Search

Eukaryotic gene expression is commonly controlled at the level of RNA polymerase II (RNAPII) pausing subsequent to transcription initiation. Transcription elongation is stimulated by the positive transcription elongation factor b (P-TEFb) kinase, which is suppressed within the 7SK small nuclear ribonucleoprotein (7SK snRNP). However, the biogenesis and functional significance of 7SK snRNP remain poorly understood. Here, we report that LARP7, BCDIN3, and the noncoding 7SK small nuclear RNA (7SK) are vital for the formation and stability of a cell stress-resistant core 7SK snRNP. Our functional studies demonstrate that 7SK snRNP is not only critical for controlling transcription elongation, but also for regulating alternative splicing of pre-mRNAs. Using a transient expression splicing assay, we find that 7SK snRNP disintegration promotes inclusion of an alternative exon via the increased occupancy of P-TEFb, Ser2-phosphorylated (Ser2-P) RNAPII, and the splicing factor SF2/ASF at the minigene. Importantly, knockdown of larp7 or bcdin3 orthologues in zebrafish embryos destabilizes 7SK and causes severe developmental defects and aberrant splicing of analyzed transcripts. These findings reveal a key role for P-TEFb in coupling transcription elongation with alternative splicing, and suggest that maintaining core 7SK snRNP is essential for vertebrate development. LARP7 | BCDIN3 | MePCE | HEXIM1 | SF2/ASF

Hexim1 is a cellular protein that associates with the positive transcription elongation factor b (P-TEFb) to regulate RNA polymerase II elongation of nascent mRNA transcripts. It directly binds to Cyclin T1 of P-TEFb and inhibits the kinase activity of Cdk9, leading to an arrest of transcription elongation. Here, we report the solution structure of the Cyclin T binding domain (TBD) of Hexim1 that forms a parallel coiled-coil homodimer composed of two segments and a preceding alpha helix that folds back onto the first coiled-coil unit. NMR titration, fluorescence, and immunoprecipitation experiments revealed the binding interface to Cyclin T1, which covers a large surface on the first coiled-coil segment. Electrostatic interactions between an acidic patch on Hexim1 and positively charged residues of Cyclin T1 drive the complex formation that is confirmed by mutagenesis data on Hexim1 mediated transcription regulation in cells. Thus, our studies provide structural insights how Hexim1 recognizes the Cyclin T1 subunit of P-TEFb, which is a key step toward the regulation of transcription elongation. Cyclin T1 | NMR spectroscopy | transcription elongation

The class II transactivator (CIITA) is the master integrator of expression of MHC class II genes. It interacts with variety of basal transcription factors to initiate and elongate transcription of these genes. Among others, it recruits positive transcription elongation factor b (P-TEFb) to MHC class II promoters. In cells, P-TEFb is found in small active or large inactive complexes. The large complex is composed of P-TEFb, 7SK small nuclear RNA, and hexamethylene bisacetamide-inducible protein 1 (Hexim1). The present study identifies Hexim1 as a potent inhibitor of CIITA-mediated transcription. Not only the exogenously expressed but also IFN-[gamma]-induced CIITA was inhibited by Hexim1. This inhibition did not result from an association between Hexim1 and CIITA but depended on the intact Cyclin T1-binding domain in Hexim1. Importantly, Hexim1 sequestered P-TEFb from CIITA, as documented by binding competition and ChIP assays. Conversely, the depletion of Hexim1 from cells by siRNA increased CIITA-mediated transcription. Thus, modulating ratios between active and inactive P-TEFb complexes is an additional mechanism of regulating transcriptional activators such as CIITA. 7SK small nuclear RNA

