Search

International audience; Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Besides, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries, while the most prevalent virus was NSPaV, followed by PaLV. An analysis of the genetic diversity of these viruses was also conducted. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed either in graft-inoculated GF305 indicators, or in different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution and prevalence of peach-infecting luteoviruses, and suggest these viruses are likely asymptomatic in peach under most circumstances.

Mite-borne viruses belonging to the genus Allexivirus (family Alphaflexiviridae) commonly occur on garlic in many parts of the world. There are usually asymptomatic and cause small damage to the plants, but often occur in mixed infection with potyviruses and carlaviruses, with synergistic effects reducing crop quality and leading to higher losses (Taglienti et al. 2017). Their occurrence on Tunisian garlic crops was studied here in the same garlic germplasm collection mentioned in a previous first report (Ayed et al. 2019). Leaf samples from a total of 66 garlic accessions were tested by DAS-ELISA using specific antibodies (DSMZ, Germany) against garlic virus A (GarV-A), garlic virus B (GarV-B) and garlic virus C (GarV-C). These serological tests showed individual virus incidence of respectively 56.4%, 67.7% and 10%. Our findings corroborate with the results of Chodorska et al (2012). In order to confirm the presence of these viruses, RT-PCR assays were performed using total RNAs extracted using two silica-capture extraction procedures according to Foissac et al (2005) and specific primers targeting the coat protein genes of the various viruses. These primers, designed for the present study are (GarV-A-F: 5' YCTYTTCTCHYTDGCHTGGACYTG 3' and GarV-A-R: 5' RCCYTTCCTAGACCARTTRGCRGG 3' for GarV-A; GarV-B-F: 5' TGGGCYTGYTACCACAAYGGATC 3' and GarV-B-R 5' TCTGCGCGVGTGGADACCATRTT 3' for GarV-B; GarV-C-F: 5' ARGAYCTYTTYTCMCTYGCRTGGGC 3' and GarV-C-R: 5' GGAGGYTCRTGAATYTGTTGTTG 3' for GarV-C). The viruses were detected by a two-step RT-PCR as described by Marais et al (2015). PCRs consisted of one cycle at 95 °C for 5 min; followed by 40 cycles of denaturation at 95 °C for 45 s, annealing at 45 °C for 45 s, and elongation at 72 °C for 45s; and a final extension step at 72 °C for 10 min. Products of the expected size (214 bp for GarV-A, 363 bp for GarV-B and 439 bp for GarV-C) were amplified from 58 (88%), 47 (71%) and 56 (85%) accessions, respectively. Forty three samples (65%) were co-infected by the three viruses. Higher numbers of positives revealed by RT-PCR especially in the case of GarV-C may reflect the higher sensitivity and efficiency of this technique compared to ELISA. Direct sequencing of selected amplicons of the expected size obtained for GarV-A, -B, and -C Tunisian isolates was performed and the sequences submitted to GenBank, validating the specificity of the three RT-PCR assays. The two sequenced GarV-A isolates (MK599147 and MN995836) shared 98% nucleotide (nt) sequence identity with each other, and 93-94% identity with the closest isolate in GenBank, the "G118" isolate from China (MN059320). The three sequenced GarV-B isolates (MN995829 to MN995831) shared 88-98% nt identity with each other. For "GarV-B 18.1" (MN995830) and "GarV-B 36.2" (MN995831) the closest isolate was "1109.1" (JX682828) from Spain (92-93% nt identity). For "GarVB 17.2" (MN995829), the closest isolate was "B-Sp-3" (LC97167) from Spain (90% nt identity). The sequenced GarV-C isolate (MN995834) showed the highest sequence nt identity (93%) with the "GarV-9" isolate (HQ724848) from Spain. To our knowledge this is the first report of the presence of GarV-A, -B and -C in Tunisia. The presence of these allexiviruses may pose a threat to the preservation of the Tunisian garlic germplasm and, more broadly, to garlic production in Tunisia. For this reason, the scrupulous identification of viruses occurring in garlic plants will help to use the appropriate strategy to decrease viral incidence in garlic growing area.

International audience; An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000’s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses, tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV) and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus (STNV) was also frequently observed. Koch’s postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and cause the less severe symptoms. The emergence of this systemic disease may have been favoured by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.

