Search

BACKGROUND: Hypotension is associated with organ injury and death in surgical and critically ill patients. In clinical practice, treating hypotension remains challenging because it can be caused by various underlying haemodynamic alterations. We aimed to identify and independently validate endotypes of hypotension in big datasets of surgical and critically ill patients using unsupervised deep learning. METHODS: We developed an unsupervised deep learning algorithm, specifically a deep learning autoencoder model combined with a Gaussian mixture model, to identify endotypes of hypotension based on stroke volume index, heart rate, systemic vascular resistance index, and stroke volume variation observed during episodes of hypotension. The algorithm was developed with data from 871 surgical patients who had 6962 hypotensive events and validated in two independent datasets, one including 1000 surgical patients who had 7904 hypotensive events and another including 1000 critically ill patients who had 53 821 hypotensive events. We defined hypotension as a mean arterial pressure

Background/Objectives: Health care workers are at greater risk for death by suicide compared to the general population and are less likely to seek assistance. More information about correlates of suicidality and treatment-seeking behavior are needed to reduce risk. Methods: The American Foundation for Suicide Prevention developed an Interactive Screening Program to identify and engage at-risk staff and trainees in health care settings. The study reports on the prevalence and demographic and clinical predictors of current suicidal thoughts, behaviors and mental health treatment at a single site (n = 5898) from 2009 to 2024. Results: The study found that 18.2% of respondents reported current suicidal thoughts and behaviors. These were more common among respondents who were younger, male, and who identified as a race/ethnicity other than non-Hispanic White. Suicidal thoughts and behaviors were more likely among those with higher PHQ-8 scores (OR = 1.23, p < 0.01) and those who endorsed maladaptive coping behaviors, hopelessness, loneliness, stress and nervousness (ORs 1.36-3.04, ps < 0.01). Current mental health treatment was more likely among women, non-Hispanic White respondents compared with Asian or Pacific Islander respondents, and nurses relative to physicians. Mental health treatment was also associated with higher PHQ-8 scores, lifetime suicide attempts, difficulty controlling eating and alcohol consumption, and recent feelings of anxiety, stress and nervousness. Conclusions: Findings suggest a continued need to identify and engage health care trainees and staff who are at risk for suicide and to establish new approaches to linking these individuals to resources or interventions aimed at reducing risk. The study identified male and/or Asian/Pacific Islander-identifying health care workers who reported intense loneliness and/or hopelessness, use of non-prescription drugs and recent suicidal thoughts and/or behaviors as high-risk individuals who may require enhanced methods of outreach, identification, acceptance and accessibility of treatment.

Background: Circulating glycine levels have been associated with reduced risk of coronary artery disease (CAD) in humans but these associations have not been observed in all studies. We evaluated whether the relationship between glycine levels and atherosclerosis was causal using genetic analyses in humans and feeding studies in mice. Methods: Serum glycine levels were evaluated for association with risk of CAD in the UK Biobank. Genetic determinants of glycine levels were identified through a genome-wide association study (GWAS) and used to evaluate the causal relationship between glycine and risk of CAD by Mendelian randomization (MR). A dietary supplementation study was carried out with atherosclerosis-prone apolipoprotein E deficient (ApoE-/-) mice to determine the effects of increased circulating glycine levels on cardiometabolic traits and aortic lesion formation. Results: Among 105,718 UK Biobank subjects, elevated serum glycine levels were associated with significantly reduced risk of prevalent CAD (Quintile 5 vs. Quintile 1 OR = 0.76, 95% CI 0.67-0.87; p < 0.0001) and incident CAD (Quintile 5 vs. Quintile 1 HR = 0.70, 95% CI 0.65-0.77; p < 0.0001) after adjustment for age, sex, ethnicity, anti-hypertensive and lipid-lowering medications, blood pressure, kidney function, and diabetes. A GWAS meta-analysis with 230,947 subjects identified 61 loci for glycine levels, of which 26 were novel. MR analyses provided modest evidence that genetically elevated glycine levels were causally associated with reduced systolic blood pressure and risk of type 2 diabetes, but did not provide significant evidence for an association with decreased risk of CAD. Glycine supplementation in mice had no effects on cardiometabolic traits or atherosclerotic lesion development. Conclusions: While expanding the genetic architecture of glycine metabolism, MR analyses and in vivo feeding studies did not provide evidence that the clinical association of this amino acid with atherosclerosis represents a causal relationship.

BACKGROUND: 2022 survey data showed 29% of Veterans utilized Veterans Affairs (VA) paid health care at a non-VA facility, 6% higher than in 2021. Despite an increase in the number of Veterans accessing care in the community via the MISSION Act Community Care Program (CCP), there is limited information on the quality of mental health care delivered to Veterans in these settings. Further, Veterans report barriers to quality care, including poor communication between CCP and VA providers, which can result in negative patient outcomes. We aimed to evaluate the feasibility and acceptability of using electronic screening, eScreening, as part of a process involving remote symptom screening, symptom monitoring, and clinically driven communication from VA to CCP providers, for Veterans accessing mental health treatment in CCP settings. METHODS: Veterans (n = 150) diagnosed with major depressive disorder, an anxiety disorder, post-traumatic stress disorder, and/or an adjustment disorder referred to mental health care in CCP between August-November 2021 were eligible to participate. Veterans received an eScreening link to complete an initial web-based assessment and three follow-up assessments spaced 4-6 weeks apart over the course of their treatment. Quantitative assessment data was largely characterized using descriptive statistics and included patient-reported outcome (PRO) measures (PTSD and depression), health-related quality of life/functioning, community care information (e.g., number of sessions attended), and satisfaction with the eScreening technology. Qualitative interview data was also collected from participating Veterans and CCP providers to better understand experiences with eScreening. RESULTS: Findings support the feasibility and acceptability of using eScreening to administer and monitor PROs for Veterans accessing mental health treatment in CCP. Of the Veterans who provided eScreening satisfaction ratings (Ns = 45-55), 89% had no technical difficulties; 78% felt comfortable entering personal information; and 83% were neutral or positive about ease of use. Focus group interviews revealed strong support from Veterans, who stated the software was easy to use; they felt comfortable completing PRO measures; and they appreciated having their symptoms monitored. Similarly, providers indicated eScreening had a positive impact on communication, collaboration of care, and transparency. CONCLUSIONS: Technologies like eScreening represent a promising tool to support the mental health care Veterans receive when they access CCP.

INTRODUCTION: Addressing physician burnout is critical for healthcare systems. As electronic health record (EHR) workload and teamwork have been identified as major contributing factors to physician well-being, we aimed to mitigate burnout through EHR-based interventions and a compassion team practice (CTP), targeting EHR workload and team cohesion. METHODS: A modified stepped wedge-clustered randomized trial was conducted, involving specialties with heavy InBasket workloads. EHR interventions included quick-action shortcuts and recommended practice for secure chats. The CTP comprised 30-s practice between physicians and their dyad partners. Survey and EHR data were collected over four assessment periods. Linear and generalized mixed-effects models assessed intervention effects, accounting for covariates. RESULTS: Forty-four physicians participated (20% participation rate). While burnout prevalence decreased from 58.5% at baseline to 50.0% at the end of the study, burnout reduction was not statistically significant after EHR (OR 0.43, 95% CI 0.12 to 1.61, p = 0.21) or EHR + CTP (OR 0.60, 95% CI 0.17 to 2.10, p = 0.42) interventions. Statistically significant greater perceived ease of EHR work resulted from both the EHR intervention (coefficient 0.76, 95% CI 0.22 to 1.29, p = 0.01) and EHR + CTP intervention (coefficient 0.80, 95% CI 0.26 to 1.35, p

Current US clinical practice guidelines for advanced prostate cancer management contain recommendations based on high-level evidence from randomized controlled trials; however, these guidelines do not address the nuanced clinical questions that are unanswered by prospective trials but nonetheless encountered in day-to-day practice. To address these practical questions, the 2024 US Prostate Cancer Conference (USPCC 2024) was created to generate US-focused expert clinical decision-making guidance for circumstances in which level 1 evidence is lacking. At the second annual USPCC meeting (USPCC 2024), a multidisciplinary panel of experts convened to discuss ongoing clinical challenges related to 5 topic areas: biochemical recurrence; metastatic, castration-sensitive prostate cancer; poly [ADP-ribose] polymerase inhibitors; prostate-specific membrane antigen radioligand therapy; and metastatic, castration-resistant prostate cancer. Through a modified Delphi process, 34 consensus recommendations were developed and are intended to provide clinicians who manage prostate cancer with guidance related to the implementation of novel treatments and technologies. In this report, the authors review the areas of consensus identified by the USPCC 2024 experts and evaluate ongoing unmet needs regarding translational application of the current clinical evidence.

