Search

The human gene MafF (hMafF) is a member of bZip transcription factor Maf family, but it alone cannot activate its target genes. In 2006, a novel hMafF interacting protein (MIP) was identified. Transient transfection assay in Hela cells suggested that co-expression of MIP and hMafF could activate US2-driven transcription. In this work, we constructed a series of plasmids and transformed YM4271 yeast strain to establish a recombinant yeast detection system. In this system, MIP's expression level could be regulated using glucose incubation or galactose-induced incubation. The expression level of reporter gene LacZ in obtained recombinant yeast strains was measured using quantitative liquid assay. By comparing and analyzing the beta-galactosidase activities of different yeast strains or the same yeast strain in different culture media, the effect of MIP on transactivation driven by nUS2-hMafF was finally determined. Only in the presence of both MIP and hMafF could the nUS2-pLacZi reporter in yeast genome be activated. More importantly, this work established a novel recombinant yeast detection system, which may serve as a powerful tool to study the regulatory mechanisms of transcription complex in the future.

Maf proteins are basic-leucine zipper transcription factors belonging to the AP1 superfamily. Several developmental processes require Maf proteins yet, the redundancy or complementarity of their respective roles in common processes has been only partially investigated. We present for the first time a complete comparative analysis of maf gene expression patterns in vertebrates. Expression of c-maf, mafB/kreisler, mafA/L-maf, mafF, mafG and mafK was analyzed by whole-mount in situ hybridization within chick embryos and their extraembryonic tissues ranging from embryonic day (E) 1 to 7. We carefully examined the extent of overlap between distinct maf genes and report that the developing lens, kidney, pancreas and apoptotic zones of limb buds show sustained co-expression of large maf genes. Small maf genes also exhibit overlap, for example in the dermomyotome. We also describe so far unidentified sites of maf gene expression. mafA is found in the developing neural tube and dorsal root ganglia. c-maf hybridization is detected in the neuroretina, the notochord and the endothelium of extraembryonic blood vessels.

ABSTRACT The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human β-globin locus control region is required for high level globin gene expression. We used an oligonucleotide of the NF-E2 tandem repeat, within HS2, as recognition site probe to screen a K562 cDNA library for interacting transcription factors. A 2.3 kb full length cDNA encoding the b-zip transcription factor MafF was isolated. MafF can form both homodimers and high affinity heterodimers with Nrf1, Nrf2 and Nf-E2, three members of the CNC-bZip family. Despite obvious structural similarities with the other small Maf proteins, MafF differs in its tissue distribution and its inability to repress transcription when overexpressed as homodimer. In fact, in different cell lines and on different promoters (γ-globin, β-globin and glutamylcysteine synthetase genes) the MafF homodimers do not appreciably affect transcription of target promoters, whereas MafF/CNC member heterodimers act as weak transcriptional activators. Even though MafF was cloned using probes derived from the globin LCR, it is in the context of the GCSl promoter and in combination with Jun that MafF shows a rather distinct and specific regulatory role. These observations suggest that a complex network of small Maf and CNC—AP1 protein interactions might be involved in regulating transcription in diverse tissues or developmental stages.

TCF11 (also known as Nrf1 and LCR-F1) is a basic-region leucine-zipper (b-ZIP) transcription factor that is essential during embryonic development. We have carried out expression analysis at a number of developmental stages and find that while there is some localized elevated expression between 8 and 9 days post coitum (dpc), the gene is widely expressed with a constant level of mRNA transcripts detectable in all tissues and at all stages examined. However, this does not reflect the specific nature of a TCF11 mutant phenotype (EMBO J. 17 (1998) 1779) which shows an essential role in foetal liver haematopoiesis. The specificity of TCF11 function may be controlled at a post-transcriptional level including availability of, and specific interaction with, a range of potential heterodimerization partners. We therefore carried out expression analysis of four candidate partner molecules; the three small Maf genes and another bZIP transcription factor found to bind to TCF11 in a two-hybrid screen, ATF4. We show different patterns of expression for the three Maf genes during development with MafG being widely expressed, MafK expressed only later in development and in specific tissues, and no detection of MafF. ATF4 shows evidence of complex regulation during development and shows elevated expression in many of the same sites as TCF11.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Small Maf proteins are obligatory heterodimeric partner molecules of mammalian Cap'n'Collar proteins that together control a wide variety of eukaryotic genes. Although both MafK and MafG are expressed in overlapping but distinct tissue distribution patterns during embryonic development, the physiological consequences of loss-of-function mutations in either gene are modest. This suggested that compensation by the third small Maf protein, MafF, might be a major reason for such mild phenotypes and that further analysis of MafF might therefore provide important insights for understanding small Maf regulatory function(s). We therefore cloned, mapped, transcriptionally and developmentally characterized, and finally disrupted the mafF gene. We show that murine mafF is transcriptionally regulated by three different promoters and is most abundantly expressed in the lung. The lacZ gene inserted into the mafF locus revealed prominent expression sites in the gut, lung, liver, outflow tract of the heart, cartilage, bone membrane, and skin but not in hematopoietic cells at any developmental stage. Homozygous mafF null mutant mice were born in a normal Mendelian ratio and displayed no obvious functional deficiencies, indicating that MafF activity may be dispensable even in tissues where the expression of other small Maf proteins is quite low.

Objective To report a novel phenotype of autosomal dominant atypical congenital cataract associated with variable expression of microcornea, microphthalmia, and iris coloboma linked to chromosome 2. Molecular analysis of this phenotype may improve our understanding of anterior segment development. Design Observational case study, genome linkage analysis, and gene mutation screening. Participants Three families, 1 Egyptian and 2 Belgians, with a total of 31 affected were studied. Methods Twenty-one affected subjects and 9 first-degree relatives underwent complete ophthalmic examination. In the Egyptian family, exclusion of PAX6, CRYAA , and MAF genes was demonstrated by haplotype analysis using microsatellite markers on chromosomes 11, 16, and 21. Genome-wide linkage analysis was then performed using 385 microsatellite markers on this family. In the 2 Belgian families, the PAX6 gene was screened for mutations by direct sequencing of all exons. Main Outcome Measures Phenotype description, genome-wide linkage of the phenotype, linkage to the PAX6, CRYAA , and MAF genes, and mutation detection in the PAX6 gene. Results Affected members of the 3 families had bilateral congenital cataracts inherited in an autosomal dominant pattern. A novel form of hexagonal nuclear cataract with cortical riders was expressed. Among affected subjects with available data, 95% had microcornea, 39% had microphthalmia, and 38% had iris coloboma. Seventy-five percent of the colobomata were atypical, showing a nasal superior location in 56%. A positive lod score of 4.86 was obtained at θ = 0 for D2S2309 on chromosome 2, a 4.9-Mb common haplotype flanked by D2S2309 and D2S2358 was obtained in the Egyptian family, and linkage to the PAX6, CRYAA , or MAF gene was excluded. In the 2 Belgian families, sequencing of the junctions and all coding exons of PAX6 did not reveal any molecular change. Conclusions We describe a novel phenotype that includes the combination of a novel form of congenital hexagonal cataract, with variably expressed microcornea, microphthalmia, and atypical iris coloboma, not caused by PAX6 and mapping to chromosome 2. Financial Disclosure(s) The authors have no proprietary or commercial interest in any materials discussed in this article.