Search

In 2012, dormant canes of a proprietary wine grape (Vitis vinifera L.) accession were included in the collection of the University of California–Davis Foundation Plant Services. No virus-like symptoms were elicited when bud chips from propagated own-rooted canes of the accession were graft-inoculated onto a panel of biological indicators. However, chlorotic ringspot symptoms were observed on sap-inoculated Chenopodium amaranticolor Coste & A. Rein and C. quinoa Willd. plants, indicating the presence of a mechanically transmissible virus. Transmission electron microscopy of virus preparations from symptomatic C. quinoa revealed spherical, nonenveloped virions about 27 nm in diameter. Nepovirus-like haplotypes of sequence contigs were detected in both the source grape accession and symptomatic C. quinoa plants via high-throughput sequencing. A novel bipartite nepovirus-like genome was assembled from these contigs, and the termini of each RNA segment were verified by rapid amplification of complementary DNA ends assays. The RNA1 (7,186-nt) of the virus encodes a large polyprotein 1 of 231.1 kDa, and the RNA2 (4,460-nt) encodes a large polyprotein 2 of 148.9 kDa. Each of the polyadenylated RNA segments is flanked by 5′- (RNA1 = 156-nt; RNA2 = 170-nt) and 3′- (RNA1 = 834-nt; RNA2 = 261-nt) untranslated region sequences with >90% identities. Maximum likelihood phylogenetic analyses of the conserved Pro-Pol amino acid sequences revealed the clustering of the new virus within the genus Nepovirus of the family Secoviridae. Considering its biological and molecular characteristics, and based on current taxonomic criteria, we propose that the novel virus, named grapevine nepovirus A, be assigned to the genus Nepovirus.

Raspberry (Rubus idaeus L.) and blackberry (Rubus fruticosus L.) are infected by at least 29 viruses, including the Tomato black ring virus (TBRV) (Martin et al. 2013). TBRV belongs to the genus Nepovirus (subgroup B) of the family Secoviridae and is listed as a plant pathogen in over 40 countries. TBRV infects a wide range of herbaceous and woody plants. In Poland, TBRV has been described on the plants of the following species: Tagetes patula, T. erecta, Cucumis sativus, Cucurbita pepo, Lactuca sativa, Solanum tuberosum, S. lycopersicum, Sambucus nigra, and Robinia pseudoacacia (Jonczyk et al. 2004, Hasiow-Jaroszewska et al. 2015). To this date, there is no information on the incidence of TBRV in raspberry and blackberry in Poland. In the spring of 2019, 52 blackberry leaf samples and 408 raspberry leaf samples were collected from 4 plantations located in central Poland. None of the raspberry plants (cvs. Glen Ample, Polka, Sokolica), nor the blackberry plants (cvs. Thornfree, Polar, Gaj, Kotata) exhibited viral symptoms. Enzyme-linked immunosorbent assay (ELISA) was carried out for extracts from the 460 collected leaf samples to detect TBRV using commercial antisera (Loewe Biochemica GmbH, Germany). The results indicated that 9 samples (4 blackberry, 5 raspberry) were infected with TBRV. The isolates of the virus were transferred by sap inoculation and maintained in Nicotiana tabacum cv. Xanthi. Systemic ringspot, necrosis and patterned lines were observed on tobacco leaves. The presence of the virus in tobacco leaf samples was confirmed by reverse transcription PCR (RT-PCR). Total RNA was extracted from all 9 samples using the silica capture (SC) method described originally by Boom et al. (1990) and adapted to the detection of plant viruses by Malinowski (1997). Part of the CP gene was amplified with the CPF (5'-GCCTGTCTCTCTCGCAATG-3') and CPR (5'-AAGGAGCCAAACTGAAATGT-3') primer pair (Hasiow-Jaroszewska et al. 2015). Amplicons of the expected size (763 bp) were obtained for each sample. The amplified products were purified, sequenced in both directions, deposited in GenBank and assigned accession numbers: MT507387 to MT507390 and MT507394 for the isolates from Rubus idaeus and MT507391 to MT507393 and MN954654 for the isolates from Rubus fruticosus, respectively. The 9 newly obtained TBRV CP gene sequences, together with the 25 isolates deposited in GenBank, were aligned by ClustalW. The isolates obtained in this study showed a 99.0-100% nucleotides (nt) and a 98.7-100% amino acids (aa) identity in the part of the CP, respectively. Comparison of the part of the CP of the 4 blackberry and the 5 raspberry TBRV isolates with 25 TBRV isolates available in GenBank showed a 80.6-97.8% nt and a 87.9-99.5% aa identity, respectively. The results of the phylogenetic analysis have revealed that the TBRV isolates obtained in this study are closely related to 3 Polish isolates (AY157994, KR139941, KR139951) and 1 Bioreba ctrl Switzerland isolate (KT923164). These findings are of epidemiological significance due to the fact that TBRV was detected on symptomless Rubus plants, which therefore represent a reservoir of the virus and a threat in case of a symptomatic infection of sensitive cultivars. Accordingly, the results will assist in using appropriate strategies for reducing TBRV incidence in Rubus-growing areas. Moreover, this is, to the best of our knowledge, the first report of TBRV in raspberry and blackberry in Poland.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Currants (Ribes spp.) are infected by at least 30 viruses (Koloniuk et al. 2018; Teifion Jones 2002), yet two are associated with the most important virus diseases of the crop: black currant reversion virus (BRV) for currant reversion and gooseberry vein banding associated virus (GVBaV) for the homonymous disease (Teifion Jones et al. 2001). BRV belongs to subgroup C of the genus Nepovirus of the family Comoviridae, whereas GVBaV is a member of genus Badnavirus, family Caulimoviridae (Petrzik et al. 2012). To this date, there is no information on the presence of either viruses in currant in Bosnia and Herzegovina (BiH). Surveys were carried out to assess the occurrence and diversity of the two viruses using high-throughput sequencing (HTS). Thirteen currant specimens (one red, one white, and 11 black) were collected in spring 2018 from commercial orchards in three localities (Travnik, Teslic, and Bugojno). Only three plants exhibited virus-like symptoms: the red currant (Ribes rubrum) from Travnik displayed leaf and flower malformation; the white currant and one black currant (R. nigrum) from Teslic showed yellow patterns and chlorosis on the upper canopy. RNA was extracted from seven samples (white, red, and black currants; both symptomatic and asymptomatic) using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Germany) and further depleted of ribosomal RNA using the KAPA RNA Hyper+RiboErase HMR kit. Libraries were generated and sequenced on the Illumina NextSeq 500/550 platform in separate reactions. Sequence analysis using Virfind (Ho and Tzanetakis 2014) revealed the presence of BRV in the red currant plant with typical disease symptoms and an asymptomatic black currant (47 and 28 contigs respectively, from 105 to 1,584 bp) and GVBaV in an asymptomatic plant (17 contigs from 350 to 1,903 bp). Nucleic acids were extracted from all 13 samples using the Poudel et al. (2013) protocol that facilitated detection of both DNA and RNA viruses. Reverse transcription PCR (RT-PCR) and PCR analyses were performed with two pairs of virus-specific primers for BRV (F, 5′-GTAATACGCTGGTGTCTC-3′/R, 5′-GAAAGGACATTTCAGACTC-3′ and F, 5′-ATTTCGAGCTGTATGGTCG-3′/R, 5′-CTCGGAAGCAGTAGACCT-3′ [Lemmetty et al. 2001]) and for GVBaV (F, 5′-ACATCAAAGGGAAGGACAAC-3′/R, 5′-TCTAAAAGCATCCACTACCAC-3′ and F, 5′-TCAGACAGGCTCTCAACAATAC-3′/R, 5′-TTCTAAAAGCATCCACTACCAC-3′) (Jones et al. 2001). These assays identified an additional GVBaV-positive sample. All amplicons were sequenced, and BLAST analysis of the BRV sequences (GenBank accession nos. MK501976 to MK501978) and GVBaV (GenBank accession nos. MK519228 to MK519230) revealed 92 to 98% and 96 to 99% nucleotide identity to GenBank accessions AF321572 and JQ388488, respectively. The positive samples were further assessed for the presence of the viruses using northern-blot hybridization with a digoxigenin-labeled probe that targeted the nontranslated region of BRV RNA2 and conserved motifs in the ribonuclease H domain of GVBaV. The results were in line with HTS and PCR detection and with the symptoms expressed in the three symptomatic plants. In addition, the episomal form of GVBaV was confirmed by positive results in RT-PCR using DNase-treated total nucleic acids and rolling circle amplification. To our knowledge, this is the first time that BRV and GVBaV were detected in currants in BiH. Given the lack of a currant certification program in the country, this information will be used in the development of best management practices for control of the two viruses and their associated diseases in both field and nursery operations.