BACKGROUND: Californias relatively low smoking rate (10.1% in 2019-2020) (About CHIS, UCLA Center for Health Policy Research, 2024) masks deep disparities among low-income populations, where smoking rates are nearly double that of their middle- to upper-income peers. Low-income smokers report a similar desire to quit and similar rates of recent quit attempts as smokers from other groups; yet, they often face barriers in accessing effective resources to facilitate successful cessation. METHODS: Our team will conduct a pragmatic stepped-wedge cluster, randomized controlled trial of Enhanced Multicomponent Proactive Navigator-Assisted Cessation of Tobacco Use (EMPACT-Us), a suite of tobacco cessation services supported by patient navigators, designed in close partnership with patients, providers, and community stakeholders. The study will take place at Family Health Centers of San Diego (FHCSD), the largest federally qualified health center (FQHC) in San Diego. Eight primary care clinics are included, where 70% (n = 13,496) of smokers at FHCSD receive care. DISCUSSION: We hypothesize that multiple points of engagement and integration of navigation services into the workflow of existing staff will improve utilization and cessation success. This study will examine if the enhanced suite of services offers insights on how to best integrate evidence-based tobacco treatment services into usual care. TRIAL REGISTRATION: ClinicalTrials.gov, NCT05750537, Registered on March 1, 2023. https://clinicaltrials.gov/study/NCT05750537 .

BACKGROUND: The American College of Cardiology, American Heart Association, and Centers for Medicare and Medicaid Services recommend shared decision-making (SDM) for patients with severe aortic stenosis choosing between transcatheter aortic valve replacement (TAVR) and surgical aortic valve replacement (SAVR). Although tools such as patient decision aids (DAs) and training in SDM have been shown to improve SDM, implementation of SDM and DAs is limited. The IMproving treatment decisions for Patients with AortiC stenosis Through Shared Decision Making (IMPACT SDM) study aims to (1) determine the effectiveness of the interventions (a DA and clinician SDM training) in achieving SDM (primary outcome) and improving the quality of decisions about aortic valve replacement, (2) determine the reach of the DAs and adoption of training, and (3) explore potential mechanisms of effectiveness and implementation at the patient-, clinician-, and clinic-level. METHODS: The study is a hybrid type II effectiveness-implementation study using a cluster randomized batched stepped wedge trial with 8 sites across the USA. Eligible patients will be surveyed before and after visits with the heart valve team; clinicians will be surveyed after visits. Reach of DAs and adoption of training will be tracked. Clinicians will be interviewed regarding barriers and facilitators to implementation. DISCUSSION: The IMPACT SDM Study seeks to provide evidence of the ability of the interventions to improve SDM and decision quality, and also to shed light on barriers and facilitators to SDM implementation to promote future implementation efforts. TRIAL REGISTRATION: ClinicalTrials.gov NCT06171737. Registered on December 15, 2023.

OBJECTIVES: Targeted therapies have been shown to improve outcomes in metastatic non-small cell lung cancer (mNSCLC) with driver mutations. We evaluated the real-world prevalence of human epidermal growth factor receptor 2 (HER2; ERBB2) tumor gene mutations among patients with mNSCLC and described historical treatments and outcomes in patients with HER2-mutant mNSCLC, during a period when there was no approved targeted therapy for HER2-mutant mNSCLC. MATERIALS AND METHODS: This retrospective observational study used a US nationwide de-identified NSCLC clinico-genomic database. Eligible patients were adults diagnosed with HER2-mutant mNSCLC from January 2014 to July 2021 without co-occuring epidermal growth factor receptor (EGFR) tumor mutations. Descriptive statistics were used to summarize prevalence, baseline characteristics and treatment patterns. Clinical outcomes were estimated with Kaplan-Meier analyses. RESULTS: Among 9206 patients with mNSCLC, 164 (1.78%) met the eligibility criteria (mean age: 67.3 years, 63.4% White, 56.7% female, and 53.0% with a smoking history). 132/164 (80.5%) had at least one line of treatment. Platinum-based chemotherapy (45.5%) and immune checkpoint inhibitor (ICI) with chemotherapy (28.0%) were the most frequently used first-line treatments. The median (95% confidence interval [CI]) real-world (rw) progression-free survival in first-line was 5.5 (4.8, 6.2) months and 3.0 (2.3, 4.2) months in second-line. The median rw overall survival in first-line was 13.2 (10.6, 18.4) months and 8.2 (6.6, 13.2) months in second-line. CONCLUSION: During this study period, the most common regimens were platinum-based chemotherapy with or without ICI in first and second line, and median rwOS was 13.2 and 8.2 months, respectively. These results indicate the need for more effective targeted therapies in this patient population.

BACKGROUND: Clinical trials are increasingly using Bayesian methods for their design and analysis. Inference in Bayesian trials typically uses simulation-based approaches such as Markov Chain Monte Carlo methods. Markov Chain Monte Carlo has high computational cost and can be complex to implement. The Integrated Nested Laplace Approximations algorithm provides approximate Bayesian inference without the need for computationally complex simulations, making it more efficient than Markov Chain Monte Carlo. The practical properties of Integrated Nested Laplace Approximations compared to Markov Chain Monte Carlo have not been considered for clinical trials. Using data from a published clinical trial, we aim to investigate whether Integrated Nested Laplace Approximations is a feasible and accurate alternative to Markov Chain Monte Carlo and provide practical guidance for trialists interested in Bayesian trial design. METHODS: Data from an international Bayesian multi-platform adaptive trial that compared therapeutic-dose anticoagulation with heparin to usual care in non-critically ill patients hospitalized for COVID-19 were used to fit Bayesian hierarchical generalized mixed models. Integrated Nested Laplace Approximations was compared to two Markov Chain Monte Carlo algorithms, implemented in the software JAGS and stan, using packages available in the statistical software R. Seven outcomes were analysed: organ-support free days (an ordinal outcome), five binary outcomes related to survival and length of hospital stay, and a time-to-event outcome. The posterior distributions for the treatment and sex effects and the variances for the hierarchical effects of age, site and time period were obtained. We summarized these posteriors by calculating the mean, standard deviations and the 95% equitailed credible intervals and presenting the results graphically. The computation time for each algorithm was recorded. RESULTS: The average overlap of the 95% credible interval for the treatment and sex effects estimated using Integrated Nested Laplace Approximations was 96% and 97.6% compared with stan, respectively. The graphical posterior densities for these effects overlapped for all three algorithms. The posterior mean for the variance of the hierarchical effects of age, site and time estimated using Integrated Nested Laplace Approximations are within the 95% credible interval estimated using Markov Chain Monte Carlo but the average overlap of the credible interval is lower, 77%, 85.6% and 91.3%, respectively, for Integrated Nested Laplace Approximations compared to stan. Integrated Nested Laplace Approximations and stan were easily implemented in clear, well-established packages in R, while JAGS required the direct specification of the model. Integrated Nested Laplace Approximations was between 85 and 269 times faster than stan and 26 and 1852 times faster than JAGS. CONCLUSION: Integrated Nested Laplace Approximations could reduce the computational complexity of Bayesian analysis in clinical trials as it is easy to implement in R, substantially faster than Markov Chain Monte Carlo methods implemented in JAGS and stan, and provides near identical approximations to the posterior distributions for the treatment effect. Integrated Nested Laplace Approximations was less accurate when estimating the posterior distribution for the variance of hierarchical effects, particularly for the proportional odds model, and future work should determine if the Integrated Nested Laplace Approximations algorithm can be adjusted to improve this estimation.

BACKGROUND: Time and money are limited resources to pursue quality improvement (QI) goals. Computer simulation using Monte Carlo methods may help focus resources towards the most efficacious interventions to pursue. METHODS: This observational, cross-sectional study analysed the length of stay (LOS) for adult American Society of Anesthesiologists (ASA) 1-3 patients in the postanaesthesia care unit (PACU) at a major academic medical centre. Data were collected retrospectively from 1 April 2023 to 31 March 2024. Statistical analysis with Monte Carlo methods simulated the per cent reduction in PACU LOS following the elimination of postoperative nausea and vomiting (PONV), hypothermia (initial temperature

ABSTRACT: Background: As healthcare moves from a one-size-fits-all approach towards precision care, individual risk prediction is an important step in disease prevention and early detection. Biobank-linked healthcare systems can generate knowledge about genomic risk and test the impact of implementing that knowledge in care. Risk-stratified prostate cancer screening is one clinical application that might benefit from such an approach. Methods: We developed a clinical translation pipeline for genomics-informed prostate cancer screening in a national healthcare system. We used data from 585,418 male participants of the Veterans Affairs (VA) Million Veteran Program (MVP), among whom 101,920 self-identify as Black/African-American, to develop and validate the Prostate CAncer integrated Risk Evaluation (P-CARE) model, a prostate cancer risk prediction model based on a polygenic score, family history, and genetic principal components. The model was externally validated in data from 18,457 PRACTICAL Consortium participants. A novel blended genome-exome (BGE) platform was used to develop a clinical laboratory assay for both the P-CARE model and rare variants in prostate cancer-associated genes, including additional validation in 74,331 samples from the All of Us Research Program. Results: In overall and ancestry-stratified analyses, the polygenic score of 601 variants was associated with any, metastatic, and fatal prostate cancer in MVP and PRACTICAL. Values of the P-CARE model at ≥80th percentile in the multiancestry cohort overall were associated with hazard ratios (HR) of 2.75 (95% CI 2.66-2.84), 2.78 (95% CI 2.54-2.99), and 2.59 (95% CI 2.22-2.97) for any, metastatic, and fatal prostate cancer in MVP, respectively, compared to the median. When high– and low-risk groups were defined as P-CARE HR>1.5 and HR