International audience; Complete genomic sequences of Artichoke latent virus (ArLV) have been obtained by classical or high-throughput sequencing for an ArLV isolate from Italy (ITBr05) and for two isolates from France (FR37 and FR50). The genome is 8,278 to 8,291 nucleotides long and has a genomic organization comparable with that of Chinese yam necrotic mosaic virus (CYNMV), the only macluravirus fully sequenced to date. The cleavage sites of the viral polyprotein have been tentatively identified by comparison with CYNMV, confirming that macluraviruses are characterized by the absence of a P1 protein, a shorter and N-terminally truncated coat protein (CP). Sequence comparisons firmly place ArLV within the genus Macluravirus, and confirm previous results suggesting that Ranunculus latent virus (RALV), a previously described Macluravirus sp., is very closely related to ArLV. Serological relationships and comparisons of the CP gene and of the partial RaLV sequence available all indicate that RaLV should not be considered as a distinct species but as a strain of ArLV. The results obtained also suggest that the spectrum of currently used ArLV-specific molecular hybridization or polymerase chain reaction detection assays should be improved to cover all isolates and strains in the ArLV species.

Plum bark necrosis stem pitting-associated virus (PBNSPaV), the causal agent of plum bark necrosis stem pitting disease, belongs to the genus Ampelovirus in the family Closteroviridae. The complete genome sequence of PBNSPaV isolates from four Prunus sources was determined by pyrosequencing. All isolates showed the same genomic organization as the PBNSPaV reference isolate. The least divergent isolate, found in a peach tree from China, showed an overall 91.8% of nucleotide identity with the type isolate. Two closely related isolates, defining a second cluster of diversity, were found in two Japanese plum lines from France and showed only 82.8% identity with the type isolate. On the other hand, they were highly homologous with two recently described PBNSPaV divergent isolates from China. The fourth and most divergent isolate, from a Chinese peach, showed only 71.2% identity to other PBNSPaV isolates and was not detected by currently available PBNSPaV reverse-transcription polymerase chain reaction detection assays. Complete sequencing of the divergent isolates allowed the development of a more broad-spectrum detection test targeting a conserved region in the P61 gene. Taken together, these results indicate a much broader diversity of PBNSPaV than previously thought and provide for a more robust detection of this still poorly characterized pathogen.

An isolate of Lettuce mosaic virus (LMV, a Potyvirus) infecting Madagascar periwinckle (Catharanthus roseus) was identified and characterized by Illumina deep sequencing. LMV-Cr has no close affinities to previously sequenced LMV isolates and represents a novel, divergent LMV clade. Inoculation experiments with other representative LMV isolates showed that they are unable to infect C. roseus, which was not known to be a host for LMV. However, three C. roseus variants of one of these isolates, LMV-AF199, could be selected and partially or completely sequenced. These variants are characterized by the accumulation of mutations affecting the C-terminal part of the cylindrical inclusion (CI) helicase and the central part of the VPg. In particular, a serine to proline mutation at amino acid 143 of the VPg was observed in all three independently selected variants and is also present in the LMV-Cr isolate, making it a prime candidate as a host-range determinant. Other mutations at VPg positions 65 and 144 could also contribute to the ability to infect C. roseus. Inoculation experiments involving a recombinant LMV expressing a permissive lettuce eukaryotic translation initiation factor 4E (eIF4E) suggest that eIF4E does not contribute to the interaction of most LMV isolates with C. roseus.

