Search

To link to full-text access for this article, visit this link: http://dx.doi.org/10.1016/j.anbehav.2005.04.003 Byline: Helen Simcox, Nick Colegrave, Adel Heenan, Chris Howard, Victoria A. Braithwaite Abstract: We used laboratory and field-based experiments to examine male mate choice in the promiscuous Panamanian bishop Brachyrhaphis episcopi (Poeciliidae) (also referred to as Brachyraphis episcopi). As females of this species can store sperm, males could increase their reproductive success by selectively mating with different females. To test this, males in both the laboratory and field were allowed to choose between a familiar (same tank or pool) and an unfamiliar female (different tank or pool). We compared males from streams and seasonally occurring pools to see whether lack of access to new females in pools promotes male mate choice for unfamiliarity. In addition, we chose streams and pools both with and without predatory fish to examine the influence of predation risk. In both the laboratory and the field, males attempted more matings with unfamiliar than familiar females. Field experiments showed that courtship preferences differed between males from populations with and without predatory fish: males from populations with predators were choosy only when light levels were dim, whereas males from populations without predators were choosy when light levels were brighter. Males from both streams and pools discriminated between familiar and unfamiliar females, but there were no differences in mating preferences between males from each habitat. Although the reasons for a preference for unfamiliar females remain unclear, the plasticity of this behaviour is evident. Differences in male mate choice between populations with and without predators suggest that males may face a trade-off between the costs and benefits of being choosy. Author Affiliation: Institute of Evolutionary Biology, University of Edinburgh, U.K. Article History: Received 12 October 2004; Revised 4 December 2004; Accepted 8 April 2005 Article Note: (miscellaneous) MS. number: 8297

Radionuclides are cosmogenically produced in meteorites before they fall to the surface of the Earth. Measurement of the radioactive decay of such nuclides provides a wealth of information on the irradiation conditions of the meteorite fragment, the intensity of cosmic rays in the inner solar system, and the magnetic activity of the Sun. We report here on the detection of 26 Al using a sophisticated spectrometer consisting of a HPGe detector and a NaI(Tl) annulus. It is shown that modern γ -ray spectrometers represent an interesting alternative to other detection techniques. Data are obtained for a fragment of the Farmville meteorite and compared to results from Geant4 simulations. In particular, we report on optimizing the detection sensitivity by using suitable coincidence gates for deposited energy and event multiplicity. We measured an 26 Al activity of 48.5±3.5 dpm/kg for the Farmville meteorite, in agreement with previously reported values for other H chondrites. [ABSTRACT FROM AUTHOR]

Abstract: A new solvent-based CO2 capture process couples the unique attributes of non-aqueous, CO2-binding organic liquids (CO2BOLs) with the newly discovered polarity-swing-assisted regeneration (PSAR) process that is unique to switchable ionic liquids. Laboratory measurements with PSAR indicate the ability to achieve a regeneration effect at 75°C compared to a temperature of 120°C using thermal regeneration only. Initial measurements also indicate the kinetic behavior of CO2 release is also improved with PSAR. [Copyright &y& Elsevier]

Summary: The protective efficacy of Mycobacterium bovis-bacille Calmette Guérin (BCG) against tuberculosis (TB) is variable in both humans and cattle. Exposure to environmental mycobacteria is thought to result in inappropriate priming of host immune responses. To investigate the impact of environmental mycobacteria on BCG efficacy, cattle were infected with M. avium, vaccinated with BCG, challenged with M. bovis and skin tested prior to necropsy. Elevated levels of IFNγ were evident in M. avium-exposed animals before and after BCG vaccination with a bias towards avian purified protein derivative (PPD-A), suggesting that M. avium primed host immune responses. Exposure to M. avium also resulted in a higher frequency of circulatory IFNγ-producing cells in response to PPD antigens at the time of M. bovis challenge. After M. bovis inoculation, the IFNγ response to bovine PPD (PPD-B) increased compared to pre-challenge levels, indicating that all animals had been exposed to M. bovis. Skin test responses indicated 2/6 M. avium-BCG-M. bovis animals as reactors and 2/6 as inconclusive compared with 6/6 BCG-M. bovis animals as reactors. M. avium-exposed animals also had fewer lesions and the number of tissues containing viable M. bovis at post-mortem was significantly lower (P<0.02 compared with BCG-M. bovis animals), with two of the animals described as skin test negative with no visible lesions or viable bacteria. Thus, exposure of cattle to environmental mycobacteria such as M. avium prior to BCG vaccination did not dampen BCG-specific immune responses and resulted in lower TB pathology. However, the PPD-A bias associated with M. avium exposure is likely to undermine current TB diagnostic tests and the IFNγ test in cattle. [Copyright &y& Elsevier]

