Search

Competing Interests: Conflicts of Interest: None declared.

Introduction: We previously reported that progression-free survival (PFS) may be a candidate surrogate end point for overall survival (OS) in first-line extensive-stage small-cell lung cancer (ES-SCLC) using data from three randomized trials (Foster, Cancer 2011). In this validation study (N0424-Alliance), we assessed the patient-level and trial-level surrogacy of PFS using data from seven new first-line phase II/III ES-SCLC trials and across all 10 trials as well (seven new, three previous)., Methods: Individual patient data were utilized across the seven new trials (2259 patients) and all 10 trials (2855 patients). Patient-level surrogacy (Kendall's τ) was assessed using the Clayton copula bivariate survival model. Trial-level surrogacy was assessed through association of the log hazard ratios on OS and PFS across trials, including weighted (by trial size) least squares regression (WLS R²) of Cox model effects and correlation of the copula effects (copula R²). The minimum effect on the surrogate (MES) needed to detect a nonzero treatment effect on OS was also calculated., Results: The median OS and PFS across all 10 trials were 9.8 and 5.9 months, respectively. PFS showed strong surrogacy within the 7 new trials (copula R² = 0.90 [standard error = 0.27], WLS R² = 0.83 [95% confidence interval: 0.43, 0.95]; MES = 0.67, and Kendall's τ = 0.58) and across all 10 trials (copula R² = 0.81 [standard errors = 0.25], WLS R² = 0.77 [95% confidence interval: 0.47-0.91], MES = 0.70, and Kendall's τ = 0.57)., Conclusions: PFS demonstrated strong surrogacy for OS in first-line ES-SCLC based on this external validation study of individual patient data. PFS is a good alternative end point to OS and should be considered when resource constraints (time or patient) might make it useful or desirable in place of OS. Additional analyses are needed to assess its appropriateness for targeted agents in this disease setting.

Introduction: The efficacy and safety of amrubicin, a third-generation synthetic anthracycline, were evaluated by comparison with carboplatin/etoposide combination therapy in elderly Japanese patients with extensive-disease small-cell lung cancer (ED-SCLC)., Patients and Methods: Eligibility included histologically or cytologically proven SCLC, no previous systemic chemotherapy, performance status of 0 to 2, and age ≥ 70 years. Patients received amrubicin (70-74 years old, 40-45 mg/m(2); ≥ 75 years old, 40 mg/m(2)) intravenously on days 1 to 3 every 3 weeks for 4 to 6 cycles or carboplatin (area under the curve of 5 intravenously on day 1) and etoposide (80 mg/m(2) intravenously on days 1 to 3) every 3 weeks for 4 to 6 cycles., Results: The target number of patients was 130 with 65 in each arm. However, the study was terminated early owing to 3 treatment-related deaths in the amrubicin arm, and only 62 patients (median age, 76 years; range, 70-88 years) were enrolled. The characteristics of the patients in the amrubicin and carboplatin/etoposide arms did not differ significantly. Overall survival, time to progression, and objective response rate were 10.9 vs. 11.3 months (P = .7353), 4.7 vs. 4.4 months, and 74.2% (23 of 31) vs. 60.0% (18 of 30), respectively, and quality of life showed no significant difference between the 2 arms. Higher incidences of febrile neutropenia and interstitial lung disease of grade 3 or worse occurred with amrubicin (34.4% vs. 3.3% and 12.5% vs. 0%, respectively)., Conclusion: These results indicate that amrubicin monotherapy at 40 to 45 mg/m(2) is toxic and intolerable in elderly Japanese patients with ED-SCLC., (Copyright © 2014 Elsevier Inc. All rights reserved.)

Background: Previous studies have demonstrated the efficacy and safety of bevacizumab in the treatment of non-small-cell lung cancer (NSCLC)., Methods: Summary data from randomised trials comparing first-line bevacizumab plus platinum-based chemotherapy with chemotherapy alone for inoperable locally advanced, recurrent or metastatic NSCLC were meta-analysed. Pooled hazard ratios (HRs) for overall survival (OS) and progression-free survival (PFS), and pooled odds ratio (OR) for adverse events were calculated. The chi-squared tests evaluated interactions between treatment effects, and prognostic factors and patient characteristics., Results: Data of 2194 patients (1313 bevacizumab; 881 controls) from four phase II and III trials: AVF-0757g, JO19907,ECOG 4599 and AVAiL, were analysed. Compared with chemotherapy alone, bevacizumab significantly prolonged OS(HR 0.90; 95% confidence interval [CI] 0.81, 0.99; P=0.03), and PFS (0.72; 95% CI 0.66, 0.79; P<0.001). Bevacizumab showed a significantly greater effect on OS in patients with adenocarcinoma versus other histologies (P=0.03), and patients with body weight loss ≤5% versus >5% (P=0.04). Bevacizumab significantly increased the risk of grade ≥3 proteinuria, hypertension,haemorrhagic events, neutropenia, and febrile neutropenia [corrected]., Conclusions: Bevacizumab significantly prolonged OS and PFS when added to first-line platinum-based chemotherapy in patients with advanced NSCLC; no unexpected toxicity was evident.

Introduction: Approximately 50% of lung cancer patients with epidermal growth factor receptor (EGFR)-mutations (deletion in exon 19 or L858R) who develop acquired resistance to EGFR tyrosine kinase inhibitors (TKIs) reportedly carry a secondary EGFR T790M mutation. This mutation has been suggested to be present in tumor cells before EGFR-TKI treatment in a small population of individuals. Here, we use a highly sensitive colony hybridization technique in an attempt to evaluate the actual incidence of T790M in pretreatment tumor specimens., Methods: DNA was extracted from surgically resected tumor tissues of 38 patients with the EGFR mutation and examined for the presence of T790M, using a standard polymerase chain reaction based method followed by a modified colony hybridization (CH) technique with an analytical sensitivity of approximately 0.01%. Associations between the T790M status and clinical characteristics including time to treatment failure (TTF) for EGFR-TKI were evaluated., Results: The T790M mutation analysis of the specimens from the 38 patients detected 30 mutants (79%). The median TTF was 9 months for the patients with pretreatment T790M and 7 months for the patients without the T790M mutation (p = 0.44). When the patients with T790M were divided into strongly positive and modestly positive subgroups in terms of the frequency of positive signals observed using CH technique, the 7 patients with strong positivity had a TTF that was significantly longer than that of the 8 patients without T790M (p = 0.0097) and of the 23 patients with modest positivity (p = 0.0019)., Conclusions: Our highly sensitive CH method showed that a subgroup of non-small-cell lung cancer patients with the EGFR mutation harbored the rare T790M allele before EGFR-TKI treatment. A high proportion of T790M allele may define a clinical subset with a relatively favorable prognosis.

Background: We conducted a feasibility study of induction chemotherapy followed by gefitinib and thoracic radiotherapy (TRT) for unresectable locally advanced adenocarcinoma of the lung., Patients and Methods: Patients received induction chemotherapy with cisplatin (80 mg/m(2), days 1 and 22) and vinorelbine (25 mg/m(2), days 1, 8, 22, and 29) followed by gefitinib (250 mg daily, beginning on day 43, for 1 year) and TRT (60 Gy/30 fractions, days 57-98). The primary end point was feasibility, which was defined as the proportion of patients who completed 60 Gy of TRT and received >75% of the planned dose of gefitinib without developing grade 2 or worse pneumonitis., Results: Of the 38 enrolled patients, 23 patients [60.5% ; 80% confidence interval (CI) 48.8-71.3] completed treatment without experiencing grade 2 or worse pneumonitis. During the chemoradiation phase, grade 3-4 alanine aminotransferase elevations were observed in 37.1% of the patients. The overall response rate was 73.0% . The median survival time was 28.5 months (95% CI 22.5-38.2), and the 2-year survival rate was 65.4% ., Conclusions: Although the results did not meet our criterion for feasibility, the toxicity was acceptable. This treatment warrants further evaluation among patients with locally advanced non-small-cell lung cancer harboring epidermal growth factor receptor mutations.