Genetic susceptibility to rheumatoid arthritis (RA) is associated with certain MHC class II molecules. To clarify the role of these determinants in RA, we generated the D1CC transgenic mouse that expressed genes involved in antigen processing and presentation by the MHC class II pathway in joints. The class II transactivator, which was transcribed from the rat collagen type II promoter and enhancer, directed the expression of these genes. In D1CC mice congenic for the H-[2.sup.q] (DBA/1) background, small amounts of bovine collagen type II in adjuvant induced reproducibly an inflammatory arthritis resembling RA. Importantly, these stimuli had no effect in DBA/1 mice. Eighty-nine percent of D1CC mice developed chronic disease with joint swelling, redness, and heat in association with synovial proliferation as well as pannus formation and mononuclear infiltration of synovial membranes. Granulomatous lesions resembling rheumatoid nodules and interstitial pneumonitis also were observed. As in patients with RA, anticyclic citrullinated peptide antibodies were detected during the inflammatory stage. Finally, joints in D1CC mice displayed juxtaarticular demineralization, severe joint space narrowing, and erosions, which led to ankylosis, but without the appearance of osteophytes. Thus, aberrant expression of MHC class II in joints facilitates the development of severe erosive inflammatory polyarthritis, which is very similar to RA. autoimmunity | class II transactivator | transgenic mouse | nodules | pneumonitis

HIV buds from lipid rafts and requires cholesterol for its egress from and entry into cells. Viral accessory protein Nef plays a major role in this process. In this study, it not only increased the biosynthesis of lipid rafts and viral particles with newly synthesized cholesterol, but also enriched them. Furthermore, via the consensus cholesterol recognition motif at its C terminus, Nef bound cholesterol. When this sequence was mutated, Nef became unable to transport newly synthesized cholesterol into lipid rafts and viral particles. Interestingly, although its levels in lipid rafts were not affected, this mutant Nef protein was poorly incorporated into viral particles, and viral infectivity decreased dramatically. Thus, Nef also transports newly synthesized cholesterol to the site of viral budding. As such, it provides essential building blocks for the formation of viruses that replicate optimally in the host.

The transcriptional transactivator Tat from HIV binds to the transactivation response element (TAR) RNA to increase rates of elongation of viral transcription. Human cyclin T supports these interactions between Tat and TAR. In this study, we report the sequence of mouse cyclin T and identify the residues from positions 1 to 281 in human cyclin T that bind to Tat and TAR. Mouse cyclin T binds to Tat weakly and is unable to facilitate interactions between Tat and TAR. Reciprocal exchanges of the cysteine and tyrosine at position 261 in human and mouse cyclin T proteins also render human cyclin T inactive and mouse cyclin T active. These findings reveal the molecular basis for the restriction of Tat transactivation in rodent cells.

Human immunodeficiency virus (HIV)-encoded trans-activator (Tat) acts through the trans-activation response element RNA stem-loop to increase greatly the processivity of RNA polymerase II. Without Tat, transcription originating from the HIV promoter is attenuated. In this study, we demonstrate that transcriptional activation by Tat in vivo and in vitro requires the C-terminal domain (CTD) of RNA polymerase II. In contrast, the CTD is not required for basal transcription and for the formation of short, attenuated transcripts. Thus, trans-activation by Tat resembles enhancer-dependent activation of transcription. These results suggest that effects of Tat on the processivity of RNA polymerase II require proteins that are associated with the CTD and may result in the phosphorylation of the CTD.

Promoter-proximal transcripts are identified by a reverse transcription-polymerase chain reaction (RT-PCR) method and U1 cells produce more promoter-proximal transcripts than promoter-distal transcripts. RT-PCR study is used to analyze the transcriptional state of proviruses of human immunodeficiency virus (HIV) infected individuals, and individuals with high CD4 levels are readily analyzed in the absence of promoter-distal transcripts.

A cellular serine kinase that specifically associates with Nef was observed with T-cell lines constitutively expressing Nef from the SF2 strain of human immunodeficiency virus type 1 (HIV-1SF2) in the from of a hybrid CD8-Nef fusion protein or T-cell lines chronically infected with HIV-1SF-2. Inhibitors of protein kinase C or protein kinase A failed to inhibit this Nef-linked serine kinase activity.

Defects in promoters of the silent DQA2, DQB2 and DOB genes from the major histocompatibility complex class II region were mapped by placing the Z and X boxes of these genes in a synthetic DRA promoter. The conserved upstream sequences (CUS) confer B-cell-specific and gamma-interferon-inducible expression to the DRA gene. These CUS are implicated in the transcriptional defects of these silent genes.