Publication Inra prise en compte dans l'analyse bibliométrique des publications scientifiques mondiales sur les Fruits, les Légumes et la Pomme de terre. Période 2000-2012. http://prodinra.inra.fr/record/256699; International audience; Five tomato mutants affected in the Rx-mediated resistance against Potato virus X (PVX) were identified by screening a mutagenized population derived from a transgenic, Rx1-expressing 'Micro-Tom' line. Contrary to their parental line, they failed to develop lethal systemic necrosis upon infection with the virulent PVX-KH2 isolate. Sequence analysis and quantitative reverse-transcription polymerase chain reaction experiments indicated that the mutants are not affected in the Rx1 transgene or in the Hsp90, RanGap1 and RanGap2, Rar1 and Sgt1 genes. Inoculation with the PVX-CP4 avirulent isolate demonstrated that the Rx1 resistance was still effective in the mutants. In contrast, the virulent PVX-KH2 isolate accumulation was readily detectable in all mutants, which could further be separated in two groups depending on their ability to restrict the accumulation of PVX-RR, a mutant affected at two key positions for Rx1 elicitor activity. Finally, transient expression of the viral capsid protein elicitor indicated that the various mutants have retained the ability to mount an Rx1-mediated hypersensitive response. Taken together, the results obtained are consistent with a modification of the specificity or intensity of the Rx1-mediated response. The five Micro-Tom mutants should provide very valuable resources for the identification of novel tomato genes affecting the functioning of the Rx gene.

UMR BFP - Equipe Virologie; International audience; Nectarines (Prunus persica) are among the most popular stone fruits grown in Italy. In particular, the Campania region produces an average of 80.000 tons of fresh fruits per year. In 2014, a survey was conducted in Eboli (Salerno province) in a five years old nectarine (cv. Gartairo) orchard in which about 30% of the trees showed an intense pitting of the fruit surface. Leaves, branches and trunk were symptomless while the intensity of the pitting tended to increase with fruit ripeness. The fruit mesocarp was not altered, nor were the flavour and taste of the fruits. To investigate the possible etiology of the disease, a symptomatic sample was analyzed by high-throughput sequencing (HTS). Double-stranded RNAs (dsRNAs) were purified by CF11 cellulose chromatography as previously described (Candresse et al., 2013) from 2-3 mm thick epicarp peel collected from a ripe fruit. The cDNA libraries were generated with the SuperScript II reverse transcriptase (Invitrogen), PCR amplified and sequenced on the Miseq Illumina platform using a 2x250bp paired-end sequencing strategy. Raw data were trimmed and cleaned by removing adaptor sequences generating a total of 1,999,750 high quality reads that were de-novo assembled with CLC Genomic Workbench 9.0, generating a total of 1663 contings. These contigs were annotated by BlastN and BlastX searches against the GenBank database, revealing the presence of several viral agents already reported as stone-fruit pathogens: Hop stunt viroid (HSVd), Apple chlorotic leaf spot virus (ACLSV) and Cherry green ring mottle virus (CGRMV). In addition, two contigs (of respectively 648 and 510 bp, totaling 0.025% of trimmed reads) showing 97% nt identity with the corresponding sequence of Peach-associated Luteovirus (PaLV) (KY635988) were also observed. To confirm the presence of PaLV and fill the sequence gap between the two contigs, total RNA was extracted and used in a RT-PCR experiment carried out with specific primers (Fw 5’ GAAACGGTAAGTCGACGGACATCGCG 3’; Rev 5’ GGAGGTTACACTGACAAGACAATGGA 3’) designed from the ends of the contigs. A PCR product of the expected size (672 pb) was obtained, purified and directly sequenced, showing 96% nt identity with the PaLV corresponding sequence. The sequence of the completed scaffold (1,609 nt), integrating the HTS data and the sequence of the 451 nt gap determined from the PCR product has been deposited in Genbank (accession number MF990276). To our knowledge, this is the first report of PaLV infecting a stone fruit tree in Italy. Members of genus Luteovirus are aphid-transmitted and phloem-limited viruses that have been recently reported to infect nectarine (Bag et al., 2015), cherry (Lenz et al., 2016) and peach (Wu et al., 2017; Igori et al., 2017). Attempts to detect PaLV in other symptomatic nectarine trees of the same orchard by RT-PCR failed, thus indicating that the virus is most probably not associated with the symptoms. Given their very recent discovery, a lot of information on the biology, symptomatology, distribution and prevalence of fruit tree-infecting luteoviruses is still missing. Further efforts to understand these agents and their potential significance are needed in order to reach scientifically-motivated decisions as to the need to control them or to exclude them from Prunus propagation materials.