Along with changes in smoking habits, non-small cell lung carcinoma (NSCLC) has come to account for about 90% of all cases of lung cancer. For the treatment of NSCLC, cytocidal antineoplastic drugs such as pemetrexed and molecular-targeted drugs such as gefitinib, erlotinib, and bevacizumab have been approved globally and used as a part of the standard treatment. The importance of better patient selection based on the optimum indication of these drugs is attracting much attention. Additionally, timing for the use of these drugs also seems to be an important issue. The present review presents a critical discussion about the following issues based on the results of clinical studies: (1) whether or not the assessment of the EGFR mutation status in NSCLC patients is indispensable; (2) whether gefitinib and erlotinib have different effects; (3) the need to sub-classify NSCLC by histologic type; (4) significance of maintenance therapy for NSCLC; and (5) whether platinum-doublet chemotherapy plus bevacizumab is a standard treatment for non-squamous cell carcinoma., (Copyright © 2011 Elsevier Ltd. All rights reserved.)

A biomarker is defined as "a characteristic that is objectively measured and evaluated as an indicator of normal biologic processes, pathogenic processes, or pharmacologic/pharmacodynamic responses to a therapeutic intervention". Various assays, including immunohistochemistry, gene constitution such as amplification, mutation, and rearrangement, gene and protein expression analysis such as single gene or protein expression, exhaustive analysis and gene or protein signature and single nucleotide polymorphism have been used to identify biomarkers in recent years. No therapeutic effects have yet been predicted based on the results of such exhaustive gene analysis because of low reproducibility although some correlate with the prognosis of patients. Biomarkers such as HER2 for breast cancer or EGFR mutation for lung cancer and KRAS mutation in colon cancer have contributed to identify a patient population that might show a good and bad treatment response, respectively. On the other hand, other biomarkers such as bcr-abl, c-kit gene mutation and CD20 expression, which are positive for CML, GIST and B cell lymphoma, respectively, have crucial biological significance but have not necessarily been used for practical clinical screening since pathological diagnosis coincide with finding of biomarkers. Hence, much work remains to be done in many areas of biomarker research., (2011 Elsevier Ltd. All rights reserved.)

Introduction: In IPASS (IRESSA Pan-Asia Study), clinically selected patients with pulmonary adenocarcinoma received first-line gefitinib or carboplatin/paclitaxel. This preplanned, exploratory analysis was conducted to increase understanding of the use of surrogate samples, such as serum, versus tumor biopsy samples for determining EGFR mutation status in the Japanese cohort (n = 233)., Methods: EGFR mutations were assessed using tumor tissue-derived DNA (n = 91) and circulating free (cf) DNA from pretreatment serum samples (n = 194)., Results: Fewer patients were EGFR mutation positive when assessed using pretreatment cfDNA (23.7%) versus tumor tissue-derived DNA (61.5%). cfDNA results identified no false positives but a high rate of false negatives (56.9%). There was a significant interaction between cfDNA EGFR mutation status and treatment for progression-free survival (PFS) (p = 0.045). PFS was significantly longer and objective response rate (ORR) higher with gefitinib than carboplatin/paclitaxel in the cfDNA EGFR mutation-positive subgroup (PFS: hazard ratio [HR], 0.29; 95% confidence interval [CI], 0.14-0.60; p < 0.001; ORR: odds ratio [OR], 1.71; 95% CI, 0.48-6.09; 75.0% versus 63.6%; p = 0.40). There was a slight numerical advantage in PFS and ORR for gefitinib over carboplatin/paclitaxel in the cfDNA EGFR mutation-negative subgroup, likely due to the high rate of false negatives within this subgroup., Conclusions: These results merit further investigation to determine whether alternative sources of tumor DNA, such as cfDNA in serum, could be used for determining EGFR mutation status in future; currently, where a sample is available, analysis of tumor material is recommended.

Introduction: Evaluation of health-related quality-of-life (HRQoL) and symptom improvement were preplanned secondary objectives for the overall population and posthoc analyses for epidermal growth factor receptor (EGFR) mutation-positive/negative subgroups in IPASS., Methods: HRQoL was assessed using the Functional Assessment of Cancer Therapy-Lung (FACT-L) and Trial Outcome Index (TOI); symptom improvement by the Lung Cancer Subscale (LCS). Improvements defined as: 6 or more (FACT-L; TOI), 2 or more (LCS) points increase maintained for 21 or more days., Results: Overall (n = 1151/1217 evaluable), HRQoL improvement rates were significantly greater with gefitinib versus carboplatin/paclitaxel; symptom improvement rates were similar for both treatments. Significantly more patients recorded improvements in HRQoL and symptoms with gefitinib in the EGFR mutation-positive subgroup (n = 259; FACT-L 70.2% versus 44.5%; odds ratio, 3.01 [95% confidence interval, 1.79-5.07]; p < 0.001; TOI 70.2% versus 38.3%; 3.96 [2.33-6.71]; p < 0.001; LCS 75.6% versus 53.9%; 2.70 [1.58-4.62]; p < 0.001), and with carboplatin/paclitaxel in the EGFR mutation-negative subgroup (n = 169; FACT-L 14.6% versus 36.3%; odds ratio, 0.31 [0.15-0.65]; p = 0.002; TOI 12.4% versus 28.8%; 0.35 [0.16-0.79]; p = 0.011; LCS 20.2% versus 47.5%; 0.28 [0.14-0.55]; p < 0.001). Median time-to-worsening (months) FACT-L score was longer with gefitinib versus carboplatin/paclitaxel for the overall population (8.3 versus 2.5) and EGFR mutation-positive subgroup (15.6 versus 3.0), and similar for both treatments in the EGFR mutation-negative subgroup (1.4 versus 1.4). Median time-to-improvement with gefitinib was 8 days in patients with EGFR mutation-positive tumors who improved., Conclusions: HRQoL and symptom endpoints were consistent with efficacy outcomes in IPASS and favored gefitinib in patients with EGFR mutation-positive tumors and carboplatin/paclitaxel in patients with EGFR mutation-negative tumors.

Introduction: The epidermal growth factor receptor (EGFR) mutation status is a validated biomarker for the stratification of EGFR-tyrosine kinase inhibitor (EGFR-TKIs) treatment in patients with non-small cell lung cancer (NSCLC); however, its use is limited in patients with wild-type EGFR, and new biomarkers are needed. We hypothesized that the serum concentration of heparan sulfate (HS), which activates oncogenic growth factor receptor signaling through EGFR and non-EGFR signaling pathways, may be a novel glycobiological biomarker for EGFR-TKIs treatment in NSCLC., Methods: The pretreatment serum HS concentrations were determined using enzyme-linked immunosorbent assay in 83 patients with stage IV non-small cell lung adenocarcinoma who received EGFR-TKIs treatment. The relationship between the serum HS concentrations and patient characteristics, tumor response, progression-free survival (PFS), and overall survival (OS) were analyzed., Results: Patient sex, performance status, smoking history, and EGFR mutation status were associated with tumor response. The serum HS concentrations were significantly higher among patients with progressive disease than among those without progressive disease (p = 0.003). Furthermore, the serum HS concentrations were strongly associated with a poor PFS and OS in a univariate Cox analysis (p = 0.0022 and p = 0.0003, respectively). A stratified multivariate Cox model according to the EGFR mutation status showed that higher HS concentrations were significantly associated with a shorter PFS and OS (p = 0.0012 and p = 0.0003)., Conclusion: We concluded that a high-serum HS concentration was strongly related to a poor treatment outcome of EGFR-TKIs and may be a promising noninvasive and repeatable glycobiological biomarker in cancer treatment.