HIV buds from lipid rafts and requires cholesterol for its egress from and entry into cells. Viral accessory protein Nef plays a major role in this process. In this study, it not only increased the biosynthesis of lipid rafts and viral particles with newly synthesized cholesterol, but also enriched them. Furthermore, via the consensus cholesterol recognition motif at its C terminus, Nef bound cholesterol. When this sequence was mutated, Nef became unable to transport newly synthesized cholesterol into lipid rafts and viral particles. Interestingly, although its levels in lipid rafts were not affected, this mutant Nef protein was poorly incorporated into viral particles, and viral infectivity decreased dramatically. Thus, Nef also transports newly synthesized cholesterol to the site of viral budding. As such, it provides essential building blocks for the formation of viruses that replicate optimally in the host. [ABSTRACT FROM AUTHOR]

The Tat protein of human immunodeficiency virus type 1 enhances transcription by binding to a specific RNA element on nascent viral transcripts. Binding is mediated by a 10-amino acid basic domain that is rich in arginines and lysines. Here we report the three-dimensional peptide backbone structure of a biologically active 25-mer peptide that contains the human immunodeficiency virus type 1 Tat basic domain linked to the core regulatory domain of another lentiviral Tat--i.e., that from equine infectious anemia virus. Circular dichroism and two-dimensional proton NMR studies of this hybrid peptide indicate that the Tat basic domain forms a stable alpha-helix, whereas the adjacent regulatory sequence is mostly in extended form. These findings suggest that the tendency to form stable alpha-helices may be a common property of arginine- and lysine-rich RNA-binding domains.

DNA fragments isolated from a genomic clone of human gamma interferon (IFN-gamma) as well as IFN-gamma cDNA were used to map potential regulatory regions of the IFN-gamma gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-gamma gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-gamma gene. No hypersensitivity was found in the 3' regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-gamma, is 83% homologous to a nearly identical sequence in the 5' flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.

The study of specific trans-acting transcription factors in prokaryotes and lower eukaryotes has been greatly facilitated by genetic analysis of mutant strains deficient in such factors. We have developed such a system to study mammalian trans-acting factors that regulate the transcription of class II major histocompatibility complex genes, using the mutant cell lines RM2 and RM3. These cells, derived from the human B-cell line Raji, specifically fail to transcribe their class II major histocompatibility complex genes. Here we show that a transfected HLA-DR alpha class II major histocompatibility complex gene, like the endogenous HLA-DR alpha genes, is efficiently transcribed in Raji cells but not in RM2 or RM3 cells, demonstrating that the mutant cells are deficient in a specific trans-acting factor required for transcription of these genes. HLA-DR expression in RM2 and RM3 cells is rescued by fusion to another B-cell line but not by fusion to each other. Thus, the defects in the two cell lines are recessive and noncomplementing and define a locus whose wild-type product we designate TF-X1. We show that TF-X1 influences the activity of a 24-base-pair B-cell-specific cis-acting transcription element in the HLA-DR alpha promoter. However, in three different biochemical assays, we detect no difference between wild-type and mutant cells in the DNA-binding proteins that interact with these DNA sequences. Thus, the defective version of TF-X1 may be a DNA-binding protein that binds to the HLA-DR alpha promoter but fails to activate transcription. Alternatively, TF-X1 may not be a DNA-binding protein at all.

Human immunodeficiency virus (HIV), the causative agent of AIDS, infects and kills lymphoid cells bearing the CD4 antigen. In an infected cell, a number of cellular as well as HIV-encoded gene products determine the levels of viral gene expression and HIV replication. Efficient HIV-replication occurs in activated T cells. Utilizing transient expression assays, we show that gene expression directed by the HIV long terminal repeat (LTR) increases in response to T-cell activation signals. The effects of T-cell activation and of the HIV-encoded trans-activator (TAT) are multiplicative. Analysis of mutations and deletions in the HIV LTR reveals that the region responding to T-cell activation signals is located at positions -105 to -80. These sequences are composed of two direct repeats, which are homologous to the core transcriptional enhancer elements in the simian virus 40 genome. Our studies reveal that these elements function as the HIV enhancer. By acting directly on the HIV LTR, T-cell activation may play an important role in HIV gene expression and in the activation of latent HIV.