Abstract: Dendritic cell antigen targeting primes robust immune responses in mouse models. Optimizing this immunization strategy in the actual hosts that require protection will advance development of efficacious contemporary vaccines. In a proof-of-concept study, we tested the immunogenicity of a single, low dose of a novel multi-component DNA construct expressing a CD205-targeted antigen fused to a CD40L minimal functional domain for linked DC activation. The DNA construct was formulated with DNA-encoded Flt3L and GM-CSF for DC recruitment and the formulation was evaluated in MHC class II-matched calves. Immunization of the calves with the CD205 antigen-targeting construct mixed with the cytokine constructs induced significant IFN-γ-secreting CD4+ T-cells, CD4+ T-cell proliferation, and antibody responses detectable within one week post-immunization. CD205 antigen-targeting significantly expanded IFN-γ-secreting CD4+ T-cells, CD4+ T-cell proliferation, and IgG antibody responses three weeks post-immunization. Nineteen weeks post-priming, the IFN-γ-secreting CD4+ T-cells, CD4+ T-cell proliferation, and the IgG titers were waning, but they remained significant. Following boosting at nineteen weeks post-immunization, the immune responses primed by the CD205-targeted antigen underwent rapid recall and the mean response tripled within one week post-boost. Comparative analysis of the immune responses observed one week post-priming versus the responses detected one week post-boost revealed that the average number of the IFN-γ-secreting CD4+ T-cells observed in the calves immunized with the CD205 antigen targeting construct increased five-fold, the mean CD4+ T-cell proliferation increased three-fold, whereas the mean IgG antibody titer increased two hundred-fold. These promising outcomes support testing the protective efficacy of CD205-targeted antigens in the calf model. [Copyright &y& Elsevier]

Abstract: The incidence of bovine tuberculosis (TB) continues to rise, and causes significant economic losses worldwide. The causative agent of bovine TB, Mycobacterium bovis, is closely related to the human pathogen M. tuberculosis, and yet these two organisms differ profoundly in their ability to cause disease in cattle. The innate immune system is primarily responsible for controlling disease, with the alveolar macrophage (AlvMϕ) acting as one of the first points of contact between host and respiratory pathogens. In this study we have examined some of the differences in this component of the host immune response to M. bovis and M. tuberculosis, with the aim of improving our understanding of why M. bovis is able to cause disease in cattle whereas M. tuberculosis is efficiently controlled. Initial studies using microarray technology revealed that chemokines represented some of the most differentially expressed genes between M. tuberculosis and M. bovis-infected bovine AlvMϕ. M. tuberculosis-infected bovine AlvMϕ expressed significantly higher levels of the chemokines CCL3, CCL4, CCL5 and CXCL8, whereas M. bovis-infected AlvMϕ were shown to express higher levels of CCL23. We further demonstrated the role of chemokines in bovine TB by showing that supernatants from AlvMϕ infected with M. tuberculosis were significantly more effective than those from M. bovis-infected cells at attracting bovine granulocytes in an in vitro chemotaxis assay. These results have significant implications in vivo as they suggest that the M. bovis-infected macrophage is able to circumvent activation of the host chemotactic response and thereby evade killing by the host immune system. [Copyright &y& Elsevier]

Abstract: The effector mechanisms used by CD4+ T cells to control mycobacteria differ between humans and rodent models of TB and should be investigated in additional animal models. In these studies, the bovine model was used to characterize the mycobactericidal CD4+ T cell response induced by vaccination with the attenuated Mycobacterium bovis bacillus Calmette-Guérin (BCG). Antigenic stimulation of peripheral blood CD4+ T cells from BCG-vaccinated cattle enhanced expression of perforin and IFNγ in cells expressing a CD45RA−CD45RO+CD62L+ cell surface phenotype, enhanced transcription of granulysin, IFNγ, perforin, IL-4, IL-13, and IL-21, and enhanced anti-mycobacterial activity of CD4+ T cells against BCG-infected macrophages. [Copyright &y& Elsevier]

Abstract: We aimed to establish the population prevalence of the MELAS 3243A>G mtDNA mutation in a large Caucasian-based population (n =2954; 99% Caucasian, 57% women and mean age of 66.4 years). All participants underwent comprehensive clinical evaluation including audiologic testing. We detected the 3243A>G mutation in seven subjects using standard polymerase chain reaction/restriction fragment length polymorphism methods, establishing a population prevalence of 236/100000 (0.24%; 95% CI 0.10–0.49%); much higher than previously reported. All had mild to moderate hearing loss. Our findings indicate that subjects with the 3243A>G mtDNA mutation could be markedly under-recognised in the community. [Copyright &y& Elsevier]

The response of DC, and the subsequent stimulation of T cells, is an essential part of the initiation of immune responses following microbial challenge. The response of human DC to bacterial lipopeptides is mediated by toll-like receptor 2, and is characterised by DC maturation and the enhanced capacity to stimulate of T cells. We report here that bovine DC are also induced to mature following lipopeptide stimulation. Exposure of DC to the model lipopeptide Pam3CSK4 was associated with increased expression of MHC, costimulatory molecules, and enhanced secretion of IL-12 and TNFα. Lipopeptide-matured DC were superior in their ability to induce T cell activation and IFNγ secretion. In contrast, exposure of MΦ to lipopeptides induced down-regulation of MHC expression and much lower increases in IL-12 secretion. A lipopeptide derived from the sequence of a relevant mycobacterial lipoprotein, MPB83, also influenced bovine DC by stimulating increases in IL-12 and TNFα secretion. These different changes in bovine DC and MΦ may have important implications for immune responses induced following bacterial infection with uptake of microbes by DC resulting in potentiation of their immunostimulatory capacity and uptake by MΦ having a much less marked effect on immune responses. [Copyright &y& Elsevier]