For patients with advanced non-small-cell lung cancer (NSCLC), dual immune checkpoint blockade (ICB) with CTLA4 inhibitors and PD-1 or PD-L1 inhibitors (hereafter, PD-(L)1 inhibitors) is associated with higher rates of anti-tumour activity and immune-related toxicities, when compared with treatment with PD-(L)1 inhibitors alone. However, there are currently no validated biomarkers to identify which patients will benefit from dual ICB1,2. Here we show that patients with NSCLC who have mutations in the STK11 and/or KEAP1 tumour suppressor genes derived clinical benefit from dual ICB with the PD-L1 inhibitor durvalumab and the CTLA4 inhibitor tremelimumab, but not from durvalumab alone, when added to chemotherapy in the randomized phase III POSEIDON trial3. Unbiased genetic screens identified loss of both of these tumour suppressor genes as independent drivers of resistance to PD-(L)1 inhibition, and showed that loss of Keap1 was the strongest genomic predictor of dual ICB efficacy-a finding that was confirmed in several mouse models of Kras-driven NSCLC. In both mouse models and patients, KEAP1 and STK11 alterations were associated with an adverse tumour microenvironment, which was characterized by a preponderance of suppressive myeloid cells and the depletion of CD8+ cytotoxic T cells, but relative sparing of CD4+ effector subsets. Dual ICB potently engaged CD4+ effector cells and reprogrammed the tumour myeloid cell compartment towards inducible nitric oxide synthase (iNOS)-expressing tumoricidal phenotypes that-together with CD4+ and CD8+ T cells-contributed to anti-tumour efficacy. These data support the use of chemo-immunotherapy with dual ICB to mitigate resistance to PD-(L)1 inhibition in patients with NSCLC who have STK11 and/or KEAP1 alterations.

Starting in the 1970s, individuals, businesses and the public have increasingly benefited from policies prohibiting smoking indoors, saving thousands of lives and billions of dollars in healthcare expenditures. Smokefree policies to protect against secondhand smoke exposure, however, do not fully protect the public from the persistent and toxic chemical residues from tobacco smoke (also known as thirdhand smoke) that linger in indoor environments for years after smoking stops. Nor do these policies address the economic costs that individuals, businesses and the public bear in their attempts to remediate this toxic residue. We discuss policy-relevant differences between secondhand smoke and thirdhand smoke exposure: persistent pollutant reservoirs, pollutant transport, routes of exposure, the time gap between initial cause and effect, and remediation and disposal. We examine four policy considerations to better protect the public from involuntary exposure to tobacco smoke pollutants from all sources. We call for (a) redefining smokefree as free of tobacco smoke pollutants from secondhand and thirdhand smoke; (b) eliminating exemptions to comprehensive smoking bans; (c) identifying indoor environments with significant thirdhand smoke reservoirs; and (d) remediating thirdhand smoke. We use the case of California as an example of how secondhand smoke-protective laws may be strengthened to encompass thirdhand smoke protections. The health risks and economic costs of thirdhand smoke require that smokefree policies, environmental protections, real estate and rental disclosure policies, tenant protections, and consumer protection laws be strengthened to ensure that the public is fully protected from and informed about the risks of thirdhand smoke exposure.

On the basis of a streamlined route to the pyrroloiminoquinone (PIQ) core, we made 16 natural products spread across four classes of biosynthetically related alkaloid natural products, and multiple structural analogs, all in ≤8 steps longest linear sequence (LLS). The strategy features a Larock indole synthesis as the key operation in a five-step synthesis of a key methoxy-PIQ intermediate. Critically, this compound was readily diverged via selective methylation of either (or both) of the imine-like or pyrrole nitrogens, which then permitted further divergence by either O-demethylation to o-quinone natural products or displacement of the methoxy group with a range of amine nucleophiles. Based on a single, early report of their potential utility against the malaria parasite, we assayed these compounds against several strains of Plasmodium falciparum, as well as two species of the related protozoan parasite Babesia. In combination with evaluations of their human cytotoxicity, we identified several compounds with potent (low-nM IC50) antimalarial and antibabesial activities that are much less toxic toward mammalian cells and are therefore promising lead compounds for antiprotozoal drug discovery.

BackgroundCOVID-19 is associated with acute risk of major adverse cardiac events (MACE), including myocardial infarction, stroke, and mortality (all-cause). However, the duration and underlying determinants of heightened risk of cardiovascular disease and MACE post-COVID-19 are not known.MethodsData from the UK Biobank was used to identify COVID-19 cases (n=10 005) who were positive for polymerase chain reaction (PCR+)-based tests for SARS-CoV-2 infection (n=8062) or received hospital-based International Classification of Diseases version-10 (ICD-10) codes for COVID-19 (n=1943) between February 1, 2020 and December 31, 2020. Population controls (n=217 730) and propensity score-matched controls (n=38 860) were also drawn from the UK Biobank during the same period. Proportional hazard models were used to evaluate COVID-19 for association with long-term (>1000 days) risk of MACE and as a coronary artery disease risk equivalent. Additional analyses examined whether COVID-19 interacted with genetic determinants to affect the risk of MACE and its components.ResultsThe risk of MACE was elevated in COVID-19 cases at all levels of severity (HR, 2.09 [95% CI, 1.94-2.25]; P

UNLABELLED: Bacillus subtilis is an important industrial and environmental microorganism known to occupy many niches and produce many compounds of interest. Although it is one of the best-studied organisms, much of this focus including the reconstruction of genome-scale metabolic models has been placed on a few key laboratory strains. Here, we substantially expand these prior models to pan-genome-scale, representing 481 genomes of B. subtilis with 2,315 orthologous gene clusters, 1,874 metabolites, and 2,239 reactions. Furthermore, we incorporate data from carbon utilization experiments for eight strains to refine and validate its metabolic predictions. This comprehensive pan-genome model enables the assessment of strain-to-strain differences related to nutrient utilization, fermentation outputs, robustness, and other metabolic aspects. Using the model and phenotypic predictions, we divide B. subtilis strains into five groups with distinct patterns of behavior that correlate across these features. The pan-genome model offers deep insights into B. subtilis metabolism as it varies across environments and provides an understanding as to how different strains have adapted to dynamic habitats. IMPORTANCE: As the volume of genomic data and computational power have increased, so has the number of genome-scale metabolic models. These models encapsulate the totality of metabolic functions for a given organism. Bacillus subtilis strain 168 is one of the first bacteria for which a metabolic network was reconstructed. Since then, several updated reconstructions have been generated for this model microorganism. Here, we expand the metabolic model for a single strain into a pan-genome-scale model, which consists of individual models for 481 B. subtilis strains. By evaluating differences between these strains, we identified five distinct groups of strains, allowing for the rapid classification of any particular strain. Furthermore, this classification into five groups aids the rapid identification of suitable strains for any application.

OBJECTIVE: Tildrakizumab, an anti-interleukin-23 p19 monoclonal antibody, is approved for the treatment of adults with moderate-to-severe plaque psoriasis. Limited evidence is available regarding the effects of tildrakizumab on patient-reported symptoms and satisfaction. This report describes the secondary endpoints of patient-reported symptoms and treatment satisfaction over 64 weeks in patients with moderate-to-severe plaque psoriasis treated with tildrakizumab in a Phase IV, real-world study. METHODS: In this uncontrolled, open-label study (NCT03718299), patients received tildrakizumab 100 mg at baseline, Week (W)4, and every 12 weeks thereafter to W52, with the final assessment at W64. Patient-reported secondary endpoints included numerical rating scale (NRS) scores for itch, pain, and scaling, and treatment satisfaction measured by 3 rating scales (Treatment Satisfaction Questionnaire for Medication [TSQM], Tildrakizumab Overall Satisfaction, and Patient Happiness with Psoriasis Control instrument) through W64. RESULTS: Of the 55 patients enrolled, 45 were assessed at W64. Mean NRS scores for itch, pain, and scaling all decreased from baseline beginning as early as W4 with maintenance through W64 (P≤0.001). Treatment satisfaction was positive throughout treatment based on all 3 measures. Mean±SD TSQM domain scores increased from 59.5±17.0 at W4 to 79.5±20.1 at W64 for Effectiveness and from 72.7±18.6 to 81.9±20.5 for Global Satisfaction. LIMITATIONS: The study is small and lacks a comparator arm. CONCLUSION: Tildrakizumab treatment improved patient-reported symptoms in patients with moderate-to-severe plaque psoriasis in a real-world setting and was associated with high levels of treatment satisfaction over 64 weeks.