Twelve Arabidopsis accessions were challenged with Plum pox potyvirus (PPV) isolates representative of the four PPV strains. Each accession supported local and systemic infection by at least some of the PPV isolates, but high variability was observed in the behavior of the five PPV isolates or the 12 Arabidopsis accessions. Resistance to local infection or long-distance movement occurred in about 40% of all the accession-isolate combinations analyzed. Except for Nd-1, all accessions showed resistance to local infection by PPV-SoC; in the Landsberg erecta (Ler) accession, this resistance was compromised by sgt1 and rar1 mutations, suggesting that it could be controlled by an R gene-mediated resistance pathway. While most of the susceptible accessions were symptomless, PPV induced severe symptoms on inflorescences in C24, Ler, and Bay-0 as early as 15 days after inoculation. Genetic analyses indicated that these interaction phenotypes are controlled by different genetic systems. The restriction of long-distance movement of PPV-El Amar and of another member of genus Potyvirus, Lettuce mosaic virus, in Col-0 requires the RTM genes, indicating for the first time that the RTM system may provide a broad range, potyvirus-specific protection against systemic infection. The restriction to PPVPS long-distance movement in Cvi-1 is controlled by a single recessive gene, designated rpv1, which was mapped to chromosome 1. The nuclear inclusion polymerase b-capsid protein region of the viral genome appears to be responsible for the ability of PPV-R to overcome rpv1-mediated resistance.

UMR BFP - Equipe Virologie; First report of [i]American plum line pattern virus[/i] infecting flowering cherry ([i]Prunus serrulata Lindl.[/i]) in Japan

BFP - Equipe Virologie; First Report of Little cherry virus 1 Infecting Apricot in the Czech Republic

Nectarine stem pitting-associated virus (NSPaV) is a recently described member of the genus Luteovirus in the family Luteoviridae on which very limited information is available. Initially described in the United States on post-quarantine imported nectarine (Prunus persica) trees (Bag et al. 2015), it was later detected on peach and nectarine plants from California (Villamor et al. 2016). Although it was initially described as tentatively associated with severe stem-pitting symptoms (Bag et al. 2015), NSPaV association with disease remains uncertain because it has been detected in some symptomless trees (Villamor et al. 2016). During a survey in 2015, five Japanese apricot (P. mume) samples collected in Japan and showing various virus-like symptoms such as discolorations and spotting on their leaves were individually analyzed by Illumina deep sequencing of cDNA libraries prepared from purified double-stranded RNAs (Candresse et al. 2013). Analysis of the sequence data showed that in one sample, collected in a park in Morioka, seven contigs showed high nucleotide identity values (90 to 98%) with the closely related NSPaV sequences available in GenBank (accession nos. KP638562, KT273409, and KT273410). These contigs totaled 3.4 kb or about 68% of NSPaV genome (NC_027211; Bag et al. 2015) and corresponded to about 0.37% of the total sequencing reads obtained for the sample. The presence of NSPaV in the sample was confirmed by RT-PCR using the NSPaV-F mod 5′-AGACTMAAATTCAATGARAAGA-3′ and NSPaV-R 5′-TTTCACAAATGATAACACAAT-3′ primer pair modified from Bag et al. (2015). The expected 460-bp fragment, corresponding to positions 1646 to 2106 of the genome (RdRp gene), was obtained and, upon direct sequencing (KX853093), shown to share 96.2 to 96.7% nucleotide identity with the NSPaV isolates present in GenBank. To the best of our knowledge, this is the first report of NSPaV presence in Japan and in P. mume, extending the information on both its host range and geographical distribution. The analysis of the high-throughput sequence data obtained on the NSPaV-infected sample showed it to be also infected by Asian prunus virus 1 and thus, no clear conclusion can be drawn on whether NSPaV may be responsible for any specific symptoms in P. mume.