Grapevine fanleaf virus (GFLV) is vectored specifically from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Limited information is available on the vector competency of X. index populations from diverse geographical origins. We determined the transmissibility of two GFLV strains showing 4.6% amino acid divergence within their coat protein (e.g., strains F13 and GHu) by seven clonal lines of X. index developed from seven distinct populations from the Mediterranean basin (Cyprus, southern France, Israel, Italy, and Spain), northern France, and California. X. index lines derived from single adult females were produced on fig (Ficus carica) plants to obtain genetically homogenous aviruliferous clones. A comparative reproductive rate analysis on Vitis rupestris du Lot and V. vinifera cv. Cabernet Sauvignon showed significant differences among clones, with the single-female Cyprus line showing the highest rate (30-fold the initial population) and the Spain and California lines showing the lowest rate (10-fold increase), regardless of the grapevine genotype. However, there was no differential vector competency among the seven X. index lines for GFLV strains F13 and GHu. The implications of our findings for the dynamic of GFLV transmission in vineyards and screening of Vitis spp. for resistance to GFLV are discussed.

Sweet cherries (Prunus avium) are of economic importance in Oregon, which ranks third in sweet cherry production in the United States after Washington and California. Cherry leaf roll virus (CLRV) causes decline in sweet cherry trees. Cherry leaf roll virus is a species of the genus Nepovirus in the family Secoviridae. In May 2016, decline, rosetting (bunching of leaves due to shortened internodes), and enation symptoms in approximately 7% of trees were observed in adjacent sweet cherry orchards cvs. ‘Royal Anne’ and ‘Bing’ on Mazzard rootstock in The Dalles, Wasco County, Oregon. A symptomatic leaf sample (cv. ‘Royal Anne’) was collected and tested positive via CLRV-specific antisera in a double-antibody sandwich ELISA (DSMZ; Braunschweig, Germany). A second collection of both cultivars was made in September 2016 from the same and neighboring orchard blocks. Of the 16 samples collected, eight symptomatic leaf samples tested positive and eight asymptomatic samples tested negative with the same CLRV-specif...