Alpha-1-acid glycoprotein (AGP) encoded by orosomucoid genes (ORM1 and ORM2) is an acute-phase response protein and functions as a drug-binding protein that affects pharmacokinetics (PK)/pharmacodynamics of binding drugs. To explore the effects of genetic variations of ORMs and a role of AGP on paclitaxel (PTX) therapy, we analyzed the duplication and genetic variations/haplotypes of ORMs in 165 Japanese cancer patients and then investigated their associations with serum AGP levels and the PK parameters of PTX. No effects of ORM duplications on serum AGP levels at baseline or PK of PTX were observed, but close associations of ORM1 -559T > A with the increases of AGP levels and area under the curve (AUC) of PTX metabolites were detected. In addition, a significant correlation between the serum AGP level and the AUCs of PTX metabolites was observed, suggesting that AGP may function as a carrier of PTX from the blood into the liver via putative receptors. This study provided useful information on the possible clinical importance of ORM genetic polymorphisms and a novel role of AGP in PTX therapy., (Copyright © 2011 Wiley-Liss, Inc.)

Lung cancer, COPD and cardiovascular diseases are highlighted as some of the most common disease that cause mortality, and for that reason are the most active areas for drug development. This perspective paper overviews the urgent need to develop a health care system for a rapidly growing patient population in Japan, including forthcoming demands on clinical care, expecting outcomes, and economics. There is an increasing requirement to build on the strengths of the current health care system, thereby delivering urgent solutions for the future. There is also a declaration from the Ministry of Health, Labour and Welfare (MHLW), to develop new biomarker diagnostics, which is intended for patient stratification, aiding in diagnostic phenotype selection for responders to drug treatment of Japanese patients. This perspective was written by the panel in order to introduce novel technologies and diagnostic capabilities with successful implementation. The next generation of personalized drugs for targeted and stratified patient treatment will soon be available in major disease areas such as, lifestyle-related cancers, especially lung cancers with the highest mortality including a predisposing disorder chronic obstructive pulmonary disease, cardiovascular disease, and other diseases. Mass spectrometric technologies can provide the "phenotypic fingerprint" required for the concept of Personalized Medicine. Mass spectrometry-driven target biomarker diagnoses in combination with high resolution computed tomography can provide a critical pathway initiative facilitated by a fully integrated e-Health infrastructure system. We strongly recommend integrating validated biomarkers based on clinical proteomics, medical imaging with clinical care supported by e-Health model to support personalized treatment paradigms to reduce mortality and healthcare costs of chronic and co-morbid diseases in the elderly population of Japan., (Copyright © 2011. Published by Elsevier B.V.)

Introduction: Adenocarcinoma is the most common histologic type of lung cancer. To address advances in oncology, molecular biology, pathology, radiology, and surgery of lung adenocarcinoma, an international multidisciplinary classification was sponsored by the International Association for the Study of Lung Cancer, American Thoracic Society, and European Respiratory Society. This new adenocarcinoma classification is needed to provide uniform terminology and diagnostic criteria, especially for bronchioloalveolar carcinoma (BAC), the overall approach to small nonresection cancer specimens, and for multidisciplinary strategic management of tissue for molecular and immunohistochemical studies., Methods: An international core panel of experts representing all three societies was formed with oncologists/pulmonologists, pathologists, radiologists, molecular biologists, and thoracic surgeons. A systematic review was performed under the guidance of the American Thoracic Society Documents Development and Implementation Committee. The search strategy identified 11,368 citations of which 312 articles met specified eligibility criteria and were retrieved for full text review. A series of meetings were held to discuss the development of the new classification, to develop the recommendations, and to write the current document. Recommendations for key questions were graded by strength and quality of the evidence according to the Grades of Recommendation, Assessment, Development, and Evaluation approach., Results: The classification addresses both resection specimens, and small biopsies and cytology. The terms BAC and mixed subtype adenocarcinoma are no longer used. For resection specimens, new concepts are introduced such as adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) for small solitary adenocarcinomas with either pure lepidic growth (AIS) or predominant lepidic growth with ≤ 5 mm invasion (MIA) to define patients who, if they undergo complete resection, will have 100% or near 100% disease-specific survival, respectively. AIS and MIA are usually nonmucinous but rarely may be mucinous. Invasive adenocarcinomas are classified by predominant pattern after using comprehensive histologic subtyping with lepidic (formerly most mixed subtype tumors with nonmucinous BAC), acinar, papillary, and solid patterns; micropapillary is added as a new histologic subtype. Variants include invasive mucinous adenocarcinoma (formerly mucinous BAC), colloid, fetal, and enteric adenocarcinoma. This classification provides guidance for small biopsies and cytology specimens, as approximately 70% of lung cancers are diagnosed in such samples. Non-small cell lung carcinomas (NSCLCs), in patients with advanced-stage disease, are to be classified into more specific types such as adenocarcinoma or squamous cell carcinoma, whenever possible for several reasons: (1) adenocarcinoma or NSCLC not otherwise specified should be tested for epidermal growth factor receptor (EGFR) mutations as the presence of these mutations is predictive of responsiveness to EGFR tyrosine kinase inhibitors, (2) adenocarcinoma histology is a strong predictor for improved outcome with pemetrexed therapy compared with squamous cell carcinoma, and (3) potential life-threatening hemorrhage may occur in patients with squamous cell carcinoma who receive bevacizumab. If the tumor cannot be classified based on light microscopy alone, special studies such as immunohistochemistry and/or mucin stains should be applied to classify the tumor further. Use of the term NSCLC not otherwise specified should be minimized., Conclusions: This new classification strategy is based on a multidisciplinary approach to diagnosis of lung adenocarcinoma that incorporates clinical, molecular, radiologic, and surgical issues, but it is primarily based on histology. This classification is intended to support clinical practice, and research investigation and clinical trials. As EGFR mutation is a validated predictive marker for response and progression-free survival with EGFR tyrosine kinase inhibitors in advanced lung adenocarcinoma, we recommend that patients with advanced adenocarcinomas be tested for EGFR mutation. This has implications for strategic management of tissue, particularly for small biopsies and cytology samples, to maximize high-quality tissue available for molecular studies. Potential impact for tumor, node, and metastasis staging include adjustment of the size T factor according to only the invasive component (1) pathologically in invasive tumors with lepidic areas or (2) radiologically by measuring the solid component of part-solid nodules.