The RNA genome of a resistance-breaking isolate of Lettuce mosaic virus (LMV-E) was engineered to express the jellyfish green fluorescent protein (GFP) or β-glucuronidase (GUS) fused to the helper-component proteinase (HC-Pro) to study LMV invasion and spread in susceptible and resistant lettuce cultivars. Virus accumulation and movement were monitored by either histochemical GUS assays or detection of GFP fluorescence under UV light. The GFP- and GUS-tagged viruses spread systemically in the susceptible lettuce cultivars Trocadero and Vanguard, where they induced attenuated symptoms, compared with the wild-type virus. Accumulation of the GFP-tagged virus was reduced but less affected than in the case of the GUS-tagged virus. Systemic movement of both recombinant viruses was very severely affected in Vanguard 75, a lettuce cultivar nearly isogenic to Vanguard but carrying the resistance gene mo12. Accumulation of the recombinant viruses in systemically infected leaves was either undetectable (GUS-tag) or erratic, strongly delayed, and inhibited by as much as 90% (GFP-tag). As a consequence, and contrary to the parental virus, the recombinant viruses were not able to overcome the protection afforded by the mo12gene. Taken together, these results indicate that GUS or GFP tagging of the HC-Pro of LMV has significant negative effects on the biology of the virus, abolishing its resistance-breaking properties and reducing its pathogenicity in susceptible cultivars.

Described for the first time in Chrysanthemum indicum in the United States, Chrysanthemum stunt viroid (CSVd) was reported to naturally infect species in the Asteraceae family (1,3), as well a few hosts in other families. In May 2010 in a nursery in southwest France, the occurrence of stunted A. frutescens plantlets of cv. Butterfly showing yellow deformed leaves with terminal necrosis, which resembled the growth reduction, flower distortion or leaf necrosis symptoms reported for CSVd in Argyranthemum spp. (3), was reported. Mother plants from which the plantlets originated were asymptomatic. Reverse transcription (RT)-PCR with universal pospiviroid primers Pospi1-FW/RE (4) was performed on five symptomatic plants. A fragment of expected size (197 bp) was obtained in all cases. Viroid infection was confirmed by RT-PCR with two sets of primers: Vid-FW/RE using a 59°C annealing temperature instead of the recommended 62°C (4) and Vir-plus/minus that allows the amplification of the full-length viroid genome (2). Sequences of the three different uncloned amplicons were determined and a 355-nt contig was assembled (GenBank No. JF938538). A BLAST analysis of this full-length sequence revealed 99% identity with CSVd isolates from Chrysanthemum from Korea and Germany (GenBank Accession Nos. AF394452 and X16408). The Argyranthemum CSVd sequence differed from the Chrysanthemum ones by an A insertion at position 289 and substitutions (A to T) at positions 65 and 299. The insertion at position 289 is currently unique among CSVd sequences in GenBank. Thirty-five symptomless mother plants of A. frutescens cv. Butterfly were tested by PCR and all were shown to be infected. The difference in symptomatology observed between the mother plants and the commercial potting plants cannot be explained at this stage, but may reflect the different physiologies or growing conditions of the two kinds of plants, since these are known to affect CSVd symptoms in other hosts (1). To estimate the extent of CSVd contamination in A. frutescens, samples of 11 other cultivars originating from different nurseries were similarly analyzed. In addition to Butterfly, cvs. Sonnenstral, Maya Bofinger, Lili, Blanc Double, and Daisy Solenio were found to be infected by CSVd in the absence of clear symptomatology. The CSVd-free cultivars were Angelic Bordeaux, Dark Pink, Pink Delight, Angelic White, Dana, and Summer. The Pospi1-FW/RE amplicons from Blanc Double, Lili, and Daisy Solenio were identical to the Butterfly isolate sequence while the Maya Bofinger sequence showed one substitution (C to T) at position 256 and Sonnenstral had one substitution (T to A) at position 254. Although CSVd infection of Butterfly had been reported from Germany (3), to our knowledge, the results reported here represent the first report of CSVd in Argyranthemum for France and implicate a range of cultivars. CSVd being classified as a quarantine pest in Chrysanthemum spp. in the European Union, the finding of its significant prevalence in A. frutescens cultivars, frequently in the absence of clear symptomatology, raises the possibility that contaminated Argyranthemum may constitute a reservoir for future Chrysanthemum contamination. References: (1) I. Bouwnen and A. van Zaayen. Page 281 in: Viroids. Science Publishers, Enfield, NH, 2003. (2) T. Candresse et al. Plant Dis. 91:330, 2007. (3) W. Mentzel and E. Maiss. Z. Pflanzenk. Pfanzenschutz 107:548, 2000. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.