Mekuria, T. A., Gutha, L. R., Martin, R. R., and Naidu, R. A. 2009. Genome diversity and intra- and interspecies recombination events in Grapevine fanleaf virus. Phytopathology 99:1394-1402. Grapevine fanleaf virus (GFLV) was documented in self-rooted vines of four grapevine (Vitis vinifera) cultivars in eastern Washington. GFLV was found as mixed infection in cvs. Pinot Noir, Chardonnay, and Cabernet Franc and as single infections in cv. Merlot. Fanleaf disease symptoms were only observed in the first two cultivars. The spatial distribution of GFLV-infected grapevines was random, suggesting primary spread through planting virus-infected cuttings rather than infield transmission. RNA1 sequences of Washington isolates showed 87 to 89% nucleotide sequence identity between them and with strain F13. RNA2 of Washington isolates was variable in size, showing 85 to 99% sequence identity between them and 81 to 92% with other isolates. As in other GFLV isolates, three conserved putative stem-loop structures were present in the 5′ noncoding regions of both RNAs of Washington isolates. Phylogenetic incongruence of GFLV isolates from Washington in 2A HP and 2BMP-based trees and identification of putative recombination events suggested that their genomic RNA2 originated from inter- and intraspecies recombination events between GFLV, Grapevine deformation virus, and Arabis mosaic virus. These results confirm interspecies recombination in RNA2 of grapevine-infecting nepoviruses as an important strategy for GFLV evolution.

Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection of nine grapevine viruses: Arabis mosaic virus, Grapevine fanleaf virus, Grapevine virus A, Grapevine virus B, Rupestris stem pitting-associated virus, Grapevine fleck virus, Grapevine leafroll-associated virus-1, -2, and -3, in combination with a plant RNA internal control used as an indicator of the effectiveness of RNA extraction and RT-PCR. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. Two plant total RNA extraction methods (silica capture and modified RNeasy method) and two RT-PCR systems (onestep and two-step) were evaluated to develop a reliable protocol for mRT-PCR. One to nine fragments specific for the viruses were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. In the two-step mRT-PCR, the detection limits were 10-3or 10-4extract dilutions, depending on the virus. Leaves, phloem from dormant cuttings, and in vitro plantlets from 103 naturally infected and healthy grapevines were analyzed. The mRT-PCR provided a reliable and rapid method for detecting grapevine viruses from a large number of samples.

Grapevine fanleaf virus (GFLV) was detected in samples of Bermuda grass (BG) from Iran by reverse transcription-polymerase chain reaction (RT-PCR) using two different pairs of GFLV-specific primers, and also by enzyme-linked immunosorbent assay (ELISA) using antiserum specific for a North American isolate of the virus. RT-PCR detected GFLV in both fresh and dried BG tissues and in virus preparations purified from these plants. Cloning and sequencing of the RT-PCR products confirmed that the amplified sequences were sections of the GFLV coat protein gene. Similar results were obtained when random and oligo(dT) primers were used on viral RNA templates recovered from BG to synthesize cDNA for cloning and sequencing. The virus induced few or no symptoms in BG, but could nonetheless be transmitted from BG to Chenopodium quinoa by mechanical inoculation. Some isolates induced systemic chlorotic spots and leaf deformation; others remained symptomless in this plant. Both symptomatic and symptomless C. quinoa plants were found to be infected with GFLV, giving positive ELISA and RT-PCR tests. A North American isolate of GFLV was found to be mechanically transmissible to BG as indicated by positive RT-PCR results from root samples of inoculated plants. GFLV-infected BG was widely distributed in the Fars province of Iran.

An indirect immunofluorescent technique was developed to localize tobacco ringspot nepovirus (TRSV) in the vector nematode Xiphinema americanum sensu stricto. A population of this nematode that efficiently transmitted TRSV was given an acquisition access period of 10 days on TRSV-infected cucumber. Treatment of fragments of viruliferous nematodes with a polyclonal antiserum against TRSV followed by fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G resulted in virus-specific bright fluorescence only in the lumen of the stylet extension and esophagus. Virus-specific fluorescent signals were observed in the virus-retention region of 44% of the nematode fragments examined. The percentage of nematodes labeled with virus-specific fluorescence increased as the acquisition access period increased from 0 to 22 days; the increase paralleled the increase in the transmission efficiency of the nematode population. Visualization of the entire virus-retention region of individual nematodes within a population of vector or nonvector nematodes provides a rapid and simple means of monitoring specific attachment of plant viruses.

Diagnostic methods employing the polymerase chain reaction (PCR) provide the most sensitive means currently available for detecting viruses in woody plants. A new technique has been tested that does not rely on gel electrophoresis or molecular hybridization to detect virus-specific PCR products. This colorimetric method for detection of PCR products from woody plants was demonstrated to be at least as sensitive as gel analysis. When combined with immunocapture of virions from plant sap, colorimetric detection provides a means to apply PCR technology to a large number of samples. Here, we report on the use of this technique for detection and quantitation of a walnut isolate of cherry leafroll virus (CLRV-W), citrus tristeza virus (CTV), prune dwarf virus (PDV), prunus necrotic ringspot virus (PNRSV), and tomato ringspot virus (ToRSV) in woody and herbaceous plants. For purified virus preparations, detection limits ranged from 100 pg/ml to 100 ag/ml. We also describe the colorimetric PCR detection of CTV in pooled samples.