Purpose: Our goal was to identify candidate polymorphisms that could influence overall survival (OS) in advanced non-small cell lung cancer (NSCLC) patients treated with carboplatin (CBDCA) and paclitaxel (PTX)., Methods: Chemotherapy-naïve stage IIIB or IV NSCLC patients treated with CBDCA (area under the curve = 6 mg/mL/min) and PTX (200 mg/m, 3-hour period) were eligible for this study. The DNA samples were extracted from peripheral blood mononuclear cells before treatment, and genotypes at approximately 110,000 gene-centric single-nucleotide polymorphisms (SNPs) were obtained by Illumina's Sentrix Human-1 Genotyping BeadChip. Statistical analyses were performed by the log-rank test and Cox proportional hazards model., Results: From July 2002 to May 2004, 105 patients received a total of 308 cycles of treatment. The median survival time (MST) of 105 patients was 17.1 months. In the genome-wide association study, three SNPs were associated significantly with shortened OS after multiple comparison adjustment: rs1656402 in the EIF4E2 gene (MST was 18.0 and 7.7 months for AG [n = 50] + AA [n = 40] and GG [n = 15], respectively; p = 8.4 × 10), rs1209950 in the ETS2 gene (MST = 17.7 and 7.4 months for CC [n = 94] and CT [n = 11] + TT [n = 0]; p = 2.8 × 10), and rs9981861 in the DSCAM gene (MST = 17.1 and 3.8 months for AA [n = 75] + AG [n = 26] and GG [n = 4]; p = 3.5 × 10)., Conclusion: Three SNPs were identified as new prognostic biomarker candidates for advanced NSCLC treated with CBDCA and PTX. The agnostic genome-wide association study may unveil unexplored molecular pathways associated with the drug response, but our findings should be replicated by other investigators.

Glutathione S-transferases (GSTs) play a vital role in the phase II biotransformation of many chemicals, including anticancer drugs. In this study, to elucidate the haplotype structures of the two closely related alpha-class genes GSTA1 and GSTA2, we screened for genetic variation in 214 Japanese colorectal cancer patients who received oxaliplatin-based chemotherapy. By direct resequencing of the 5'-flanking region, all the exons, and their flanking introns for 107 patients, 29 and 27 variants were identified in GSTA1 and GSTA2, respectively. The known functional single nucleotide polymorphisms (SNPs) -567T>G, -69C>T, and -52G>A in GSTA1*B were found at allele frequencies of 0.140. Of the four major GSTA2 allelic variants reported previously (GSTA2*A, *B, *C, and *E), only GSTA2*B (frequency = 0.154), *C (0.706), and *E (0.140) were detected. Following linkage disequilibrium analysis, haplotypes of both genes were separately estimated. Then, rapid genotyping methods for 7 and 6 SNPs tagging common haplotypes of GSTA1 and GSTA2, respectively, were developed using the single-base extension assay, and an additional 107 patients were genotyped. Finally, haplotype combinations of both genes were classified into 3 major types: GSTA1*A-GSTA2*C, GSTA1*A-GSTA2*B, and GSTA1*B-GSTA2*E. These findings will be useful in pharmacogenomic studies on xenobiotics including anticancer drugs.

Cytochrome P450 oxidoreductase (POR) transfers electrons from NADPH to all microsomal cytochrome P450 (CYP) enzymes and is necessary for microsomal CYP activities. In this study, to find genetic variations and to elucidate the haplotype structures of POR, we comprehensively screened the genetic variations in the 5'-flanking region, all the exons and their flanking introns of POR for 235 Japanese subjects. Seventy-five genetic variations including 26 novel ones were found: 7 were in the 5'-flanking region, 2 in the 5'-untranslated region (5'-UTR, non-coding exon 1), 16 in the coding exons (10 nonsynonymous and 6 synonymous), 45 in the introns, 4 in the 3'-UTR and 1 in the 3'-flanking region. Of these, 4 novel nonsynonymous variations, 86C>T (T29M), 1648C>T (R550W), 1708C>T (R570C) and 1975G>A (A659T), were detected with allele frequencies of 0.002. We also detected known nonsynonymous SNPs 683C>T (P228L), 1237G>A (G413S), 1453G>A (A485T), 1508C>T (A503V), 1510G>A (G504R) and 1738G>C (E580Q) with frequencies of 0.002, 0.009, 0.002, 0.434, 0.002 and 0.002, respectively. Based on the linkage disequilibrium (LD) profiles, the analyzed region could be divided into two LD blocks. For Blocks 1 and 2, 14 and 46 haplotypes were inferred, respectively, and 2 and 6 common haplotypes found in more than 0.03 frequencies accounted for more than 81% of the inferred haplotypes. This study provides fundamental and useful information for the pharmacogenetic studies of drugs metabolized by CYPs in the Japanese population.

Background: Amrubicin is a novel anthracycline agent that is well known to exert significant activity against small cell lung cancer (SCLC), but the adverse pulmonary effects of amrubicin are less well known. We investigated the incidence of acute interstitial lung disease (ILD) in SCLC patients who had been treated with amrubicin., Methods: Medical records were used to retrospectively investigate a total of 100 cases of SCLC patients treated with single-agent amrubicin therapy at the National Cancer Center Hospital East between June 2003 and March 2008. The patients' radiographic records and clinical data were reviewed to identify patients who had developed acute ILD after being treated with amrubicin., Results: After receiving amrubicin, seven of the 100 SCLC patients subsequently developed pulmonary infiltrates, and they were identified as cases of acute ILD associated with amrubicin. Of the seven patients who developed ILD, six were treated with corticosteroids, and the ILD improved in three of them, but the other three patients died of respiratory failure. The incidence of ILD was 33% (4/12) among the patients with pre-existing pulmonary fibrosis (PF) and 3% (3/88) among the patients without PF, and the difference between the two groups was statistically significant (P = 0.0036)., Conclusions: The results of this study indicated that amrubicin may cause severe ILD and that pre-existing PF was associated with a higher rate of ILD among SCLC patients treated with amrubicin. We recommend not administering amrubicin in the treatment of SCLC patients with pre-existing PF.

Introduction: This post hoc analysis investigated the relationship between tumor response and overall survival (OS) in pretreated advanced non-small cell lung cancer (NSCLC)., Methods: We conducted landmark survival analyses of V-15-32, a phase III study comparing gefitinib with docetaxel in pretreated advanced NSCLC. Best response at weeks 8, 12, 16, and 20, and visit response at week 4, were evaluated., Results: Disease control (DC; complete response [CR], partial response [PR], or stable disease) was a better predictor of OS than CR/PR at all time points. The strongest predictor of OS for both gefitinib and docetaxel was DC at week 8 (hazard ratio [HR] DC versus non-DC: 0.30, 95% confidence interval [CI] 0.20-0.45, p < 0.001 for both treatments). DC at week 4 was also associated with longer survival compared with non-DC for both treatments (HR 0.33, 95% CI 0.23-0.49, p < 0.001 for gefitinib; HR 0.30, 95% CI 0.19-0.47, p < 0.001 for docetaxel)., Discussion: DC is a better predictor of OS with gefitinib and docetaxel than CR/PR in advanced pretreated NSCLC, with a best response of DC at week 8 the strongest predictor.

Introduction: To determine the dose-limiting toxicity and recommended dose (RD) of cisplatin (CDDP) combined with S-1 (tegafur, 5-chloro-2, 4-dihydroxypyridine, and potassium oxonate) for patients with non-small cell lung cancer and to evaluate efficacy and toxicity of this regimen at RD., Methods: Patients with stages III and IV non-small cell lung cancer received 3-week cycles of treatment, each consisting of oral administration of S-1 at 80 mg/m in 2 divided doses per day for 14 consecutive days, intravenous administration of CDDP (60 mg/m, 70 mg/m, or 80 mg/m) on the first day, and no medication during the subsequent 7 days. The primary objective of phase I study was to estimate the maximum tolerable dose and the RD, and the primary end point of phase II study was response., Results: RD of CDDP in the analysis of 18 eligible patients was 60 mg/m. Evaluation of efficacy and toxicity at RD in 55 eligible patients showed that partial response was observed in 18 patients (32.7%, 95% confidence interval: 20.7-46.7%). The median survival time was 18.1 months, and the time to disease progression was 3.8 months. Grade 3 or severer adverse events were observed in 27 patients (49.1%)., Conclusions: CDDP combined with S-1 showed a satisfactory overall survival time and acceptable toxicity profile. However, the response as the primary end point did not reach the predetermined threshold level.

