism (a novel microsatellite marker) in the promoter region. The novel nonsynonymous variations were 50A>C (Lys17Thr), 1202A>G (Lys401Arg), 1459A>G (Asn487Asp), and 1541T>C (Ile514Thr). The allele frequencies were 0.010 for 1459A>G (Asn487Asp) and 0.002 for the other 3 variations. Also detected in this analysis was the known nonsynonymous single nucleotide polymorphism 1661G>A (Arg554Lys) at a 0.444 frequency.

Background: Familial juvenile hyperuricemic nephropathy (FJHN) is an autosomal-dominant disease characterized by hyperuricemia of underexcretion type, gout, and chronic renal failure. We previously reported linkage on chromosome 16p12 in a large Japanese family designated as family 1 in the present study. Recent reports on the discovery of mutations of the uromodulin (UMOD) gene in families with FJHN encouraged us to screen UMOD mutations in Japanese families with FJHN, including family 1., Methods: Six unrelated Japanese families with FJHN were examined for mutations of the UMOD gene by direct sequencing. To confirm the results of the mutation screening, parametric linkage analyses were performed using markers in 16p12 region and around other candidate genes of FJHN., Results: Five separate heterozygous mutations (Cys52Trp, Cys135Ser, Cys195Phe, Trp202Ser, and Pro236Leu) were found in five families, including family 1. All mutations were co-segregated with the disease phenotype in all families, except for family 1, in which an individual in the youngest generation was found as a phenocopy by the genetic testing. Revised multipoint linkage analysis showed that the UMOD gene was located in the interval showing logarithm of odds (LOD) score above 6.0. One family carrying no mutation in the UMOD gene showed no linkage to the medullary cystic kidney disease type 1 (MCKD1) locus, the genes of hepatocyte nuclear factor-1beta (HNF-1beta), or urate transporters URAT1 and hUAT., Conclusion: Our results gave an evidence for the mutation of the UMOD gene in the majority of Japanese families with FJHN. Genetic heterogeneity of FJHN was also confirmed. Genetic testing is necessary for definite diagnosis in some cases especially in the young generation.

The outcome of treatment with disease-modifying anti-rheumatic drugs (DMARDs) in rheumatoid arthritis (RA) patients is considerably variable and is also unpredictable. It would be useful clinically if physicians were able to predict responses to DMARDs prior to their administration. One possible cause of differences in efficacy and adverse drug reactions is genetic variation in how individuals metabolize drugs. Based on pharmacogenetics, tailor-made drug therapy, also called personalized drug therapy or individual drug therapy, will be possible with analysis of genetic polymorphism, such as single nucleotide polymorphism (SNP), and analysis of haplotype and diplotype configuration. Several studies of the correlation between the genetic polymorphism of enzymes metabolizing several DMARDs and efficacy or adverse drug reactions have already been reported, suggesting that pharmacogenetics will be applicable to the treatment of RA in the near future.

Background: Del22q11.2 syndrome is the most frequent known chromosomal microdeletion syndrome, with an incidence of 1 in 4000-5000 livebirths. It is characterised by a 3-Mb deletion on chromosome 22q11.2, cardiac abnormalities, T-cell deficits, cleft palate facial anomalies, and hypocalcaemia. At least 30 genes have been mapped to the deleted region. However, the association of these genes with the cause of this syndrome is not clearly understood., Methods: To test for the chromosomal deletion at 22q11.2, we did fluorescence in-situ hybridisation analysis with ten probes on 22q11.2 in 235 unrelated patients with clinically diagnosed del22q11.2 syndrome. To investigate mutations in the coding sequence of TBX1, we also did genetic analysis in 13 patients from ten families who have the 22q11.2 syndrome phenotype but no detectable deletion of 22q11.2., Findings: 96% (225 of 235) of patients had a defined 1.5-3-Mb deletion at 22q11.2. We identified three mutations of TBX1 in two unrelated patients without the 22q11.2 deletion-one with sporadic conotruncal anomaly face syndrome/velocardiofacial syndrome and one with sporadic DiGeorge's syndrome-and in three patients from a family with conotruncal anomaly face syndrome/velocardiofacial syndrome. We did not record these three mutations in 555 healthy controls (1110 chromosomes; p<0.0001)., Interpretation: Our results suggest that the TBX1 mutation is responsible for five major phenotypes in del22q11.2 syndrome. Therefore, we conclude that TBX1 is a major genetic determinant of the del22q11.2 syndrome.

The etiology of type 2 diabetes (DM) is polygenic. We investigated here genes and polymorphisms that associate with DM in the Japanese population. Single-nucleotide polymorphisms (SNPs) of 398 derived from 120 candidate genes were examined for association with DM in a population-based case-control study. The study group consisted of 148 cases and 227 controls recruited from Funagata, Japan. No evident subpopulation structure was detected for the tested population. The association tests were conducted with standard allele positivity tables (chi(2) tests) between SNP genotype frequency and case-control status. The independent association of the SNPs from serum triglyceride levels and body mass index was examined by multiple logistic regression analysis. A value of P<0.01 was accepted as statistically significant. Six genes (met proto-oncogene, ATP-binding cassette transporter A1, fatty acid binding protein 2, LDL receptor defect C complementing, aldolase B, and sulfonylurea receptor) were shown to be associated with DM.