The UV-induced photo-relaxation dynamics of 5-bromouracil (BrU) and 5-bromo-2-deoxyuridine (BrUrd) in aqueous solution were investigated using femtosecond time-resolved photoelectron spectroscopy with an extreme ultraviolet (XUV) probe in a flat liquid jet. Upon excitation to the 1ππ* state by 4.66 eV UV photons, both molecules exhibited rapid relaxation into lower-lying electronic states followed by decay to the S0 ground state. By employing a 21.7 eV XUV probe pulse, we were able to differentiate the relaxation of the excited state population from the initially excited 1ππ* state to an intermediate electronic state with 100 fs. Computational results identify this intermediate as the 1πσ* excited state, accessed by a 1ππ*/1πσ* conical intersection, and the signal from this intermediate state disappears within ∼200 fs. In contrast to thymine, formation of neither the 1nπ* state nor a long-lived triplet state was observed. Although the 1πσ* state is largely repulsive, prior studies have reported a low quantum yield for dissociation, and we observe weak signals that are consistent with production of hot S0 ground state (for BrUrd) on a time scale of 1.5-2 ps. It thus appears that solvent caging effects limit the dissociation yield in solution.

INTRODUCTION: Popular pod-style e-cigarettes commonly use nicotine salt-based e-liquids that cause less irritation when inhaled and can deliver higher nicotine concentrations than free-base nicotine. This study investigated the pharmacokinetic and pharmacodynamic effects of different nicotine formulations (salt vs. free-base) and concentrations that might influence systemic nicotine absorption and appeal of e-cigarettes. AIMS AND METHODS: In this randomized, double-blind, within-subject crossover study, 20 non-nicotine-naïve participants were switched among three e-liquids (free-base nicotine 20 mg/mL, nicotine salt 20 mg/mL, nicotine salt 40 mg/mL) using a refillable pod system and a standardized vaping protocol (one puff every 30 seconds, 10 puffs total). Serum nicotine concentrations and vital signs were assessed over 180 minutes; direct effects, craving, satisfaction, withdrawal, and respiratory symptoms were measured using questionnaires. CYP2A6 genotypes and the nicotine metabolite ratio were also assessed. RESULTS: Eleven (55%) participants were male and the median age was 23.5 years (range 18-67). All three formulations differed significantly in peak serum nicotine concentration (baseline adjusted Cmax, median (range): 12.0 ng/mL (1.6-27.3), 5.4 ng/mL (1.9-18.7), and 3.0 ng/mL (1.3-8.8) for nicotine salt 40 mg/mL, nicotine salt 20 mg/mL and free-base 20 mg/mL, respectively). All groups reached Cmax 2.0-2.5 minutes (median) after their last puff. Differences in subjective effects were not statistically significant. No serious adverse events were observed. CONCLUSIONS: Free-base 20 mg/mL formulations achieved lower blood nicotine concentrations than nicotine salt 20 mg/mL, while 40 mg/mL nicotine salt yielded concentrations similar to cigarette smoking. The findings can inform regulatory policy regarding e-liquids and their potential use in smoking cessation. IMPLICATIONS: Nicotine salt formulations inhaled by an e-cigarette led to higher nicotine delivery compared to nicotine-free-base formulations with the same nicotine concentration. These findings should be considered in future regulatory discussions. The 40 mg/mL nicotine salt formulation showed similar nicotine delivery as combustible cigarettes, albeit at concentrations over the maximum limit for e-liquids allowed in the European Union. Nicotine delivery resembling combustible cigarettes might be beneficial for smokers willing to quit to adequately alleviate withdrawal symptoms. However, increased nicotine delivery can also pose a public health risk, raising concerns about abuse liability, especially among youth and nonsmokers.

PURPOSE: Seizure-related homolog protein 6 (SEZ6) is a novel target expressed in small cell lung cancer (SCLC). ABBV-011, a SEZ6-targeted antibody conjugated to calicheamicin, was evaluated in a phase I study (NCT03639194) in patients with relapsed/refractory SCLC. We report initial outcomes of ABBV-011 monotherapy. PATIENTS AND METHODS: ABBV-011 was administered intravenously once every 3 weeks (Q3W) during dose escalation (0.3-2 mg/kg) and expansion. Patients with SEZ6-positive tumors (≥25% of tumor cells with ≥1+ staining intensity by immunohistochemistry) were preselected for expansion. Safety, tolerability, antitumor activity, and pharmacokinetics were evaluated. RESULTS: As of August 2022, 99 patients received ABBV-011 monotherapy (dose escalation, n=36; Japanese dose evaluation, n=3; dose expansion, n=60 [1 mg/kg, n=40]); median age was 63 years (range, 41-79). Thirty-two percent, 41%, and 26% of patients received 1, 2, and ≥3 prior therapies, respectively. The maximum tolerated dose was not reached through 2.0 mg/kg. Most common treatment-emergent adverse events (TEAEs) were fatigue (50%), nausea (42%), and thrombocytopenia (41%). Most common hepatic TEAEs were increased aspartate aminotransferase (22%), increased g-glutamyltransferase (21%), and hyperbilirubinemia (17%); 2 patients experienced veno-occlusive liver disease. Objective response rate (ORR) was 19% (19/98). In the 1-mg/kg dose-expansion cohort (n=40), ORR was 25%; median response duration was 4.2 months (95% CI, 2.6-6.7) and median progression-free survival was 3.5 months (95% CI, 1.5-4.2). CONCLUSIONS: ABBV-011 1.0 mg/kg Q3W monotherapy was well tolerated and demonstrated encouraging antitumor activity in heavily pretreated patients with relapsed/refractory SCLC. SEZ6 is a promising novel SCLC target and warrants further investigation.

Mollusca is a morphologically diverse phylum, exhibiting an immense variety of calcium carbonate structures. Proteomic studies of adult shells often report high levels of rapidly-evolving, novel shell matrix proteins (SMPs), which are hypothesized to drive shell diversification. However, relatively little is known about the phylogenetic distribution of SMPs, or about the function of individual SMPs in shell construction. To understand how SMPs contribute to shell diversification a thorough characterization of SMPs is required. Here, we build tools and a foundational understanding of SMPs in the marine gastropod species Crepidula fornicata and Crepidula atrasolea because they are genetically-enabled mollusc model organisms. First, we established a staging system of shell development in C. atrasolea for the first time. Next, we leveraged previous findings in C. fornicata combined with phylogenomic analyses of 95 metazoan species to determine the evolutionary lineage of its adult SMP repertoire. We found that 55% of C. fornicatas SMPs belong to molluscan orthogroups, with 27% restricted to Gastropoda, and only 5% restricted at the species level. The low percentage of species-restricted SMPs underscores the importance of broad-taxon sampling and orthology inference approaches when determining homology of SMPs. From our transcriptome analysis, we found that the majority of C. fornicata SMPs that were found conserved in C. atrasolea were expressed in both larval and adult stages. We then selected a subset of SMPs of varying evolutionary ages for spatial-temporal analysis using in situ hybridization chain reaction (HCR) during larval shell development in C. atrasolea. Out of the 18 SMPs analyzed, 12 were detected in the larval shell field. These results suggest overlapping larval vs. adult SMP repertoires. Using multiplexed HCR, we observed five SMP expression patterns and three distinct cell populations within the shell field. These patterns support the idea that modular expression of SMPs could facilitate divergence of shell morphological characteristics. Collectively, these data establish an evolutionary and developmental framework in Crepidula that enables future comparisons of molluscan biomineralization to reveal mechanisms of shell diversification.