Background: The mechanism of resistance to human epidermal growth factor receptor 2 (HER2)-targeted agents has not been fully understood. We investigated the influence of PIK3CA mutations on sensitivity to HER2-targeted agents in naturally derived breast cancer cells., Materials and Methods: We examined the effects of Calbiochem (CL)-387,785, HER2 tyrosine kinase inhibitor, and trastuzumab on cell growth and HER2 signaling in eight breast cancer cell lines showing HER2 amplification and trastuzumab-conditioned BT474 (BT474-TR)., Results: Four cell lines with PIK3CA mutations (E545K and H1047R) were more resistant to trastuzumab than the remaining four without mutations (mean percentage of control with 10 microg/ml trastuzumab: 58% versus 92%; P = 0.010). While PIK3CA-mutant cells were more resistant to CL-387,785 than PIK3CA-wild-type cells (mean percentage of control with 1 microM CL-387,785: 21% versus 77%; P = 0.001), CL-387,785 retained activity against BT474-TR. Growth inhibition by trastuzumab and CL-387,785 was more closely correlated with changes in phosphorylation of S6K (correlation coefficient, 0.811) than those of HER2, Akt, or ERK1/2. Growth of most HER2-amplified cells was inhibited by LY294002, regardless of PIK3CA genotype., Conclusions: PIK3CA mutations are associated with resistance to HER2-targeted agents. PI3K inhibitors are potentially effective in overcoming trastuzumab resistance caused by PIK3CA mutations. S6K phosphorylation is a possibly useful pharmacodynamic marker in HER2-targeted therapy.

Neonatal Fc receptor (FcRn) plays an important role in regulating IgG homeostasis in the body. Changes in FcRn expression levels or activity caused by genetic polymorphisms of FCGRT, which encodes FcRn, may lead to interindividual differences in pharmacokinetics of therapeutic antibodies. In this study, we sequenced the 5'-flanking region, all exons and their flanking regions of FCGRT from 126 Japanese subjects. Thirty-three genetic variations, including 17 novel ones, were found. Of these, two novel non-synonymous variations, 629G>A (R210Q) and 889T>A (S297T), were found as heterozygous variations. We next assessed the functional significance of the two novel non-synonymous variations by expressing wild-type and variant proteins in HeLa cells. Both variant proteins showed similar intracellular localization as well as antibody recycling efficiencies. These results suggested that at least no common functional polymorphic site with amino acid change was present in the FCGRT of our Japanese population.

Introduction: Recent pivotal phase III studies in patients with advanced non-small cell lung cancer (NSCLC) consistently showed greater survival benefit of pemetrexed in patients with nonsquamous cell carcinoma histology (nonsquamous histology) compared with those with squamous cell carcinoma histology (squamous histology). To confirm the efficacy differences of pemetrexed by histologic type, we conducted an additional subgroup analysis of data from a Japanese randomized phase II study evaluating the efficacy and safety of pemetrexed 500 mg/m2 (P500) and 1000 mg/m2 (P1000) in patients with advanced NSCLC previously treated with chemotherapy. The efficacy and safety results of original phase II study have already been reported (Ohe et al., Clin Cancer Res 2008;14:4206-4212)., Methods: Objective response rates (ORRs), overall survival time, and progression-free survival time were analyzed by subgroup of histology, squamous, and nonsquamous, for the dose groups combined and separately., Results: A total of 216 patients were evaluable for efficacy. One hundred sixty-eight patients had nonsquamous and 48 had squamous histology. ORRs were 20.8% and 2.1% (p < 0.001); median survival times (MST) were 16.0 and 8.5 months (p < 0.001); and median progression-free survival times (PFS) were 3.1 and 1.6 months (p < 0.001) for nonsquamous and squamous histology, respectively. In patients who were randomized to the P500 group, ORR were 23.5% and 0% (p = 0.0062); MST were 19.4 and 7.9 months (p < 0.001); and PFS were 3.1 and 1.4 months (p < 0.001) for nonsquamous and squamous histology, respectively. In patients who were randomized to the P1000 group, ORR were 18.1% and 4.0% (p = 0.1113); MST were 13.5 months and 8.6 months (p = 0.0971); and PFS were 3.1 and 1.7 months (p = 0.0024) for nonsquamous and squamous histology, respectively. There were no clinically relevant differences in the incidence of toxicities between histology groups., Conclusions: This study showed the difference of pemetrexed efficacy by histologic type, and this result supports the treatment-by-histology effect observed in the past pivotal phase III studies. Higher dose of pemetrexed resulted in similar outcomes both in patients with nonsquamous histology and squamous histology. Pemetrexed is not as effective as alternative therapies for previously treated squamous histology; however, pemetrexed should be the key agent for the treatment of patients with nonsquamous histology.

Critical advances in the treatment of patients with lung cancer have occurred in the past few years. The cooperative groups in North America and internationally have played crucial roles in these advances. The leaders of the groups meet on a regular basis to review the progress of their trials. However, they rarely have a chance to discuss all ongoing and planned trials, except at the annual Lung Cancer Congress held each June. This article captures this exchange from the 10th Annual Lung Cancer Congress held in June 2009. Exciting efforts are ongoing for all stages of non-small-cell lung cancer, small-cell lung cancer, and mesothelioma. A major focus of the groups at this time is a push toward more personalized medicine, as reflected in the selection criteria for many of the trials, along with planned correlates to better define populations most likely to benefit. Agents targeting the vascular endothelial growth factor (VEGF) pathway, including many tyrosine kinase inhibitors against the VEGF receptor, and those targeting the epidermal growth factor receptor pathway, are under extensive development with many combination trials ongoing.

Background: This report describes quality of life (QoL) findings of a randomized study comparing gefitinib with docetaxel in patients with advanced/metastatic pretreated non-small-cell lung cancer., Patients and Methods: This open-label, phase III study randomized 490 Japanese patients to gefitinib (250 mg/day) or docetaxel (60 mg/m(2)/3 weeks), with survival as the primary outcome. Preplanned QoL analyses included Functional Assessment of Cancer Therapy-Lung (FACT-L), Trial Outcome Index (TOI) and Lung Cancer Subscale (LCS) improvement rates, and mean change from baseline., Results: Gefitinib showed statistically significant benefits over docetaxel in QoL improvement rates (FACT-L 23% versus 14%, P = 0.023; TOI 21% versus 9%, P = 0.002) and mean change from baseline score [mean treatment difference: FACT-L 3.72 points, 95% confidence interval (CI) 0.55-6.89, P = 0.022; TOI 4.31 points, 95% CI 2.13-6.49, P < 0.001], although differences did not meet the clinically relevant six-point change. There were no significant differences between treatments in LCS improvement rates (23% versus 20%, P = 0.562) or mean change from baseline score (0.63 points, 95% CI -0.07 to 1.34, P = 0.077)., Conclusions: Gefitinib improved aspects of QoL over docetaxel, with superior objective response rate and a more favorable tolerability profile and no statistically significant difference in overall survival (although noninferiority was not statistically proven).