HIV-1 is the etiologic agent of acquired immune deficiency syndrome (AIDS). Functional loss of antigen-presenting cells (APC) in HIV-1 infection is considered to be involved in AIDS pathogenesis. We found that actions of the viral transactivator Tat and the transactivator of MHC class II genes, CIITA, are mutually inhibitory. While Tat inhibited expression of MHC class II genes in APC, overexpression of CIITA inhibited Tat and subsequently HIV-1 replication. This action of Tat appears to be mediated by sequestering the common cofactor, cyclin T1, but not p300 and CBP. These reciprocal actions between Tat and CIITA not only explains the functional impairment of APC in HIV-1 infection but also rationalizes the suppression of HIV-1 virus load by induction of CIITA such as IFN-gamma., (Copyright 2000 Academic Press.)

We present 3 cases of anti-myeloperoxidase, anti-neutrophil cytoplasmic antibody (MPO-ANCA)-positive rapidly progressive glomerulonephritis developed during the treatment with D-penicillamine (D-PC) for rheumatoid arthritis. Rheumatoid arthritis was diagnosed in these patients, and D-PC was administered to them at doses of 100, 200, and 300 mg per day for 32, 42, and 39 months, respectively. They developed proteinuria, hematuria, renal insufficiency, and anemia, and D-PC was stopped. On admission, MPO-ANCA was strongly positive in their sera. Renal biopsy showed glomerulonephritis with cellular crescents. Immunofluorescence examination revealed deposits of granular IgG, IgM, IgA, C1q, and C3 in the mesangium. The 3 patients were treated with steroid pulse therapy along with administration of anticoagulants, and cyclophosphamide was also used in 2 patients. Their renal function improved gradually and MPO-ANCA disappeared after immunosuppressive treatment.

We describe an extraordinary patient with overlap syndrome (systemic lupus erythematosus, systemic sclerosis, and rheumatoid arthritis) having positive autoantibodies against Sm, double stranded DNA, DNA topoisomerase I, and centromere, together with rheumatoid factor. The patient had multiple organ involvement resulting from thrombotic microangiopathy that mimicked so-called normotensive scleroderma renal crisis, and died mainly of massive pulmonary hemorrhage caused by thrombotic thrombocytopenic purpura. The clinical presentations of the case support the concept of strong associations between disease-specific autoantibodies and clinical features.

In vivo somatic mutations have been detected at several human loci by using clonal cultures of peripheral blood T-cells. It has not been fully understood whether or not the somatic mutations in T-cells are similar to those of other cell types. To address this issue, we cloned, from human peripheral blood, T- and B-cells with mutations at an autosomal adenine phosphoribosyltransferase (APRT) locus. For the efficient detection of somatic mutations at the APRT locus, a blood sample from a human individual heterozygous for germline APRT deficiency was used. T- and B-cells deficient in APRT enzyme activity were cloned from peripheral blood mononuclear cells using a selecting agent, 2,6-diaminopurine. The APRT-deficient mutant frequencies were on the order of 10(-4) in both T- and B-cells. The single-strand conformation polymorphism analysis of the APRT DNA of mutant B-cell clones suggested that the molecular mechanisms leading to the APRT deficiency in B-cells were similar to those in T-cells. Our observations suggest that both the frequency and the mode of in vivo somatic mutations occurring spontaneously at general autosomal loci in B-cells are similar to those in T-cells.

We have characterized 18 germline and 10 in vivo somatic mutations in the human adenine phosphoribosyltransferase (APRT) gene. Both germline and in vivo somatic mutations were clustered at the intron 4 splice donor site and at codon 87. In vitro somatic mutations in human APRT do not appear to show this clustering. These findings suggest that the spectrum of germline mutations in APRT may be similar to that incurred by somatic cells in vivo, but different from that seen in cultured cells. Thus, in vivo, rather than in vitro, somatic mutations in this gene may be more representative of mutational events occurring in the germline.

About 79% of all the Japanese patients with adenine phosphoribosyltransferase (APRT) deficiency have been estimated to possess at least one APRT*J allele with a substitution of ACG for ATG at codon 136. We developed a non-radioactive method for diagnosing genotypes of this disease. Part of the genomic DNA including the mutation site of the APRT*J allele was amplified using polymerase chain reaction and the amplified product was dot-blotted onto nylon membranes and then hybridized with either APRT*J-specific or non-APRT*J-specific synthetic oligonucleotides labelled at the 5' termini with biotin in the presence of non-labelled competitive synthetic sequences. The temperature was gradually decreased during the hybridization. When competitive sequences were omitted, difference in the intensity of the hybridization between APRT*J-containing and non-containing samples was not sufficiently clear to differentiate the genotypes. When an excess amount of competitive sequences was added in addition to biotin-labelled oligonucleotides, this method effectively differentiated samples containing only APRT*J alleles from those containing only non-APRT*J alleles. The present method was also useful to differentiate samples with both APRT*J and non-APRT*J alleles from those having only either of the alleles. An equivalent procedure using competitive sequence for hybridization and gradually decreasing the temperature will be useful for detecting point mutations in other genes.