Black currant reversion is a virus-like disease whose causal agent has not been identified. In rooted cuttings of a black currant plant affected with the severe form of the disease, pronounced chlorotic line patterns and ringspots developed in newly emerging leaves. From such symptom-bearing leaves, a virus was mechanically transmitted with difficulty to Chenopodium quinoa and, from this host, to other herbaceous test plants. The virus was purified and partially characterized, and the purified viri-ons were used for antiserum production. Virus particles were isometric, approximately 27 nm in diameter, and sedimented as two nucleoprotein components. They contained a protein species with a molecular mass of 55 kDa, which was readily degraded into a 54-kDa protein and two major RNA components of about 6,700 and 7,700 nucleotides (nt), each with a poly(A) tail. Most of these properties are shared by nepoviruses, but the virus was serologically unrelated to 14 nepoviruses or putative nepovi-ruses tested. However, the deduced sequence of 1,260 nt at the 3′ end of one of the viral RNA species was distinct from any known viral sequence, except that it contained short regions of homology to the 3′ terminal sequences of RNAs of seven other nepoviruses and two comovi-ruses. To detect this virus in Ribes plants, primers were designed from the known sequence to amplify a 210-nt region of the cDNA of the virus RNA using an immunocapture reverse transcriptase polymerase chain reaction (IC-RT-PCR) protocol. Using this assay for the virus, we associated its presence with two recognized forms of black currant reversion disease occurring in Finland, Scotland, or New Zealand. We also detected the virus in vector gall mites from reverted plants and in black currant plants on which such vector mites had fed. However, the virus was not detected by IC-RT-PCR in known healthy Ribes plants; in Ribes plants free from reversion, but affected by three other distinct virus-like diseases of Ribes; or in plants infected with arabis mosaic, strawberry latent ringspot, or raspberry ringspot nepoviruses. These data suggest that this virus may be the causal agent of reversion disease, and it is tentatively called black currant reversion associated virus.

Commercial seed lots of various cultivars of kenaf (Hibiscus cannabinus) were shown to transmit hibiscus latent ringspot virus (HLRSV) to progeny seedlings in different percentages up to a maximum of 26%. In these greenhouse tests, no symptoms were observed in the infected seedlings. Enzyme-linked immunosorbent assays (ELISA) of dissected kenaf seeds suggested that seed infection occurs through the embryo. HLRSV was also shown to be seed transmitted in Chenopodium amaranticolor and C. quinoa, in 11% and in less than 1%, respectively, of the seed collected from mechanically inoculated plants. However, transmission of HLRSV through seed was not detected in Abutilon theophrasti. C. quinoa and C. amaranticolor plants infected through seed transmission were invariably symptomless as opposed to mechanically inoculated plants that exhibited systemic symptoms of yellow flecking.

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3′ untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2). References: (1) K. Hosaka and D. M. Spooner. Theor. Appl. Genet. 84:851, 1992. (2) R. A. C. Jones et al. Phytopathology 73:195, 1983. (3) J. R. Thompson et al. Arch. Virol. 149:2141, 2004. (4) B. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Arabis mosaic virus (ArMV; genus Nepovirus, family Comoviridae) is one of several nepoviruses responsible for infectious degeneration disease of grapevines in Europe (3). The first occurrence in Spain, in the summer of 2007, was found in Val de Salnés, Rias Baixas appellation, Galice on 25-year-old vines of the Albariño variety grafted onto an unidentified rootstock and showing leaf yellowing. The second finding was in the spring of 2008 in Barriobusto, Rioja appellation, Basque Country on 30-year-old vines of Tempranillo variety grafted onto 41B rootstock. In this case, no obvious foliar symptoms were observed but fruit set was very poor. Positive ELISA results were obtained at two different laboratories using antibodies to ArMV obtained from two companies (BIOREBA, Reinach, Switzerland and Sediag, Longvic, France). At a third lab, the presence of ArMV was further confirmed by reverse transcription (RT)-nested PCR using the primers described by Bertolini et al. (1). External primers ArMV 1 and ArMV 2 amplified a fragment of 340 bp from the coat protein region of the virus and internal primers ArMV i1 and ArMV i2 amplified a fragment of 203 bp. The specificity of the amplicons was subsequently confirmed by sequencing and comparison with other ArMV isolates available in the GenBank, EMBL, and DDBJ databases. Alignment performed using Blastn showed 85% nucleotide sequence identity with ArMV isolate NW (Accession No. AY017339). ELISA revealed co-infection with GLRaV-1 in Galice, GLRaV-3 in Rioja, and GFkV at both sites; these other viruses being common in their respective appellations. ArMV could be mechanically transmitted from rooted cuttings onto Chenopodium amaranticolor with an average of a 46% success rate (1:10 tissue/buffer ratio; [2]), but the range was very wide (0 to 100%) and dependent on the individual source vine. No statistical differences were found between nicotine or phosphate buffer for extraction or when using shoot tips or root tips as a source of virus (Fisher's exact test). Infection in C. amaranticolor was symptomless, but detectable by ELISA, and systemic. The Galician grapevine was an isolated plant, replanted on the spot of a dead one. Xiphinema diversicaudatum, the nematode vector of ArMV, was found in the vineyard soil. Only two ArMV-positive vines were found among 1,993 plants analyzed in Galice from 2005 to 2007 (no field data available for the second finding). In Rioja, one positive vine was found in a random sample of 74 vines from two different vineyards. Further testing of the neighboring vines indicated that one of the adjacent plants was also infected. This minimal spread since the vineyard was planted is suggestive of a lack of vectored transmission. In Spain as a whole, the virus seems to be rare and associated with the Atlantic biogeographic region. Both vineyards were planted before certified material became widely available. Currently, statutory testing of grapevine propagation material should prevent further spread. References: (1) E. Bertolini et al. Phytopathology 93:286, 2003. (2) G. P. Martelli, ed. Graft-Transmissible Diseases of Grapevines. Handbook for Detection and Diagnosis, FAO, Rome, 1993. (3) G. P. Martelli and E. Boudon-Padieu. Directory of Infectious Diseases of Grapevines and Viruses and Virus-like Diseases of the Grapevine. Bibliographic Report 1998-2004, CIHEAM, Paris, 2006.