Background: This trial evaluated whether a combination of docetaxel and gemcitabine provides better survival than docetaxel alone in patients with previously treated non-small-cell lung cancer (NSCLC)., Patients and Methods: Eligibility included pathologically or cytologically proven NSCLC, failure of one platinum-based regimen, performance status of zero or one, 20-75 years old, and adequate organ function. Patients received docetaxel 60 mg/m(2) (day 1) or docetaxel 60 mg/m(2) (day 8) and gemcitabine 800 mg/m(2) (days 1 and 8), both administered every 21 days until disease progression., Results: Sixty-five patients participated in each arm. This trial was terminated early due to an unexpected high incidence of interstitial lung disease (ILD) and three treatment-related deaths due to ILD in the combination arm. Docetaxel plus gemcitabine compared with docetaxel-alone patients experienced similar grade and incidence of toxicity, except for ILD. No baseline factor was identified for predicting ILD. Median survival times were 10.3 and 10.1 months (one-sided P = 0.36) for docetaxel plus gemcitabine and docetaxel arms, respectively., Conclusion: Docetaxel alone is still the standard second-line treatment for NSCLC. The incidence of ILD is higher for docetaxel combined with gemcitabine than for docetaxel alone in patients with previously treated NSCLC.

Glutathione S-transferases (GSTs) play a vital role in phase II biotransformation of many synthetic chemicals including anticancer drugs. Deletion polymorphisms in GSTT1 and GSTM1 are reportedly associated, albeit controversial, with an increased risk in cancer as well as with altered responses to chemotherapeutic drugs. In this study, to elucidate the haplotype structures of GSTT1 and GSTM1, genetic variations were identified in 194 Japanese cancer patients who received platinum-based chemotherapy. Homozygotes for deletion of GSTT1 (GSTT1(*)0/(*)0 or null) and GSTM1 (GSTM1(*)0/(*)0 or null) were found in 47.4% and 47.9% of the patients, respectively, while 23.2% of the patients had both GSTT1 null and GSTM1 null genotypes. From homozygous (+/+) and heterozygous ((*)0/+) patients bearing GSTT1 and GSTM1 genes, six single nucleotide polymorphisms (SNPs) for GSTT1 and 23 SNPs for GSTM1 were identified. A novel SNP in GSTT1, 226C>A (Arg76Ser), and the known SNP in GSTM1, 519C>G (Asn173Lys, (*)B), were found at frequencies of 0.003 and 0.077, respectively. Using the detected variations, GSTT1 and GSTM1 haplotypes were identified/inferred. Three and six common haplotypes (N> or =10) in GSTT1 and GSTM1, respectively, accounted for most (>95%) inferred haplotypes. This information would be useful in pharmacogenomic studies of xenobiotics including anticancer drugs.

ATP7A and ATP7B are involved in cellular resistance to platinum compounds such as cisplatin. By sequencing ATP7A, 38 genetic variations, including 30 novel ones were detected from 203 Japanese cancer patients. Of these, seven nonsynonymous variations were found: novel 1030A>G (R344G), 2111A>G (Q704R), 2200C>A (Q734K), 2948C>T (T983M) and 3112G>A (V1038I) at 0.004 frequencies and known 2299G>C (V767L) and 4390A>G (I1464V) at 0.351 and 0.075 frequencies, respectively. Regarding ATP7B, 28 novel and 33 known genetic variations were detected including 13 nonsynonymous ones: novel 1258A>G (M420V), 1426G>A (A476T), and 2401A>C (T801P) were found at 0.002, 0.005, and 0.002, respectively and known 1216G>T (A406S), 1366G>C (V456L), 2495A>G (K832R), 2785A>G (I929V), 2855G>A (R952K), 2871delC (P957PfsX9), 3419T>C (V1140A), 3836A>G (D1279G), 3886G>A (D1296N) and 3889G>A (V1297I) at 0.483, 0.463, 0.387, 0.005, 0.384, 0.005, 0.387, 0.002, 0.012, and 0.015 frequencies, respectively. Linkage disequilibrium between detected variations was also analyzed. Our results would provide fundamental and useful information for genotyping ATP7A and ATP7B in the Japanese and probably other Asian populations.

Introduction: The aim of this study was to evaluate the efficacy and safety of Erlotinib in Japanese patients with previously treated non-small cell lung cancer (NSCLC). Available tumor biopsy samples were analyzed to examine relationships between biomarkers and clinical outcome., Methods: This open-label phase II trial enrolled stage III/IV NSCLC patients who had progressive disease after at least one prior platinum-based chemotherapy regimen. Erlotinib was administered at a dose of 150 mg/d orally until disease progression or intolerable toxicity. Analysis of epidermal growth factor receptor gene mutations in exon 18-21 by direct sequencing was performed in tumor tissue specimens obtained at the first diagnosis., Results: Sixty-two patients were enrolled and 60 patients were evaluable for efficacy. Objective response rate and disease control rate were 28.3% and 50.0%; median time to progression and overall survival were 77 days and 14.7 months, respectively. In logistic regression analysis, only smoking history was proved to be a statistically significant predictive factor for response (odds ratio: 0.06, p < 0.001). Only 7 patients had samples available for mutation analysis. Three patients who had deletion mutations on exon 19 (del E746-A750 or del S752-I759) exhibited objective response. Common toxicities were rash (98%), dry skin (81%), and diarrhea (74%). Discontinuation due to adverse events occurred in 11 patients (18%). Four patients (6%) experienced interstitial lung disease-like events, one of whom died., Conclusions: Erlotinib is efficacious in Japanese patients with previously treated NSCLC. The toxicity profile was similar to that in Western patients, except for a somewhat higher incidence of skin disorders and interstitial lung disease. Further studies are needed to determine the relationship between epidermal growth factor receptor mutations and outcomes with Erlotinib in Japanese patients.

Clinical trials performed within the cooperative group system play a substantial role in the advancing of lung cancer therapy. Interactions between the leaders of the cooperative groups are critical and occur regularly throughout the year, but the annual Lung Cancer Congress provides a unique forum for representatives from each group to present ongoing and planned studies in an interactive forum. Herein, we highlight discussion from the 9th annual Lung Cancer Congress in June 2008, focused on advanced-stage non-small-cell lung cancer (NSCLC). Many studies are looking at the addition of targeted agents such as bevacizumab, cetuximab, vascular endothelial growth factor receptor inhibitors, and apoptosis-inducing agents to chemotherapy. Personalizing therapy by better selection of patients for particular drugs is also being emphasized, most notably epidermal growth factor receptor fluorescence in situ hybridization overexpression and other predictions of response with cetuximab. Future articles in this series will address early and locally advanced NSCLC as well as other thoracic malignancies such as small-cell lung cancer and mesothelioma. Ongoing trials within the cooperative groups are an essential component of the persistent improvement in the treatment of lung cancer.

While there have been advances in the treatment of lung cancer, they have been marginal in comparison with recent advances in the chemotherapy and molecularly targeted treatment of breast cancer, colorectal cancer and genitourinary cancer. Lung cancer is an extremely difficult disease to treat, and to obtain positive results and to develop new standard treatment. The results of clinical trial on gefitinib and erlotinib suggest that the evaluation of molecular target drugs seems to be quite difficult in unselected patient population and may be different from cytotoxic drugs. We need to find out specific molecular biomarkers for each drug. With global studies in view, it will be essential to obtain even more significant results by sophisticated clinical trials in selected patient populations and contribute to improving the treatment outcome of lung cancer patients.