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-γ production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-γ-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-γ transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-γ mediated cellular immune responses in cattle. [Copyright &y& Elsevier]

Orf virus causes pustular skin lesions (orf) in sheep, goats and humans. The virus encodes an interleukin-10 (orfvIL-10) that is identical in amino acid composition to ovine IL-10 (ovIL-10) over the C terminal two-thirds of the polypeptide, but not in the N terminal third. The immuno-suppressive and immuno-stimulatory activities of orfvIL-10 and ovIL-10 were compared. Both orfvIL-10 and ovIL-10 inhibited TNF-α and IL-8 cytokine production from stimulated ovine macrophages and keratinocytes and IFN-γ and GM-CSF production from peripheral blood lymphocytes. OrfvIL-10 and ovIL-10 co-stimulated both ovine and murine mast cell proliferation in conjunction with IL-3 (ovine) or IL-4 (murine). Isoleucine at position 87 (Ile87) of the mature human IL-10 (huIL-10) has been reported as essential for the immuno-stimulatory activity of huIL-10. In spite of the differences in amino acids within the N-terminal third of orfvIL-10 compared with ovIL-10 and substitution of Ile87 with Ala87 in ovIL-10, these variants of ovIL-10 and orfvIL-10 all co-stimulated mast cell proliferation and inhibited macrophage IL-8 production. As ovIL-10 and orfvIL-10 have a similar structure to huIL-10 and conserved receptor-binding residues, it was concluded that Ile87 is not essential for IL-10 immuno-stimulatory activity. Finally, ovine keratinocytes do not express ovIL-10. This might explain why orf virus has evolved a viral IL-10. [Copyright &y& Elsevier]

Caveolae are small, cholesterol-rich, hydrophobic membrane domains, characterized by the presence of the protein caveolin and involved in several cellular processes, including clathrin-independent endocytosis, the regulation and transport of cellular cholesterol, and signal transduction. Recently, caveolae have been identified as providing a novel route by which several pathogens are internalized by antigen-presenting cells and as centers for signal transduction. Here, we review the distribution and role of caveolae and caveolin in mammalian immune cells. [Copyright &y& Elsevier]

Iron and aluminium based coagulants are used in enormous amounts and play an essential role in urban water management globally. They are dosed at drinking water production facilities for the removal of natural organic matter. Iron salts are also dosed to sewers for corrosion and odour control, and at wastewater treatment plants (WWTPs) for phosphate removal from wastewater and hydrogen sulfide removal from biogas. A recent laboratory study revealed that iron dosed to sewers is available for phosphate and hydrogen sulfide removal in the downstream WWTP. This study demonstrates for the first time under real-life conditions the practical feasibility and effectiveness of the strategy through a year-long full-scale investigation. Over a period of 5 months, alum dosing at ∼190 kg Al/day to the bioreactor in a full-scale WWTP was stopped, while FeCl 2 dosing at ∼160 kg Fe/day in the upstream network was commenced. Extensive sampling campaigns were conducted over the baseline, trial and recovery periods to investigate sulfide control in sewers and its flow-on effects on phosphate in WWTP effluent, H 2 S in biogas, as well as on the WWTP effluent hypochlorite disinfection process. A plant-wide mass balance analysis showed that the Fe2+ dosed upstream was effectively used for P removal in the activated sludge tanks, with an effluent phosphate concentration comparable to that in the baseline period (i.e. with alum dosing to the bioreactor). Simultaneously, hydrogen sulfide concentration in biogas decreased ∼43%, from 495 ± 10 to 283 ± 4 ppm. No effects on biological nitrogen removal and disinfection processes were observed. Both effluent phosphate and H 2 S in biogas increased in the recovery period, when in-sewer dosing of FeCl 2 was stopped. X-ray diffraction failed to reveal the presence of vivianite in the digested sludge, providing strong evidence that thermal hydrolysis prevented the formation of vivianite during anaerobic digestion. The latter limits the potential for selective recovery of Fe and P through magnetic separation. Overall, our study clearly demonstrates the multiple beneficial reuse of iron in a real urban wastewater system and urges water utilities to adopt an integrated approach to coagulant use in urban water management. • Long-term, field demonstration of 3-time uses of iron in an urban wastewater system. • 3-uses include sulfide control in sewer and digester and P removal in bioreactor. • Thermal hydrolysis destroyed vivianite in activated sludge. • Thermal hydrolysis inhibited formation of vivianite during anaerobic digestion. [ABSTRACT FROM AUTHOR]