The dagger nematode, (Xiphinema rivesi Dalmasso), a member of the X. americanum group, was first reported in 2002 in Chile (3). X. rivesi is a vector of at least four North American nepoviruses including Cherry rasp leaf virus (CRLV), Tobacco ringspot virus (TobRSV), Tomato ringspot virus (TomRSV), and Peach rosette mosaic virus (PRMV) (2). TomRSV, first reported in Chile in 1984, was associated with raspberry decline and lately with brownline disease in D'Agen prune trees (1), however none of the Xiphinema spp. found in Chile have been reported to transmit this nepovirus. Two virus isolates, TomRSV (prune brownline isolate PBL-08) and Grapevine fanleaf virus (GFLV) (Yellow mosaic isolate GFLV-012), from the virus collection of the Departamento de Sanidad Vegetal, Universidad de Chile were used in transmission tests with a population of X. rivesi found in Chile. X. rivesi is not known to transmit GFLV and this virus was included as a check. The nematodes were extracted from soil from a D'Agen prune orchard, and transmission tests were done in compliance with the criteria proposed by Trudgill et al. (4). Cucumis sativus cv. National Pickling were grown in a growth chamber at 25°C and used as acquisition hosts and transmission bait plants. Acquisition hosts were mechanically inoculated with GFLV or TomRSV, displaying systemic symptoms in 15 to 20 days. Noninoculated cucumber plants were included as controls. Virus infection was confirmed by double-antibody sandwich (DAS)-ELISA before the introduction of nematodes to the soil. After a 20-day acquisition feeding period, the nematodes were wet screened from the soil and added to the healthy bait plants and allowed a 20-day inoculation feeding period. X. rivesi transmitted TomRSV but not GFLV. TomRSV bait plants developed systemic symptoms 5 weeks after the nematodes were transferred. Transmission of TomRSV was confirmed by testing leaf and root sap of bait plants in a DAS-ELISA. High virus concentrations were detected in the roots and leaves of TomRSV symptomatic plants. Bait plants on which nematodes had been allowed to feed following virus acquisition from GFLV-infected or from virus-free control plants tested negative by ELISA. No symptoms appeared on bait plants used for GFLV transmission or the control bait plants. To our knowledge, this is the first report of transmission of TomRSV with a Xiphinema population from Chile and South America. References: (1) J. Auger. Acta Hortic. 235:197, 1988. (2) D. J. F. Brown et al. Phytopathology 84:646, 1994. (3) G. Leal et al. Fitopatología 37:75, 2002. (4) D. L. Trudgill et al. Rev. Nematol. 6:133, 1983.

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

The polyphagous stubby-root nematode species, Paratrichodorus teres (Hooper) Siddiqi, was first described from soil under lettuce near Norwich, UK and subsequently reported from South Africa and the United States, but predominantly from temperate regions within Europe (4). P. teres is one of 13 economically important trichodorid species known to be vectors of Tobacco rattle virus (TRV) (4). Artichokes planted during 2000 in a field located in the Kandia area of the Argolis Region, Greece (37°32′N, 22°56′E) exhibited symptoms of a virus infection. Sampling was done to ascertain the presence of Longidorus fasciatus, a vector of artichoke Italian latent nepovirus known to occur in the area (1,4). In addition to L. fasciatus, an unknown trichodorid species and Tylenchorhyncus sp. were recovered from the root zone of artichoke at a number of sites within the field. Measurements and morphological examination of the female (n = 13, body length = 741.7 ± 25.5 μm, onchiostyle = 43.7 ± 0.8 μm, and position of vulva from anterior region relative to total body length V% = 53.8 ± 0.4 μm) and male (n =1, body length = 720.5 μm, onchiostyle = 43.5 μm, spicule length = 51.7 μm, and number of ventromedian precloacal supplements = 3) trichodorids isolated from soil samples conformed to the original description of P. teres and the generic polytomous key (2). Furthermore, morphological identification was supported by molecular data. DNA was extracted from seven individual trichodorids, each of which were placed into separate 0.5-ml micro-centrifuge tubes containing 20 μl of 0.25 M NaOH and incubated at 25°C overnight. Thereafter, samples were incubated at 99°C for 3 min and 10 μl of 0.25 M HCl, 5 μl of 0.5 M Tris-HCl, (pH 8.0) and 5 μl of 2% Triton X-100 were added to each tube. Samples were incubated at 99°C for a further 3 min and stored at -20°C. Template DNA was amplified using polymerase chain reaction with primers specific for 18S rDNA and sequenced (3). The resultant consensus sequence had 99.8% homology to P. teres populations isolated from Portugal and good homology (95 to 98%) with five other Paratrichodorus spp. listed on public sequence databases, e.g., NCBI GenBank. This constitutes a new geographic record and a possible association of P. teres on artichoke. References: (1) D. J. F. Brown et al. Eur. J. Plant Pathol. 103:501, 1997. (2) W. Decraemer. Fundam. Appl. Nematol. 21:37, 1998. (3) C. M. G. Oliveira et al. J. Nematol. 36:153, 2004. (4) C. E. Taylor and D. J. F. Brown. Nematode Vectors of Plant Viruses, CAB International Mycological Institute, Wallingford, UK, 1997.