Background: The indications for definitive thoracic radiotherapy (TRT) in limited-disease small cell lung cancer (LD-SCLC) and ipsilateral pleural effusion have not been thoroughly investigated. We retrospectively investigated the clinical outcome of LD-SCLC patients with ipsilateral pleural effusion., Methods: The medical records of SCLC patients who received treatment at the National Cancer Center Hospital East between July 1992 and December 2006 were reviewed. Sixty-three of the 373 LD-SCLC patients (17%) had ipsilateral pleural effusion. Of these, 62 patients received chemotherapy as an initial treatment, and were included in this study. Since about 1998, definitive TRT was routinely performed if the patient's pleural effusion disappeared after induction chemotherapy. The 62 patients were divided into three subgroups: group A included patients who received chemotherapy and TRT (n = 26), group B included patients who did not receive TRT in spite of the disappearance of pleural effusion after first-line chemotherapy (n = 8), and group C included patients who did not receive TRT and whose pleural effusion persisted after first-line chemotherapy (n = 28)., Results: The response rate for first-line chemotherapy was 74%. Ipsilateral pleural effusion disappeared after first-line chemotherapy in 34 patients (55%). The median overall survival time was 11.8 months, and the 2 and 3-year survival rates were 21 and 10%, respectively. In groups A, B, and C, the median survival times were 19.2, 10.5, and 9.2 months, respectively, and the 2-year survival rates were 38, 25, and 7%, respectively., Conclusion: Long-term survival was achieved by LD-SCLC patients with ipsilateral pleural effusion who successfully underwent chemoradiotherapy.

Introduction: Concurrent chemoradiotherapy with full doses of cisplatin-based chemotherapy is standard treatment for inoperable stage III non-small cell lung cancer (NSCLC). Although many platinum-based two drug combinations with third-generation agents are difficult to combine fully with thoracic radiotherapy (TRT), a phase I study reported a full dose of cisplatin (CDDP) plus 80% dose of vinorelbine (VNR) was successfully combined with concurrent TRT., Methods: Between October 2000 and October 2004, 73 patients with inoperable stage III NSCLC treated with CDDP, VNR, and concurrent TRT were retrospectively analyzed. Patients were treated with CDDP 80 mg/m on day 1 and VNR 20 mg/m on days 1 and 8 every 4 weeks. Radiotherapy was administered concurrently in cycle 1. The total radiation dose was 60 Gy in 30 fractions. Common Terminology Criteria for Adverse Events version 3.0 were used to assess treatment-related adverse events., Results: Median age was 63 years (40-78). Twenty-nine patients had adenocarcinoma, 63 were male, 47 ECOG PS 1, and 47 stage IIIB. Median chemotherapy cycle was 2.0. Objective response rate was 93% and median survival time was 21 months. Three-year overall survival rate was 33%. Infield control rate was 71%. The most common grade 3 or 4 adverse event was leukocytopenia (67%). Only 3 patients (4%) experienced grade 3 esophagitis. One patient died of radiation pneumonitis 87 days after completion of chemoradiotherapy., Conclusions: Concurrent chemoradiotherapy with CDDP and VNR was highly active and well-tolerated. This regimen could be used as a control arm in future trial for stage III NSCLC.

Introduction: Vandetanib (ZACTIMA) is a once-daily, oral anticancer drug that selectively inhibits vascular endothelial growth factor receptor (VEGFR) and epidermal growth factor receptor (EGFR) signaling. Vandetanib was evaluated as a monotherapy in a randomized, double-blind, dose-finding study in Japan., Patients and Methods: Eligible patients with locally advanced or metastatic (stage IIIB/IV) or recurrent non-small cell lung cancer, previously treated with chemotherapy, were randomized to receive once-daily oral vandetanib 100, 200, or 300 mg (1:1:1). The primary objective was to determine the objective response rate for each vandetanib dose., Results: Fifty-three patients received vandetanib (100 mg, n = 17; 200 mg, n = 18; 300 mg, n = 18). The objective response rate in each dose arm was 17.6% (3 of 17; 100 mg), 5.6% (1 of 18; 200 mg), and 16.7% (3 of 18; 300 mg). Common adverse events included rash, diarrhea, hypertension, and asymptomatic QTc prolongation. The adverse event profile was generally consistent with that reported previously for agents that inhibit the VEGFR or EGFR signaling pathways. Among the three responders evaluated for EGFR mutation, two had no mutation, and in one case, the EGFR mutation status could not be determined by direct DNA sequencing and amplification refractory mutation system assay of EGFR exons 19-21. Baseline plasma VEGF levels appeared to be lower in patients who experienced clinical benefit after vandetanib treatment., Conclusion: In Japanese patients with advanced non-small cell lung cancer, vandetanib monotherapy (100-300 mg/d) demonstrated antitumor activity with an acceptable safety and tolerability profile.

Combined-modality therapy has emerged as the standard of care for fit patients with unresectable, locally advanced non-small-cell lung cancer (NSCLC). Concurrent chemotherapy/radiation has demonstrated therapeutic superiority compared with sequential or asynchronous chemotherapy and radiation in this setting. The role of consolidation or maintenance therapy with targeted agents or conventional cytotoxic agents remains unclear. We explore the portfolio of clinical trials being conducted in locally advanced NSCLC by North American cooperative oncology groups as well as ongoing trials in Europe and Japan. These efforts focus on radiation dose escalation using image-guided radiation therapy as well as newer cytotoxic agents (eg, pemetrexed) and targeted therapies (eg, cetuximab, bevacizumab, and etc) thus far unexplored in this setting.

Many of the most significant advances in the treatment of lung cancer have come from trials run within the cooperative group system. The leaders of the lung cancer section of each group interact throughout the year, but an annual lung cancer congress in Hawaii provides a forum for extensive discussions of ongoing and planned trials. This article is the first in a series that will focus on the key points of this discussion held at the 8th Annual Lung Cancer Congress in June 2007. Early-stage non-small-cell lung cancer trials are highlighted in this manuscript. Current work in adjuvant therapy is focused on exploring the use of bevacizumab in addition to chemotherapy for resected disease in a large Intergroup study and the use of more "personalized" chemotherapy based on specific genomic or protein expression profiles of individual tumors in smaller exploratory studies. The question of postoperative radiation therapy is being addressed within the cooperative groups. Alternative approaches to surgery, such as lesser resections in smaller tumors and accelerated radiation including stereotactic radiosurgery, are also under investigation within this framework. Ongoing trials within the cooperative groups continue to drive steady improvement in the treatment of lung cancer and offer great promise for the future.

The multidrug resistance-associated protein 2 (MRP2) encoded by the ABCC2 gene is expressed in the liver, intestine and kidneys and preferentially exports organic anions or conjugates with glucuronide or glutathione. In this study, all 32 exons and the 5'-flanking region of ABCC2 in 236 Japanese were resequenced, and 61 genetic variations including 5 novel nonsynonymous ones were detected. A total of 64 haplotypes were determined/inferred and classified into five *1 haplotype groups (*1A, *1B, *1C, *1G, and *1H) without nonsynonymous substitutions and *2 to *9 groups with nonsynonymous variations. Frequencies of the major 4 haplotype groups *1A (-1774delG), *1B (no common SNP), *1C (-24C>T and 3972C>T), and *2 [1249G>A (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. This study revealed that haplotype *1A, which has lowered activity, is quite common in Japanese, and that the frequency of *1C, another functional haplotype, was comparable to frequencies in Asians and Caucasians. In contrast, the haplotypes harboring 3972C>T but not -24C>T (*1G group), which are reportedly common in Caucasians, were minor in Japanese. Moreover, the allele 1446C>T (Thr482Thr), which has increased activity, was not detected in our Japanese population. These findings imply possible differences in MRP2-mediated drug responses between Asians and Caucasians.