BACKGROUND AND AIMS: Long-term safety and efficacy of mavacamten in patients with obstructive hypertrophic cardiomyopathy (HCM) are unknown. MAVA-LTE (NCT03723655) is an ongoing, 5-year, open-label extension study designed to evaluate the long-term effects of mavacamten. METHODS: Participants from EXPLORER-HCM (NCT03470545) could enrol in MAVA-LTE upon study completion. RESULTS: At the latest data cut-off, 211 (91.3%) of 231 patients originally enrolled in MAVA-LTE still received mavacamten. Median (range) time on study was 166.1 (6.0-228.1) weeks; 185 (80.1%) and 99 (42.9%) patients had completed the week 156 and 180 visits, respectively. Sustained reductions from baseline to week 180 occurred in left ventricular outflow tract gradients (mean [standard deviation]: resting, -40.3 [32.7] mmHg; Valsalva, -55.3 [33.7] mmHg), NT-proBNP (median [interquartile range]: -562 [-1162.5, -209] ng/L), and EQ-5D-5L score (mean [standard deviation]: 0.09 [0.17]). Mean left ventricular ejection fraction (LVEF) decreased from 73.9% (baseline) to 66.6% (week 24) and 63.9% (week 180). At week 180, 74 (77.9%) of 95 patients improved by at least one New York Heart Association class from baseline. Over 739 patient-years exposure, 20 patients (8.7%; exposure-adjusted incidence: 2.77/100 patient-years) experienced 22 transient reductions in LVEF to

IntroductionE-cigarette and cannabis use by adolescents are risk factors for smoking initiation. We hypothesised that increasingly common dual use of e-cigarette and cannabis in adolescence leads to more frequent cigarette smoking in young adulthood.MethodsData are from a prospective cohort study in Southern California, where 1164 participants who ever used nicotine products in their lifetime completed surveys in 12th grade (T1:2016), and at 24-month (T2) and 42-month (T3) follow-ups. Past 30-day use (number of days: range=0-30) of cigarettes, e-cigarettes and cannabis, and nicotine dependence, were assessed in each survey. Nicotine dependence for cigarettes and e-cigarettes was assessed using original and modified (for e-cigarette) Hooked on Nicotine Checklists (number of dependent products: range=0-2). Path analysis examined the mediation process via nicotine dependence linking baseline e-cigarette and cannabis use to subsequent increased cigarette use.ResultsBaseline exclusive use of e-cigarettes (baseline prevalence, 2.5%) was associated with 2.61-fold increase in frequency of smoking days at T3 (95% CI 1.04 to 13.1), exclusive cannabis use (26.0%) with 2.58-fold increase (95% CI 1.43 to 4.98), and dual use (7.4%) with 5.84-fold increase (95% CI 3.16 to 12.81), compared with baseline non-users. Nicotine dependence at T2 mediated 10.5% (95% CI 6.3 to 14.7) and 23.2% (95% CI 9.6 to 36.3) of the association of cannabis and dual use, respectively, with increased smoking at T3.DiscussionAdolescent e-cigarette and cannabis use was associated with more frequent smoking during young adulthood, with larger effects of dual use. Associations were partially mediated through nicotine dependence. Dual use of cannabis and e-cigarettes may contribute to the development of nicotine dependence and increased use of combustible cigarettes.

Screening trials for cardiovascular disease have not demonstrated a reduction in all-cause mortality. The Danish Cardiovascular Screening trial (DANCAVAS) involved men aged 65-74 years old who were randomized to an invitation to undergo screening or not. While the 5-year interim analysis did not show a statistically significant benefit in the primary outcome of all-cause mortality, HR 0.95 (CI 0.90-1.00), a sub-group analysis of men age 65-69 did show a lower hazard ratio of 0.89 (CI 0.83-0.96). Given the widening difference between screened and un-screened participants, as well as the benefit in younger subjects, it is likely that the next analysis will demonstrate a statistically-significant benefit of screening. In this commentary we argue why this trial will almost certainly become one of the most influential screening trials and why heeding its most important lesson, the use of coronary artery calcium scoring, has the potential to save countless lives.

PURPOSE: The current standard method for pectus excavatum (PE) repair is the Nuss procedure. One major postoperative complication is the displacement of the implanted metal bar, which is used to remodel the chest wall. Blocking the possible ways that the bar can be displaced with the use of stabilizers and peri/intracostal sutures has reduced the incidence of bar displacement. Despite the modifications, bar dislocation is often reported. We adopted the medial position stabilizer placement method and imposed no postoperative restrictions. In this study, we analyzed the bar dislocation rate with this modification and concurrent postoperative full activity. METHODS: Nuss procedure modification where stabilizers are placed bilaterally in the medial location was done on patients irrespective of age and Haller index greater than 3.25. A single bar was used for all patients. Cryoanalgesia was performed on every patient. No postoperative restrictions were imposed on the patients. Full immediate activities, including sports, were allowed. RESULTS: 114 patients (103 male, 11 female) were analyzed from 2016 to 2023. The median age was 15 years old. There was zero incidence of bar displacement. The combined incidence of other postoperative complications was 4%: 2 wound infections and 2 hematoma formations, both needing incision and drainage. CONCLUSION: Bilateral medial stabilizer placement resulted in no incidence of bar dislocation. Return to immediate full activities after the Nuss procedure did not appear to increase the incidence of bar displacement if stabilizers were placed medially.

BackgroundThe legal climate for cannabis use has dramatically changed with an increasing number of states passing legislation legalizing access for medical and recreational use. Among cancer patients, cannabis is often used to ameliorate adverse effects of cancer treatment. Data are limited on the extent and type of use among cancer patients during treatment and the perceived benefits and harms. This multicenter survey was conducted to assess the use of cannabis among cancer patients residing in states with varied legal access to cannabis.MethodsA total of 12 NCI-Designated Cancer Centers, across states with varied cannabis-access legal status, conducted surveys with a core questionnaire to assess cannabis use among recently diagnosed cancer patients. Data were collected between September 2021 and August 2023 and pooled across 12 cancer centers. Frequencies and 95% confidence intervals for core survey measures were calculated, and weighted estimates are presented for the 10 sites that drew probability samples.ResultsOverall reported cannabis use since cancer diagnosis among survey respondents was 32.9% (weighted), which varied slightly by state legalization status. The most common perceived benefits of use were for pain, sleep, stress and anxiety, and treatment side effects. Reported perceived risks were less common and included inability to drive, difficulty concentrating, lung damage, addiction, and impact on employment. A majority reported feeling comfortable speaking to health-care providers though, overall, only 21.5% reported having done so. Among those who used cannabis since diagnosis, the most common modes were eating in food, smoking, and pills or tinctures, and the most common reasons were for sleep disturbance, followed by pain and stress and anxiety with 60%-68% reporting improved symptoms with use.ConclusionThis geographically diverse survey demonstrates that patients use cannabis regardless of its legal status. Addressing knowledge gaps concerning benefits and harms of cannabis use during cancer treatment is critical to enhance patient-provider communication.

IMPORTANCE: There are consistent data demonstrating that socioeconomic disadvantage is associated with risk of premature mortality, but research on the relationship between neighborhood socioeconomic factors and premature mortality is limited. Most studies evaluating the association between neighborhood socioeconomic status (SES) and mortality have used a single assessment of SES during middle to older adulthood, thereby not considering the contribution of early life neighborhood SES. OBJECTIVE: To investigate the association of life course neighborhood SES and premature mortality. DESIGN, SETTING, AND PARTICIPANTS: This cohort study included Black and White participants of the multicenter Atherosclerosis Risk in Communities Study, a multicenter study conducted in 4 US communities: Washington County, Maryland; Forsyth County, North Carolina; Jackson, Mississippi; and the northwestern suburbs of Minneapolis, Minnesota. Participants were followed up for a mean (SD) of 18.8 (5.7) years (1996-2020). Statistical analysis was performed from March 2023 through May 2024. EXPOSURE: Participants residential addresses during childhood, young adulthood, and middle adulthood were linked with US Census-based socioeconomic indicators to create summary neighborhood SES scores for each of these life epochs. Neighborhood SES scores were categorized into distribution-based tertiles. MAIN OUTCOMES AND MEASURES: Premature death was defined as all-cause mortality occurring before age 75 years. Multivariable-adjusted Cox proportional hazards models were used to estimate hazard ratios (HRs) and 95% CIs. RESULTS: Among 12 610 study participants, the mean (SD) age at baseline was 62.6 (5.6) years; 3181 (25.2%) were Black and 9429 (74.8%) were White; and 7222 (57.3%) were women. The lowest, compared with the highest tertile, of neighborhood SES score in middle adulthood was associated with higher risk of premature mortality (HR, 1.28; 95% CI, 1.07-1.54). Similar associations were observed for neighborhood SES in young adulthood among women (HR, 1.25; 95% CI, 1.00-1.56) and neighborhood SES in childhood among White participants (HR, 1.25; 95% CI, 1.01-1.56). Participants whose neighborhood SES remained low from young to middle adulthood had an increased premature mortality risk compared with those whose neighborhood SES remained high (HR, 1.25; 95% CI, 1.05-1.49). CONCLUSIONS AND RELEVANCE: In this study, low neighborhood SES was associated with premature mortality. The risk of premature mortality was greatest among individuals experiencing persistently low neighborhood SES from young to middle adulthood. Place-based interventions that target neighborhood social determinants of health should be designed from a life course perspective that accounts for early-life socioeconomic inequality.