Leaves displaying bright yellow or light green line pattern symptoms were collected from individual, large, mature buddleias in a home garden in Clemson, SC, a botanical garden in Knoxville, TN, and a container-grown plant on sale in a retail home and garden store in Seneca, SC. Buddleias grown in the southeastern United States frequently display virus-like symptoms, but the line pattern symptom displayed by these plants was atypical of the mosaic, mottling, and leaf deformation seen when buddleias are infected with Alfalfa mosaic virus (AMV) or Cucumber mosaic virus (CMV) (2,4). Line pattern symptoms are frequently seen in woody species infected by ilarviruses or nepoviruses (2). No ilarviruses are reported to infect buddleia and only the nepovirus, Strawberry latent ringspot virus, which is restricted mainly to Europe, is reported to infect this species (1,2). The nepoviruses Tomato ringspot virus (ToRSV) and Tobacco ringspot virus (TRSV) are frequently found infecting plants of many species in the southeastern United States (3). Total RNA was extracted from the three symptomatic plants and used in reverse transcription-polymerase chain reactions (RT-PCR) to detect ToRSV and TRSV using primer pairs developed in this laboratory, which amplify regions around the amino terminus of the coat protein of the respective viruses. The expected amplification product for ToRSV of 327 base pairs was obtained from samples tested from each plant, and the nucleotide sequence of the product showed 96% identity with the corresponding fragment of GenBank Accession No. NC_003839 that the primers were designed to amplify. Repeated attempts to isolate a virus from symptomatic leaves using sap inoculation to Chenopodium amaranticolor Coste & Reyne, C. quinoa Willd, Nicotiana clevelandii Gray, and N. tabacum L. have failed. Repeated testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) of leaves from the plant growing in Clemson consistently produced absorbance values at 405 nm in the range of 0.47 to 0.55 (mean of 8 separate samples per test) for symptomatic and asymptomatic leaves. The range of values for the positive control (ToRSV-G growing in N. clevelandii) was 1.3 to 1.5. The ranges of values for the noninfected controls (noninfected N. clevelandii and leaf tissue from a buddleia known to be infected with AMV and CMV but in which ToRSV or TRSV had never been detected by RT-PCR) were 0.102 to 0.104 and 0.102 to 0.106, respectively. The extraction buffer produced absorbance readings in the range of 0.098 to 0.102. RT-PCR of RNA extracted from other portions of the leaves used in the ELISA consistently amplified the 327-bp product from symptomatic leaves and from the positive control but not from noninfected control tissues. RNA from asymptomatic leaves on the infected plant also produced the 327-bp product in RT-PCR. Isolation of viruses from woody hosts is frequently difficult, and although, we have yet to succeed to confirm the association between the observed symptom and ToRSV, the evidence from PCR and ELISA would indicate ToRSV is present in these plants. To our knowledge, this is the first report of ToRSV, a member of the genus Nepovirus, in buddleia. References: (1) J. Albouy and J. C. Devergne. Maladies á Virus des Plants Ornementales. INRA Editions, Paris, 1998. (2) J. I. Cooper. Virus Diseases of Trees and Shrubs. 2nd ed. Chapman and Hill, London, 1993. (3) J. R. Edwards and R. G. Christie. Pages 352–353 in: Handbook of Viruses Infecting Legumes. CRC Press, Boca Raton, FL, 1991. (4) C. J. Perkins and R. G. T. Hicks. Plant Pathol. 38:443, 1989.

Clonal and seed propagules of Rubus ursinus, the trailing blackberry, and seed of R. leucodermis, the western black raspberry, were collected from throughout the Pacific Northwest (Oregon, Washington, and British Columbia). The collections were made in four general environmental regions: at sea level along the Pacific coast, in the coastal mountains adjacent to the coast, in the Willamette Valley, and in the Cascade Mountains. After the resulting propagules were established, leaves were tested by enzyme-linked immunosorbent assay according to standard procedures. None of the R. leucodermis samples tested positive for raspberry bushy dwarf idaeovirus (RBDV), tomato ringspot nepovirus (TomRV), or tobacco streak ilarvirus (TSV). Rubus leucodermis is either resistant to these viruses or their vectors, the viruses are not seed transmitted in this species, or the viruses were not detected due to inadequate sampling. No samples of R. ursinus tested positive for RBDV or TomRV. Samples from 77% of the sites where cuttings were taken and 37% of the seedling populations tested positive for TSV. Along the Pacific coast, only 20% of the sites sampled by cuttings tested positive for TSV. However, the percentage of infected sites where cuttings were taken increased to 88 and 100% in the coastal mountains and the Cascade Mountains, respectively. Along the Pacific coast, 14% of seedling sites tested positive for TSV. The number of TSV positive seedling sites increased to 45 and 36% in the Cascade Mountains and the coastal mountains, respectively. The Willamette Valley site tested negative for TSV. With one exception, all of the low elevation sites tested negative for TSV. Prevailing winds or earlier flowering may prevent some of these Pacific Coast populations from becoming infected. Many of the TSV positive sites had some samples that tested negative, indicating that TSV is unevenly distributed within these populations.

A national survey was conducted in Canada during 1994 and 1995 for four viral pathogens of quarantine significance in grapevine. A total of 11,417 samples, collected from 637 field sites, was tested for the presence of arabis mosaic virus (ArMV), grapevine fanleaf virus (GFLV), and two viruses commonly associated with grapevine leafroll disease, grapevine leafroll associated virus types I (GLRaV-I) and III (GLRaV-III). Nationally, the incidence of nepovirus-infected samples was low, 0.53 and 0.25% for ArMV and GFLV, respectively, and higher for the two leafroll associated viruses, 1.67% for GLRaV-I and 10.8% for GLRaV-III. Nepoviruses were found only in samples of varieties of Vitis vinifera origin or hybrid crosses, whereas GLRaV-I and GLRaV-III were found in samples of all variety types. Among the varieties tested, GLRaV-III was found primarily in samples of hybrid (14.8%) or other (including the Labrusca varieties Concord, Niagara, and Elvira) (13.5%) origin, whereas GLRaV-I was found predominantly in samples of V. vinifera (4.05%) origin. The widespread occurrence of these viruses in Canada has resulted in a reevaluation of their current quarantine status.