A method using high-performance liquid chromatography (HPLC) for determination of phosphoribosylpyrophosphate (PRPP) synthetase activity in human erythrocytes has been developed and PRPP synthetase activity on purine and pyrimidine metabolic disorders has been studied. Kinetic properties of erythrocyte PRPP synthetase of patients with gout and of a patient with pyrimidine 5'-nucleotidase deficiency were compared with those of healthy subjects. The mean of PRPP synthetase activity of gouty patients was a little higher (P less than 0.01) than that of healthy subjects. The response of the enzyme for ATP of gouty patients was different from that of healthy subjects. The shapes of activation curve of the enzyme for inorganic phosphate were hyperbolic in gouty patients and in a patient with pyrimidine 5'-nucleotidase deficiency.

Patients with 2,8-dihydroxyadenine urolithiasis are either completely or partially deficient in adenine phosphoribosyltransferase activities. Patients with partial enzyme deficiencies, all of whom have been found among Japanese, are homozygotes having a unique mutant adenine phosphoribosyltransferase gene (APRT*J) in double dose (Japanese type deficiency). We have established B-cell lines from heterozygotes and homozygotes of complete and Japanese type adenine phosphoribosyltransferase deficiencies as well as normal individuals. Characterization of the cell lines indicated that all homozygous cells were deficient in adenine phosphoribosyltransferase function while all heterozygous and normal cells had functional adenine phosphoribosyltransferase.

Thioguanine-resistant T lymphoblast populations were selectively amplified using T cell growth factor in the cultures of peripheral blood T cells from four Lesch-Nyhan heterozygotes. Although Lesch-Nyhan T lymphoblasts were all thioguanine-resistant, none of the cultures from 13 control subjects yielded the growth of such defective cell populations. These data provide direct evidence for the existence of a small percentage (5%-40%) of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) deficient T cells in the heterozygotes, but not in normal individuals. Conversely, culture of the T lymphoblasts with azaserine plus hypoxanthine permitted the growth of the other part of the cell population that was enzyme positive. The low percentages of HGPRT-negative cells among T cells in heterozygotes suggest that the presence of this enzyme is beneficial for differentiation of lymphocytes of T cell linkage. Considering the ease and the reliability, culture of the peripheral T cells with thioguanine and T cell growth factor is very likely of practical use for detecting Lesch-Nyhan syndrome carriers among predisposed females.

A screening method using high-performance liquid chromatography (HPLC) for the simultaneous detection of deficiencies of adenine phosphoribosyltransferase (APRT) and hypoxanthine phosphoribosyltransferase (HPRT) activities in human erythrocytes is described. Both enzyme reactions of APRT and HPRT in lysates treated with a charcoal-dextran were simultaneously carried out in the same reaction tube and the enzyme activities were determined by measuring the increases in absorbance at 260 nm of adenosine and inosine converted from adenosine-5'-monophosphate and inosine-5'-monophosphate with alkaline phosphatase. Adenosine and inosine were separated from adenine and hypoxanthine by a reversed-phase column. The method could detect 1% of normal APRT activity and 0.3% of normal HPRT activity. The within-run coefficients of variation for APRT and HPRT activities were 3.2 and 3.4%, respectively.

Viable human and murine lymphoblasts, and normal human tissue extracts, converted the thioether nucleosides 5'-methylthioadenosine (MeSAdo) and 5'-methylthioinosine (MeSIno) to methionine. Both MeSAdo and MeSIno, but not homocysteine, supported the short-term growth of human or murine lymphoblasts in methionine deficient medium. However, MeSAdo at concentrations greater than 25 microM inhibited cell growth. MeSIno was non-toxic at concentrations up to 200 microM, and supported the long-term growth of lymphoblasts in methionine-free medium.

Cells from 20 patients with leukemia and 9 with solid tumors were assayed for the enzyme methylthioadenosine phosphorylase, which function in both purine and polyamine metabolism in rapidly dividing cells. As determined by autoradiography of viable cells, and by direct enzymatic analysis, samples from one individual with pre-T-cell acute lymphoblastic leukemia and one with common acute lymphoblastic leukemia were methylthioadenosine phosphorylase deficient. In contrast, other leukemias of similar antigenic phenotype, as well as normal peripheral blood lymphocytes, thymic lymphocytes, and normal bone marrow cells, had substantial methylthioadenosine phosphorylase activity. This evidence suggests that the complete absence of methylthioadenosine phosphorylase distinguishes some leukemic cells in vivo from their nonmalignant counterparts.