OBJECTIVE: To determine the feasibility, efficacy, and safety of early cold stored platelet transfusion compared with standard care resuscitation in patients with hemorrhagic shock. BACKGROUND: Data demonstrating the safety and efficacy of early cold stored platelet transfusion are lacking following severe injury. METHODS: A phase 2, multicenter, randomized, open label, clinical trial was performed at 5 US trauma centers. Injured patients at risk of large volume blood transfusion and the need for hemorrhage control procedures were enrolled and randomized. The intervention was the early transfusion of a single apheresis cold stored platelet unit, stored for up to 14 days versus standard care resuscitation. The primary outcome was feasibility and the principal clinical outcome for efficacy and safety was 24-hour mortality. RESULTS: Mortality at 24 hours was 5.9% in patients who were randomized to early cold stored platelet transfusion compared with 10.2% in the standard care arm (difference, -4.3%; 95% CI, -12.8% to 3.5%; P =0.26). No significant differences were found for any of the prespecified ancillary outcomes. Rates of arterial and/or venous thromboembolism and adverse events did not differ across treatment groups. CONCLUSIONS AND RELEVANCE: In severely injured patients, early cold stored platelet transfusion is feasible, safe and did not result in a significant lower rate of 24-hour mortality. Early cold stored platelet transfusion did not result in a higher incidence of arterial and/or venous thrombotic complications or adverse events. The storage age of the cold stored platelet product was not associated with significant outcome differences. TRIAL REGISTRATION: ClinicalTrials.gov identifier: NCT04667468.

BACKGROUND: To enhance the utility of functional hemodynamic monitoring, the variables systolic slope (dP/dt) and dynamic arterial elastance (Eadyn) are calculated by the Hypotension Prediction Index (HPI) Acumen® Software. This study was designed to characterize the effects of phenylephrine and ephedrine on dP/dt and Eadyn. METHODS: This was a retrospective, non-randomized analysis of data collected during two clinical studies. All patients required intra-operative controlled mechanical ventilation and had an indwelling radial artery catheter connected to an Acumen IQ sensor. Raw arterial pressure waveform data was downloaded from the patient monitor and all hemodynamic measurements were calculated off-line. The anesthetic record was reviewed for bolus administrations of either phenylephrine or ephedrine. Cardiovascular variables prior to drug administration were compared to those following vasopressor administrations. The primary outcome was the difference for dP/dt and Eadyn at baseline compared with the average after the bolus administration. All data sets demonstrated non-normal distributions so statistical analysis of paired and unpaired data followed the Wilcoxon matched pairs signed-rank test or Mann-Whitney U test, respectively. RESULTS: 201 doses of phenylephrine and 100 doses of ephedrine were analyzed. All data sets are reported as median [95% CI]. Mean arterial pressure (MAP) increased from 62 [54,68] to 78 [76,80] mmHg following phenylephrine and from 59 [55,62] to 80 [77,83] mmHg following ephedrine. Stroke volume and cardiac output both increased. Stroke volume variation and pulse pressure variation decreased. Both drugs produced significant increases in dP/dt, from 571 [531, 645] to 767 [733, 811] mmHg/sec for phenylephrine and from 537 [509, 596] to 848 [779, 930] mmHg/sec for ephedrine. No significant changes in Eadyn were observed. CONCLUSION: Bolus administration of phenylephrine or ephedrine increases dP/dt but does not change Eadyn. dP/dt demonstrates potential for predicting the inotropic response to phenylephrine or ephedrine, providing guidance for the most efficacious vasopressor when treating hypotension. TRIAL REGISTRATION: Data was collected from two protocols. The first was deemed to not require written, informed consent by the Institutional Review Board (IRB). The second was IRB-approved (Effect of Diastolic Dysfunction on Dynamic Cardiac Monitors) and registered on ClinicalTrials.gov (NCT04177225).

Diatoms are major players in the global carbon cycle, and their metabolism is affected by ocean conditions. Understanding the impact of changing inorganic nutrients in the oceans on diatoms is crucial, given the changes in global carbon dioxide levels. Here, we present a genome-scale metabolic model (iMK1961) for Cylindrotheca closterium, an in silico resource to understand uncharacterized metabolic functions in this ubiquitous diatom. iMK1961 represents the largest diatom metabolic model to date, comprising 1961 open reading frames and 6718 reactions. With iMK1961, we identified the metabolic response signature to cope with drastic changes in growth conditions. Comparing model predictions with Tara Oceans transcriptomics data unraveled C. closteriums metabolism in situ. Unexpectedly, the diatom only grows photoautotrophically in 21% of the sunlit ocean samples, while the majority of the samples indicate a mixotrophic (71%) or, in some cases, even a heterotrophic (8%) lifestyle in the light. Our findings highlight C. closteriums metabolic flexibility and its potential role in global carbon cycling.

Deciphering the genetic basis of prostate-specific antigen (PSA) levels may improve their utility for prostate cancer (PCa) screening. Using genome-wide association study (GWAS) summary statistics from 95,768 PCa-free men, we conducted a transcriptome-wide association study (TWAS) to examine impacts of genetically predicted gene expression on PSA. Analyses identified 41 statistically significant (p 0.5: CCNA2 and HIST1H2BN. Six of the 20 identified genes are not known to impact PCa risk. Fine-mapping based on whole blood and prostate tissue revealed five protein-coding genes with evidence of causal relationships with PSA levels. Of these five genes, four exhibited evidence of colocalization and one was conditionally independent of previous GWAS findings. These results yield hypotheses that should be further explored to improve understanding of genetic factors underlying PSA levels.

SUMMARY: perox-per-cell automates cumbersome, image-based data collection tasks often encountered in peroxisome research. The software processes microscopy images to quantify peroxisome features in yeast cells. It uses off-the-shelf image processing tools to automatically segment cells and peroxisomes and then outputs quantitative metrics including peroxisome counts per cell and spatial areas. In validation tests, we found that perox-per-cell output agrees well with manually quantified peroxisomal counts and cell instances, thereby enabling high-throughput quantification of peroxisomal characteristics. AVAILABILITY AND IMPLEMENTATION: The software is coded in Python. Compiled executables and source code are available at https://github.com/AitchisonLab/perox-per-cell. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

BACKGROUND: Reducing cigarette addictiveness has the potential to avert millions of yearly tobacco-related deaths worldwide. Substantially reducing nicotine in cigarettes decreases cigarette consumption, but no large clinical trial has determined the effects of reduced-nicotine cigarettes when other nicotine-containing products are available. The aim of this study was to examine the effects of reduced-nicotine cigarettes in the context of the availability of alternative nicotine delivery systems. METHODS: In a U.S. six-site, open-label, parallel-arm study, smokers were randomized for twelve weeks to an experimental marketplace containing cigarettes with either 0.4 mg or 15.8 mg nicotine per gram of tobacco; all had access to non-combusted alternative nicotine delivery systems (e.g., e-cigarettes; medicinal nicotine). Group differences in the primary outcomes (cigarettes per day, number of smoke-free days) were examined using linear and negative binomial regression, respectively (Trial Registration: NCT03272685). FINDINGS: Among 438 randomized participants (mean [standard deviation (SD), range] age, 44.5 [11.9, 20-73] years, 225 [51.4%] women, 282 [64.4%] White and 339 [77.4%] trial completers), those in the 0.4 mg vs. 15.8 mg nicotine cigarette condition experienced significantly lower cigarettes per day at the end of intervention (mean [SD], 7.05 [7.88] vs. 12.95 [9.07], adjusted mean difference, -6.21 [95% CI, -7.66 to -4.75], P

The use of e-cigarettes (vaping) by young adults has increased substantially in the past decade. Although health risks of long-term e-cigarette use remain unknown, there is evidence of acute physiological harms. Most young adults who vape report intent to quit, but little is known about effective interventions. This protocol paper reports on the development and design of a pilot trial of a vaping intervention for young military Veterans. Young adult Veterans accessing VA healthcare (n = 20) who vape daily and have been referred for cessation services will be enrolled. To maximize accessibility the intervention will be delivered virtually; participants will be randomized to receive behavioral counseling by telephone or by video telehealth. The intervention was adapted from an existing program targeting young adult cigarette smokers and will include 6 individual counseling sessions delivered over 8 weeks. Assessment visits will occur at baseline, at end-of-treatment, and 4 weeks later. Analyses will evaluate feasibility and acceptability of the intervention overall, and will compare telephone and video telehealth modalities. Longitudinal regression will be used to evaluate changes in vaping behavior and in nicotine dependence over time. This study will provide assessment of a novel intervention adapted for Veterans who vape nicotine. The comparison of two modalities of virtual intervention delivery will increase knowledge and the potential to disseminate across VA and other healthcare systems. Findings from this pilot trial will inform the design of future, larger studies of vaping cessation interventions for younger Veterans.