The coat protein (cp) gene and the 3' end untranslated region of a peach isolate of tomato ringspot virus (TomRSV) were cloned from purified total viral RNA and sequenced. Reverse transcription and polymerase chain reaction (RT-PCR) were used to engineer the TomRSV cp gene so that it could be cloned into plasmid vectors designed for either in vitro transcription or plant expression. The cloned TomRSV cp gene was used to transform Nicotiana benthamiana and N. tabacum plants, a systemic and a local lesion host, respectively. After challenge inoculation with the TomRSV peach isolate, several R 0 , R 1 , and R 2 resistant transgenic lines containing sense and antisense cp constructs exhibited different levels of protection ranging from complete resistance to delay in symptom appearance or reduction in symptom severity. Interestingly, cp gene expression levels were undetectable by enzyme-linked immunosorbent assay (ELISA) in the resistant lines containing cp sense constructs, and levels of cp transcripts were low or undetectable by Northern blot on resistant sense and antisense lines. The high level of resistance obtained in Nicotiana spp. offers important prospects for the engineering of TomRSV resistance into several economically important fruit and berry crops susceptible to this nepovirus.

Peach rosette mosaic virus (PRMV), a nepovirus prevalent in Michigan, causes severe crop loss and death to Concord grapevine cultivars. Because of the high cost of soil fumigation, combined with the removal of most soil fumigants from the market, three types of grapevine cultivars (American scion cvs. Concord, Delaware and Niagara; French-American hybrid rootstock cvs. Couderc 1202, C. 1616, Teleki SA, and Teleki SC; French-American hybrid scion cvs. Chancellor, Foch, Seyval, and Vignoles) were tested for resistance to PRMV. In 1986, 44 vines of each cultivar were planted into a field that had contained mature, uniformly PRMV-infected Concord vines and a uniform population distribution of the dagger nematode vector (Xipinema americanum). From 1988-1991 each vine was annually tested for PRMV infection by enzyme-linked immunosorbent assay in the spring and summer. By 1991, the final year of testing, PRMV was detected in less than 5% of the vines of Chancellor and Couderc 1616, 7% of the vines of Couderc 1202 and Foch, 18.2% of the vines of Niagara and Delaware, 20% of the vines of Teleki 5C, and 50% or more of the vines of Vignoles, Teleki SA, and Concord. Seyval remained uninfected for the duration of the experiment. The greatest reduction in yield and growth (up to 40 and 60%, respectively) was in Concord. Chancellor, Couderc 1202, Couderc 1616, Foch, Teleki 5A, and Vignoles also showed reduced yield, growth, or both, when PRMV-infected and healthy vines were compared

A polymerase chain reaction (PCR) protocol has been developed for the detection of tomato ringspot virus (TomRSV) in herbaceous and woody plant tissues. This PCR test detected all major TomRSV serogroups (A through E) and can detect as little as 60 pg of target sequence in Malus sylvestris leaf tissue. The oligonucleotides selected for the TomRSV PCR primed a 449-nucleotide region of the putative viral polymerase gene and did not react to any of the healthy plant tissues tested. The high sensitivity and specificity of TomRSV PCR give researchers a new and powerful technique to study this important plant virus

The genomes of several viruses infecting woody host plants were found to serve as templates for the reverse transcriptase-polymerase chain reaction (RT-PCR) while still contained within their capsids as virions in solution. A detection system was developed in which the virions could be assayed by RT-PCR after recovery from solution by immobilization directly onto polypropylene or polystyrene surfaces. Components of crude plant extracts that could otherwise inhibit the RT-PCR analysis were washed away, and the immobilized virions could then be detected by the PCR reaction. Quantitative RT-PCR assays of virions bound nonspecifically to plastic were compared to those in which the viruses were bound by specific antiserum-directed immunocapture. Binding to plastic was inhibited to a greater extent by extracts of some of the host plants than was immunocapture

A region of the coat protein (CP) gene of grapevine fanleaf virus (GFLV) was detected by RT-PCR in the nematode vector Xiphinema index. The reverse transcription step was performed with total RNA extracted from viruliferous X. index. From the synthesized first cDNA strand, an 810-nucleotide fragment (nt 2515-3324 of GFLV-RNA2) was amplified by two 25-mer primers designed in the CP gene. Specific detection was successfully accomplished with samples of one or 10 viruliferous nematodes. Preliminary analysis and comparison of the 207-nt sequence of a stretch (nt 2549-2755 of GFLV-RNA2) of five different RT-PCR amplified fragments, obtained from 10 nematodes of a same sample in a diseased vineyard, indicated substantial variations in the GFLV CP gene

Fifty-five grape rootstock selections produced by L. A. Lider, nine Vitis vinifera×Muscadinia rotundifofia (VR) hybrids produced by H. P. Olmo (both of the University of California, Davis), and three fanleaf degeneration-susceptible grape rootstocks were planted in 1979 in a site in the Napa Valley, California, known to be infested with grapevine fanleaf virus (GFLV) and viruliferous Xiphinema index. All of these rootstock selections were field-budded with V. vinifera cv. Cabernet Sauvignon. The site was chosen because of the relatively uniform distribution of virus and vector. Shoot tips from the scions were first assessed for the presence of GFLV in 1981 with enzyme-linked immunosorbent assay (ELISA)