Human immunodeficiency virus 1 has been implicated as the main etiologic agent of the acquired immunodeficiency syndrome. However, other infectious agents may accelerate the progression of this disease. In particular, hepatitis B virus has been suggested as one such cofactor. Therefore, we have investigated the effects of hepatitis B virus gene products on expression of the human immunodeficiency virus I in transient transfection studies of Jurkat lymphoblastic T cells, using as reporter the chloramphenicol acetyltransferase gene coupled to the long terminal repeat of human immunodeficiency virus I. As measured by the amount of chloramphenicol acetyltransferase activity, gene expression directed by the human immunodeficiency virus I long terminal repeat increased approximately 10-fold in response to the hepatitis B virus X protein. This trans-activation by the X protein is multiplicative with the effect of phorbol esters and can be accounted for by an increase in the steady-state level of chloramphenicol acetyltransferase mRNA. Analysis of deletion and clustered point mutants in the long terminal repeat indicated that the X protein exerts its effect through multiple cis-acting sites. These results provide a possible molecular basis for the association of hepatitis B virus and the acquired immunodeficiency syndrome and confirm that the X protein is a transcriptional transactivator.

We have synthesized 175-nucleotide-long probes for the DNA of human histocompatibility antigens HLA-DR alpha and beta by extending on poly(A)+ mRNA from B-cell lines with short synthetic deoxyribonucleotide primers complementary to the predicted nucleotide sequence of the NH2 terminus of both polypeptides. The synthesis of the probe for the alpha-chain DNA was a two-step process starting with 11-mers which were extended by dideoxynucleotide chain termination experiments to a 20-mer of predicted sequence. The synthesized 20-mer was then used to generate a 175-nucleotide cDNA probe which was shown to encode the appropriate amino acids for the alpha chain and was used to select a human genomic DNA clone containing the coding sequences for HLA-DR alpha. For the beta polypeptide an 18-mer homologous to the NH2-terminal sequence of a cDNA clone from another B-cell line was used to extend on poly(A)+ mRNA isolated from a B-cell line. Preliminary sequence analysis of a 175-base-long extension product indicates a match of the cDNA sequence to the published sequence of a clone for HLA-DR beta. Information from these extension experiments helps to establish the sensitivity and specificity of the primer extension method.

The genome of human immunodeficiency virus encodes a protein that dramatically elevates amounts of viral proteins. The precise mechanism of this trans-activation remains to be established. It has been reported that trans-activation can occur without major changes in the levels of mRNA. We constructed recombinant plasmids containing those viral sequences required in cis for trans-activation linked to the chloramphenicol acetyltransferase gene. These plasmids were introduced into cultured cells in either the presence or absence of a second plasmid that directed expression of the viral trans-activator protein. Expression of the chloramphenicol acetyltransferase gene was measured at the level of protein (by enzymatic assay) and RNA (by ribonuclease protection and primer extension). Our results demonstrate that trans-activation is accompanied by large increases in mRNA levels; these increases may be sufficient to explain the elevated levels of trans-activated protein.

The unusual electron microscopic appearance of a hybrid formed between 9S mouse beta-globin mRNA and its corresponding cloned gene segment is caused by at least one, and possibly two, intervening sequences of DNA that interrupt the mouse beta-globin gene. Such an interpretation is consistent with a paradoxical restriction site pattern previously noted in this gene and with the nucleotide sequence of that portion of the gene that spans both structural and intervening sequences. The large intervening sequence, approximately 550 base pairs in length, occurs in the structural globin sequence and immediately follows the beta-globin codon corresponding to amino acid 104. A smaller, putative intervening sequence is located close to the 5' end of the beta-globin-coding sequence but may reside beyond its initiation codon. The beta-globin gene thus appears to be encoded in two, and possibly three, discontinuous segments.

We investigated the cis-acting sequences that function in the B-cell-specific and interferon-gamma-inducible expression of the HLA-DR alpha gene, a human class II major histocompatibility complex gene. The effects of 5' deletions on the activity of the DR alpha promoter and the influence of upstream DR alpha promoter elements on the activity of the herpes simplex virus thymidine kinase promoter were examined by a transient transfection assay in human B-, T-, and fibroblast cell lines. We show that the DR alpha gene is regulated by positive and negative cis-acting sequences between positions -1300 and +31 from the site of initiation of transcription. We also demonstrate that the DR alpha promoter sequences from positions -116 to -92 and from -136 to -80 are the minimal sequences required for conferring B-cell specificity and interferon-gamma inducibility upon the Herpes simplex virus thymidine kinase promoter, respectively.