BACKGROUND: Nearly one-third of patients with prostate cancer (PCa) experience biochemical recurrence (BCR) after primary definitive treatment. BCR increases the risk of distant metastasis and mortality in patients with prognostically unfavorable features. These patients are best managed with a tailored treatment strategy incorporating risk stratification using clinicopathological factors, next-generation imaging, and genomic testing. OBJECTIVE: This narrative review examines the utility of risk stratification for the management of patients with BCR in the context of clinical trial data, referencing the latest recommendations by European and US medical societies. METHODS: PubMed was searched for relevant studies published through May 21 2023 on treatment of patients with BCR after radical prostatectomy (RP) or external beam radiotherapy (EBRT). RESULTS: European and US guidelines support the risk-stratified management of BCR. Post-RP, salvage EBRT (with or without androgen deprivation therapy [ADT]) is an accepted treatment option for patients with BCR. Post-EBRT, local salvage therapies (RP, cryotherapy, high-intensity focused ultrasound, stereotactic body radiotherapy, and low-dose-rate and high-dose-rate brachytherapy) have demonstrated comparable relapse-free survival rates but differing adverse event profiles, short and long term. Local salvage therapies should be used for local-only relapses while ADT should be considered for regional or distant relapses. In practice, patients often receive ADT, with varying guidance for intermittent ADT vs. continuous ADT, due to consideration of quality-of-life effects. CONCLUSIONS: Despite a lack of consensus for BCR treatment among guideline associations and medical societies, risk stratification of patients is essential for personalized treatment approaches, as it allows for an informed selection of therapeutic strategies and estimation of adverse events. In lower-risk disease, observation is recommended while in higher-risk disease, after failed repeat local therapy, ADT and/or clinical trial enrollment may be appropriate. Results from ongoing clinical studies of patients with BCR should provide consensus for management.

BACKGROUND: Biochemical recurrence (BCR) following primary interventional treatment occurs in approximately one-third of patients with prostate cancer (PCa). Next-generation imaging (NGI) can identify local and metastatic recurrence with greater sensitivity than conventional imaging, potentially allowing for more effective interventions. This narrative review examines the current clinical evidence on the utility of NGI for patients with BCR. METHODS: A search of PubMed was conducted to identify relevant publications on NGI applied to BCR. Given other relevant recent reviews on the topic, this review focused on papers published between January 2018 to May 2023. RESULTS: NGI technologies, including positron emission tomography (PET) radiotracers and multiparametric magnetic resonance imaging, have demonstrated increased sensitivity and selectivity for diagnosing BCR at prostate-specific antigen (PSA) concentrations

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

IntroductionE-cigarettes and heated tobacco products (HTPs) may serve as potential options for harm reduction for smokers if they possess reward profiles similar to cigarettes. Little is known about the abuse liability of HTPs and e-cigarettes versus cigarettes in racial/ethnic minority smokers.Aims and methodsTwenty-two nicotine-deprived people who smoke (black [n = 12] and white [n = 10]) completed three visits that included a standardized 10-puff bout followed by a 50-minute ad libitum use assessment with their usual brand cigarette (UBC), an e-cigarette, and HTP. Visits were completed in a randomized crossover design and were separated by a minimum 48-hour washout period. Assessments included plasma nicotine, Cmax, and reductions in craving and withdrawal.ResultsUBC delivered significantly greater levels of nicotine compared to the e-cigarette (p

Immune checkpoint inhibitor (ICI) therapy has revolutionized oncology, but treatments are limited by immune-related adverse events, including checkpoint inhibitor colitis (irColitis). Little is understood about the pathogenic mechanisms driving irColitis, which does not readily occur in model organisms, such as mice. To define molecular drivers of irColitis, we used single-cell multi-omics to profile approximately 300,000 cells from the colon mucosa and blood of 13 patients with cancer who developed irColitis (nine on anti-PD-1 or anti-CTLA-4 monotherapy and four on dual ICI therapy; most patients had skin or lung cancer), eight controls on ICI therapy and eight healthy controls. Patients with irColitis showed expanded mucosal Tregs, ITGAEHi CD8 tissue-resident memory T cells expressing CXCL13 and Th17 gene programs and recirculating ITGB2Hi CD8 T cells. Cytotoxic GNLYHi CD4 T cells, recirculating ITGB2Hi CD8 T cells and endothelial cells expressing hypoxia gene programs were further expanded in colitis associated with anti-PD-1/CTLA-4 therapy compared to anti-PD-1 therapy. Luminal epithelial cells in patients with irColitis expressed PCSK9, PD-L1 and interferon-induced signatures associated with apoptosis, increased cell turnover and malabsorption. Together, these data suggest roles for circulating T cells and epithelial-immune crosstalk critical to PD-1/CTLA-4-dependent tolerance and barrier function and identify potential therapeutic targets for irColitis.

The development of robust artificial intelligence models for echocardiography has been limited by the availability of annotated clinical data. Here, to address this challenge and improve the performance of cardiac imaging models, we developed EchoCLIP, a vision-language foundation model for echocardiography, that learns the relationship between cardiac ultrasound images and the interpretations of expert cardiologists across a wide range of patients and indications for imaging. After training on 1,032,975 cardiac ultrasound videos and corresponding expert text, EchoCLIP performs well on a diverse range of benchmarks for cardiac image interpretation, despite not having been explicitly trained for individual interpretation tasks. EchoCLIP can assess cardiac function (mean absolute error of 7.1% when predicting left ventricular ejection fraction in an external validation dataset) and identify implanted intracardiac devices (area under the curve (AUC) of 0.84, 0.92 and 0.97 for pacemakers, percutaneous mitral valve repair and artificial aortic valves, respectively). We also developed a long-context variant (EchoCLIP-R) using a custom tokenizer based on common echocardiography concepts. EchoCLIP-R accurately identified unique patients across multiple videos (AUC of 0.86), identified clinical transitions such as heart transplants (AUC of 0.79) and cardiac surgery (AUC 0.77) and enabled robust image-to-text search (mean cross-modal retrieval rank in the top 1% of candidate text reports). These capabilities represent a substantial step toward understanding and applying foundation models in cardiovascular imaging for preliminary interpretation of echocardiographic findings.

INTRODUCTION: A three-pronged approach to acne treatment combining an antibiotic, antimicrobial, and retinoid may be more efficacious than single/double treatments while potentially reducing antibiotic resistance. This study evaluated the efficacy and safety of the first fixed-dose, triple-combination topical acne product, clindamycin 1.2%/adapalene 0.15%/benzoyl peroxide (BPO) 3.1% gel (CAB) using pooled phase 3 data. METHODS: In two identical phase 3 (N = 183; N = 180), double-blind, 12-week studies, participants aged ≥ 9 years with moderate-to-severe acne were randomized 2:1 to receive once-daily CAB or vehicle gel. Endpoints included ≥ 2-grade reduction from baseline in Evaluators Global Severity Score and clear/almost clear skin (treatment success) and least-squares mean percent change from baseline in acne lesion counts. Treatment-emergent adverse events (TEAEs) and cutaneous safety/tolerability were evaluated. RESULTS: At week 12, 50.0% of participants achieved treatment success with CAB versus 22.6% with vehicle gel (P  70% reductions in inflammatory and noninflammatory lesions at week 12 (77.9% and 73.0%, respectively), which were significantly greater than vehicle (57.9% and 48.2%; P

INTRODUCTION: There has been a rapid proliferation of synthetic nicotine products in recent years, despite newly established regulatory authority and limited research into its health risks. Previous research has implicated social media platforms as an avenue for nicotine product unregulated sales. Yet, little is known about synthetic nicotine product content on social media. We utilized natural language processing to characterize the sales of synthetic nicotine products on Instagram. METHODS: We collected Instagram posts by querying Instagram hashtags (eg, #tobaccofreenicotine) related to synthetic nicotine. Using Bidirectional Encoder Representations from Transformers, collected posts were categorized into thematically related topic clusters. Posts within topic clusters relevant to study aims were then manually annotated for variables related to promotion and selling (eg, cost discussion, contact information for offline sales). RESULTS: A total of 7425 unique posts were collected with 2219 posts identified as related to promotion and selling of synthetic nicotine products. Nicotine pouches (52.9%, n = 1174), electronic nicotine delivery systems (30.6%, n = 679), and flavored e-liquids (14.1%, n = 313) were most commonly promoted. About 16.1% (n = 345) of posts contained embedded hyperlinks and 5.8% (n = 129) provided contact information for purported offline transactions. Only 17.6% (n = 391) of posts contained synthetic nicotine-specific health warnings. CONCLUSIONS: In the United States, synthetic nicotine products can only be legally marketed if they have received premarket authorization from the Food and Drug Administration (FDA). Despite these prohibitions, Instagram appears to be a hub for potentially unregulated sales of synthetic and tobacco-free products. Efforts are needed by platforms and regulators to enhance content moderation and prevent unregulated online sales of existing and emerging synthetic nicotine products. IMPLICATIONS: There is limited clinical understanding of synthetic nicotines unique health risks and how these novel products are changing over time due to regulatory oversight. Despite synthetic nicotine-specific regulatory measures, such as the requirement for premarket authorization and FDA warning letters issued to unauthorized sellers, access to and promotion of synthetic nicotine is widely occurring on Instagram, a platform with over 2 billion users and one that is popular among youth and young adults. Activities include direct-to-consumer sales from questionable sources, inadequate health warning disclosure, and exposure with limited age restrictions, all conditions necessary for the sale of various tobacco products. Notably, the number of these Instagram posts increased in response to the announcement of new FDA regulations. In response, more robust online monitoring, content moderation, and proactive enforcement are needed from platforms who should work collaboratively with regulators to identify, report, and remove content in clear violation of platform policies and federal laws. Regulatory implementation and enforcement should prioritize digital platforms as conduits for unregulated access to synthetic nicotine products and other future novel and emerging tobacco products.