Individual nematodes (Nematoda: Longidoridae) from three different populations of Xiphinema americanum sensu stricto and one population each of X. bricolensis, X. californicum, and X. rivesi were tested in the laboratory for their ability to transmit the following North American nepoviruses: cherry rasp leaf (CRLV), tobacco ringspot (TobRSV), and two strains of tomato ringspot (TomRSV). X. californicum and X. rivesi nematodes transmitted all four viruses, but X. rivesi transmitted the viruses more frequently. X. bricolensis nematodes transmitted only the two serologically distinguishable strains of TomRSV but were more efficient vectors of the peach stem pitting (PSP) strain than of the prune brown line (PBL) strain of this virus [...]

A polymerase chain reaction (PCR) method has been developed to detect grapevine fanleaf virus (GFLV) in GFLV-infected grape tissue. Four sample extraction methods for infected plant tissues were compared. Although PCR could readily detect RNA in samples of GFLV RNA and virion in GFLV-infected leaf samples of Gomphrena globosa with all four extraction methods, only one method was useful for GFLV detection in grapevine tissue. Dilution of infected grape leaf samples by a 200-fold excess of healthy leaf tissue did not prevent GFLV detection by this method [...]

A purified preparation of the walnut isolate of cherry leafroll virus (CLAY) was successfully transmitted to cherry (Prunus avium cv. Bing), to seedling Mazzard rootstock (P. avium), and to Mahaleb rootstock (P. mahaleb) but not to rooted cuttings of Colt rootstock (P. avium × P. pseudocerasus). CLAY-W infection produced a characteristic pitting symptom in the woody cylinder of susceptible cultivars. Its presence was confirmed by enzyme-linked immunosorbent assay in extracts prepared from symptomatic leaves or bark tissues

A Trifolium ambiguum plant growing in a field plot displayed a faint mottle typical of symptoms of virus infection in forage legumes. Sap inoculation to a series of herbaceous test plants indicated the presence of a virus. Preparations of crude sap examined in an electron microscope showed the presence of isometric particles. The virus was partially characterized and was identified as tomato ringspot virus (TomRSV) by gel double-diffusion serological tests. T. ambiguum has been proposed as a source of resistance to the common legume viruses(.)

A pathogenesis-related (PR) protein, immunologically related to the 21-kDa Pinto bean PR-4d protein, was induced in 20 plant species from six dicotyledonous families after infection with tobacco ringspot virus. This protein was also induced in lima bean plants upon treatment with mercuric chloride, 2-chloroethylphosphonic acid, and benzoic acid. PR-4d protein was present in most plant species that developed necrotic symptoms, but there was no correlation between its induction and the types of symptoms produced. The Pinto bean PR-4d and Samsun NN tobacco PR-5 proteins were reciprocally immunoreactive (...)

Factors associated with honeybees that facilitate the spread of pollen-borne blueberry leaf mottle nepovirus (BBLMV) to highbush blueberries were examined. These factors included the longevity of infectious BBLMV in the honeybee colony and in-hive pollen transfer within and between colonies. Blueberry leaf mottle virus remained infectious for at least 10 days within colonies of the honeybee, which is the primary pollinator. Flowering blueberry plants were caged for various periods with colonies of honeybees derived from a blueberry farm where a high percentage of bushes were infected by BBLMV (...)

(...) Analysis of virion proteins by sodium dodecyl sulfate polyacrylamide gel electrophoresis showed a single viral protein with a relative mass (M r ) of about 53,000. Nucleic acids of virus particles analyzed under denaturing conditions by horizontal agarose gel electrophoresis consisted of two ssRNA bands of M r 2.2×10 6 and 2.6×10 6 , for RNA-2 and RNA-1, respectively. Ultrastructural examination of infected plants revealed cytopathic effects characteristic of nepoviruses. This virus is closely related serologically to the elm and the birch strains of cherry leaf roll virus and will be referred to as the Euonymus strain of cherry leaf roll virus

In southeastern Pennsylvania, tomato ringspot virus (TmRSV) and tobacco ringspot virus (TbRSV) were detected by ELISA both individually and together in declining Cascade grapevines and in symptomless vines adjacent to infected ones but not in other symptomless vines in one vineyard. In a survey of randomly selected grapevines (Vitis spp.) from 12 other vineyards in southeastern Pennsylvania, TmRSV and TbRSV were detected in one and 11 of 60 Seyval and one and two of 35 Chancellor vines, respectively (.)

Monoclonal antibodies were made to an apple isolate of tomato ringspot virus (TmRSV-A) by fusion of splenocytes from immunized mice with NS-1 myeloma cells. Most IgG class monoclonal antibodies reacted strongly with homologous antigen in direct or indirect ELISA. The reactivity of most IgM class monoclonal antibodies was considerably less. Both rabbit and mouse polyclonal antibodies to TmRSV-A generally reacted better than the monoclonal antibodies. Most of the monoclonal antibodies that reacted strongly with TmRSV-A also reacted strongly with isolates of TmRSV from blueberry, geranium, peach, and cymbidium orchid but not with the Chickadee strain of TmRSV (...)

Etude du niveau d'infestation par le virus de la tache annulaire de la tomate, dans la region de culture du pecher du nord-ouest de la Virginie occidentale. Test de l'efficacite du test ELISA dans la detection du virus sur pecher