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78&#95;+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78&#95; +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.

The vitamin D receptor (VDR) is a transcriptional factor responsive to 1alpha,25-dihydroxyvitamin D(3) and lithocholic acid, and induces expression of drug metabolizing enzymes CYP3A4, CYP2B6 and CYP2C9. In this study, the promoter regions, 14 exons (including 6 exon 1's) and their flanking introns of VDR were comprehensively screened for genetic variations in 107 Japanese subjects. Sixty-one genetic variations including 25 novel ones were found: 9 in the 5'-flanking region, 2 in the 5'-untranslated region (UTR), 7 in the coding exons (5 synonymous and 2 nonsynonymous variations), 12 in the 3'-UTR, 19 in the introns between the exon 1's, and 12 in introns 2 to 8. Of these, one novel nonsynonymous variation, 154A>G (Met52Val), was detected with an allele frequency of 0.005. The single nucleotide polymorphisms (SNPs) that increase VDR expression or activity, -29649G>A, 2T>C and 1592((*)308)C>A tagging linked variations in the 3'-UTR, were detected at 0.430, 0.636, and 0.318 allele frequencies, respectively. Another SNP, -26930A>G, with reduced VDR transcription was found at a 0.028 frequency. These findings would be useful for association studies on VDR variations in Japanese.

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.

Background: To compare the efficacy and toxicity of three platinum-based combination regimens against cisplatin plus irinotecan (IP) in patients with untreated advanced non-small-cell lung cancer (NSCLC) by a non-inferiority design., Patients and Methods: A total of 602 patients were randomly assigned to one of four regimens: cisplatin 80 mg/m(2) on day 1 plus irinotecan 60 mg/m(2) on days 1, 8, 15 every 4 weeks (IP) carboplatin AUC 6.0 min x mg/mL (area under the concentration-time curve) on day 1 plus paclitaxel 200 mg/m(2) on day 1 every 3 weeks (TC); cisplatin 80 mg/m(2) on day 1 plus gemcitabine 1000 mg/m(2) on days 1, 8 every 3 weeks (GP); and cisplatin 80 mg/m(2) on day 1 plus vinorelbine 25 mg/m(2) on days 1, 8 every 3 weeks (NP)., Results: The response rate, median survival time, and 1-year survival rate were 31.0%, 13.9 months, 59.2%, respectively, in IP; 32.4%, 12.3 months, 51.0% in TC; 30.1%, 14.0 months, 59.6% in GP; and 33.1%, 11.4 months, 48.3% in NP. No statistically significant differences were found in response rate or overall survival, but the non-inferiority of none of the experimental regimens could be confirmed. All the four regimens were well tolerated., Conclusion: The four regimens have similar efficacy and different toxicity profiles, and they can be used to treat advanced NSCLC patients.

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122&#95;+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122&#95;+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

The charge of the Molecular Biology, Genomics, and Proteomics in Bronchioloalveolar Carcinoma Committee was to evaluate the molecular biology, genomic changes, and proteomic findings in patients with bronchioloalveolar carcinoma compared with other types of lung cancer. The literature was reviewed and unpublished information was presented by the committee members at the session. The molecular biology studies have included findings on epidermal growth factor receptor (EGFR) mutations, p53 mutations, K-ras mutations, and loss of heterozygosity. The genomic changes have mostly focused on the mRNA expression arrays as well as protein studies. The current state of knowledge was reviewed, the missing information was acknowledged, and proposals for future research were identified.

Introduction: ZD6474 (vandetanib) is an orally available inhibitor of vascular endothelial growth factor receptor, epidermal growth factor receptor, and RET receptor tyrosine kinase activity. This study assessed the safety and tolerability of escalating doses of ZD6474 in Japanese patients with solid, malignant tumors., Methods: Adult patients with solid tumors refractory to standard therapy received a once-daily oral dose of ZD6474 (100-400 mg) in 28-day cycles, until disease progression or unacceptable toxicity was observed., Results: Eighteen patients were treated at doses of 100 mg (n = 3), 200 mg (n = 6), 300 mg (n = 6), and 400 mg (n = 3). Dose-limiting toxicities at the completion of cycle 2 were hypertension (n = 3), diarrhea (n = 1), headache (n = 1), toxic skin eruption (n = 1), and alanine aminotransferase increase (n = 1). A dose of 400 mg/day was considered to exceed the maximum tolerated dose (MTD). Toxicities were manageable with dose interruption and/or reduction. Objective tumor response was observed in four of nine patients with non-small cell lung cancer (NSCLC) at doses of either 200 or 300 mg. Terminal half-life was about 90-115 hours. Plasma trough concentrations achieved steady-state conditions after approximately 1 month of daily dosing., Conclusions: It was concluded that a dose of 400 mg/day was considered to exceed the MTD, and doses for phase II study were thought to be not more than 300 mg/day. The objective response observed in some NSCLC patients is encouraging for further studies in this tumor type.

Background: To evaluate the feasibility and efficacy of docetaxel consolidation therapy after concurrent chemoradiotherapy for unresectable stage III non-small cell lung cancer (NSCLC)., Patients and Methods: The eligibility criteria included unresectable stage III NSCLC, no previous treatment, age between 20 and 74 years, and performance status 0 or 1. Treatment consisted of cisplatin (80 mg/m2 on days 1, 29, and 57), vinorelbine (20 mg/m2 on days 1, 8, 29, 36, 57, and 64), and thoracic radiotherapy (TRT) (60 Gy/30 fractions over 6 weeks starting on day 2), followed by consolidation docetaxel (60 mg/m2 every 3 to 4 weeks for three cycles)., Results: Of 97 patients who were enrolled in this study between 2001 and 2003, 93 (76 males and 17 females with a median age of 60) could be evaluated. Chemoradiotherapy was well tolerated; three cycles of chemotherapy and 60 Gy of TRT were administered in 80 (86%) and 87 (94%) patients, respectively. Grade 3 or 4 neutropenia, esophagitis, and pneumonitis developed in 62, 11, and 3 patients, respectively. Docetaxel consolidation was administered in 59 (63%) patients, but three cycles were completed in only 34 (37%) patients. The most common reason for discontinuation was pneumonitis, which developed in 14 (24%) of the 59 patients. During consolidation therapy, grade 3 or 4 neutropenia, esophagitis, and pneumonitis developed in 51, 2, and 4 patients, respectively. A total of four patients died of pneumonitis. We calculated a V20 (the percent volume of the normal lung receiving 20 Gy or more) on a dose-volume histogram in 25 patients. Of these, five patients developed grade 3 or more severe radiation pneumonitis. A median V20 for these five patients was 35% (range, 26-40%), whereas the median V20 for the remaining 20 patients was 30% (range, 17-35%) (p = 0.035 by a Mann-Whitney test). The response rate was 81.7% (95% confidence interval [CI], 72.7-88.0%), with 5 complete and 71 partial responses. The median progression-free survival was 12.8 (CI, 10.2-15.4) months, and median survival was 30.4 (CI, 24.5-36.3) months. The 1-, 2-, and 3-year survival rates were 80.7, 60.2, and 42.6%, respectively., Conclusion: This regimen produced promising overall survival in patients with stage III NSCLC, but the vast majority of patients could not continue with the docetaxel consolidation because of toxicity.

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803&#95;-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703&#95;1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703&#95;1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.