BackgroundNicotine and tobacco product (NTP) and cannabis use are common in adolescence/young adulthood and increase risk for negative psychosocial outcomes. This study investigated associations among adolescent/young adults' initial experiences with NTPs, lifetime frequency of substance use, substance-related problems, and mental health symptoms.MethodAdolescents and young adults enrolled in a study on NTP and cannabis use were asked at what age they initiated the use of NTPs and were assigned to groups based on which product or substance(s) they reported using at the earliest age. Participants who reported use of NTPs (in isolation, without cannabis) first (N = 78, "NTP-only"), simultaneous use of NTPs and cannabis first (e.g., blunt or bowl; N = 25, "Simult-only"), use of both NTPs in isolation and simultaneous use at the same age (N = 48, "NTP + Simult"), and no NTP use (N = 53, "NTP-naïve") were compared on substance use, substance-related problems, and mental health symptoms.ResultsGroups differed on lifetime frequency of NTP, simultaneous, and cannabis use, with NTP users reporting more substance use episodes and substance-related problems than the NTP-naïve group. The lifetime frequency of cannabis use did not differ across NTP use groups. NTP use was associated with increased anxiety and depression, with no significant differences between groups.ConclusionsAdolescents and young adults who use nicotine may be at increased risk for greater nicotine use and mental health consequences, but initiating NTP use simultaneously with cannabis may not increase the risk of negative outcomes above and beyond nicotine initiation. Prospective longitudinal research is needed to establish temporal associations between first-used NTP/cannabis products and relevant outcomes.

Atrial fibrillation (AF) often escapes detection, given its frequent paroxysmal and asymptomatic presentation. Deep learning of transthoracic echocardiograms (TTEs), which have structural information, could help identify occult AF. We created a two-stage deep learning algorithm using a video-based convolutional neural network model that (1) distinguished whether TTEs were in sinus rhythm or AF and then (2) predicted which of the TTEs in sinus rhythm were in patients who had experienced AF within 90 days. Our model, trained on 111,319 TTE videos, distinguished TTEs in AF from those in sinus rhythm with high accuracy in a held-out test cohort (AUC 0.96 (0.95-0.96), AUPRC 0.91 (0.90-0.92)). Among TTEs in sinus rhythm, the model predicted the presence of concurrent paroxysmal AF (AUC 0.74 (0.71-0.77), AUPRC 0.19 (0.16-0.23)). Model discrimination remained similar in an external cohort of 10,203 TTEs (AUC of 0.69 (0.67-0.70), AUPRC 0.34 (0.31-0.36)). Performance held across patients who were women (AUC 0.76 (0.72-0.81)), older than 65 years (0.73 (0.69-0.76)), or had a CHA2DS2VASc ≥2 (0.73 (0.79-0.77)). The model performed better than using clinical risk factors (AUC 0.64 (0.62-0.67)), TTE measurements (0.64 (0.62-0.67)), left atrial size (0.63 (0.62-0.64)), or CHA2DS2VASc (0.61 (0.60-0.62)). An ensemble model in a cohort subset combining the TTE model with an electrocardiogram (ECGs) deep learning model performed better than using the ECG model alone (AUC 0.81 vs. 0.79, p = 0.01). Deep learning using TTEs can predict patients with active or occult AF and could be used for opportunistic AF screening that could lead to earlier treatment.

Diastolic dysfunction associated with peri- and post-operative complications.  Propofol and cardiovascular depression.  Some studies report that propofol worsens diastolic function, others report improvement.

BACKGROUND: Management strategies for metastatic castration-resistant prostate cancer (mCRPC) have rapidly shifted in recent years. As novel imaging and therapeutic approaches have made their way to the clinic, providers are encountering increasingly challenging clinical scenarios, with limited guidance from the current literature. MATERIALS AND METHODS: The US Prostate Cancer Conference (USPCC) is a multidisciplinary meeting of prostate cancer experts intended to address the many challenges of prostate cancer management. At the first annual USPCC meeting, areas of controversy and consensus were identified during a 2-day meeting that included expert presentations, full-panel discussions, and postdiscussion responses to questions developed by the USPCC cochairs and session moderators. RESULTS: This narrative review covers the USPCC expert discussion and perspectives relevant to mCRPC, including neuroendocrine/aggressive-variant prostate cancer (NEPC/AVPC). Areas of broad agreement identified among USPCC experts include the benefits of poly (ADP-ribose) polymerase (PARP) inhibitors for patients with BRCA1/2 mutations, the use of radioligand therapy in patients with prostate-specific membrane antigen (PSMA)-positive mCRPC, and the need for clinical trials that address real-world clinical questions, including the performance of novel therapies when compared with modern standard-of-care treatment. Ongoing areas of controversy and uncertainty included the appropriateness of PARP inhibitors in patients with non-BRCA1/2 mutations, the optimal definition of PSMA positivity, and systemic therapies for patients with NEPC/AVPC after progression on platinum-based therapies. CONCLUSIONS: The first annual USPCC meeting identified several areas of controversy in the management of mCRPC, highlighting the urgent need for clinical trials designed to facilitate treatment selection and sequencing in this heterogeneous disease state.

PURPOSE: Castration-sensitive prostate cancer (CSPC) is a complex and heterogeneous condition encompassing a range of clinical presentations. As new approaches have expanded management options, clinicians are left with myriad questions and controversies regarding the optimal individualized management of CSPC. MATERIALS AND METHODS: The US Prostate Cancer Conference (USPCC) multidisciplinary panel was assembled to address the challenges of prostate cancer management. The first annual USPCC meeting included experts in urology, medical oncology, radiation oncology, and nuclear medicine. USPCC co-chairs and session moderators identified key areas of controversy and uncertainty in prostate cancer management and organized the sessions with multidisciplinary presentations and discussion. Throughout the meeting, experts responded to questions prepared by chairs and moderators to identify areas of agreement and controversy. RESULTS: The USPCC panel discussion and question responses for CSPC-related topics are presented. Key advances in CSPC management endorsed by USPCC experts included the development and clinical utilization of gene expression classifiers and artificial intelligence (AI) models for risk stratification and treatment selection in specific patient populations, the use of advanced imaging modalities in patients with clinically localized unfavorable intermediate or high-risk disease and those with biochemical recurrence, recommendations of doublet or triplet therapy for metastatic CSPC (mCSPC), and consideration of prostate and/or metastasis-directed radiation therapy in select patients with mCSPC. CONCLUSIONS: CSPC is a diverse disease with many therapeutic options and the potential for adverse outcomes associated with either undertreatment or overtreatment. Future studies are needed to validate and clinically integrate novel technologies, including genomics, AI, and advanced imaging, to optimize outcomes among patients with CSPC.

INTRODUCTION: Plaque psoriasis is a chronic condition that may impact patients work productivity. Tildrakizumab, an interleukin-23 p19 inhibitor, is approved for treatment of moderate-to-severe plaque psoriasis in adults. However, the effect of tildrakizumab treatment on work productivity in patients with psoriasis is not well characterized. METHODS: In this multicenter, open-label, uncontrolled phase 4 study (NCT03718299), patients with moderate-to-severe plaque psoriasis received tildrakizumab 100 mg at week 0, week 4, and every 12 weeks thereafter through week 52. Patients completed the Work Productivity and Activity Impairment Questionnaire: Psoriasis (WPAI:PSO) at baseline and every 12 weeks from week 16 through week 64. The following four domains of the WPAI:PSO were examined: absenteeism (percentage of time missed from work due to psoriasis), presenteeism (percentage reduction of productivity while at work due to psoriasis), total activity impairment (percentage impairment in activities other than work due to psoriasis), and total work productivity impairment (total percentage of work impairment from both absenteeism and presenteeism due to psoriasis). Missing data were not imputed. RESULTS: Of the 55 patients enrolled, 31 patients completed all domains of the WPAI:PSO at week 64. From baseline to week 64, respectively, mean ± standard deviation (SD) scores improved for presenteeism (20.5 ± 21.7 to 2.6 ± 5.8; P