Search

Background: Wound healing is a restoration process of tissue integrity and function targeting reducing the healing time and complications with priority of available, acceptable and affordable medication. The study aimed to evaluate wound healing of aloe vera gel as raw or ethanol extract on a dorsal full thickness circular wound in Wistar rats. Rats subjected to the excision surgery were grouped into: control (+ ve), without treatment. and Kenacomb, aloe raw gel and aloe ethanol extract applied groups for 3, 7, 14 and 21 days for treatment evaluation. The study chromatographically quantified anthraquinones and identified the raw gel and extract' compounds. The evaluation was through the assessment of the wound contraction and complete blood count, serum interleukin-4 and skin tissue proline, hydroxyproline, glycine, malondialdehyde, nitric oxide contents and skin histopathology investigation at tested intervals. Results: Raw gel and extract contained in μg/ml, aloin A (9.23 and 17.22), aloin B (8.87 and 10.31) and emodin (11.66 and 12.66), respectively. The predominates identified percentage in raw gel were coumarins (34.93), fatty acids (28.45), phytosterols (7.77) and tocopherols (8.44) and in gel extract were phytosterols (49.39), fatty acids (29.16) and tocopherols (3.70). Results after 21 days were recorded in + ve control 80.50% wound contraction and showed significantly decreased values of IL-4, lymphocytes, Hb, RBCs and skin glycine, proline, hydroxyproline and NO. Neutrophils, monocytes, platelets and MDA were significantly increased. Histologically revealed epidermal acanthosis, inflammatory infiltration, fibrosis with hair follicles and sebaceous glands loss and dermal hemorrhage. Aloe raw gel revealed incomplete healing (91.79%) and failed to normalize IL-4, lymphocytes, neutrophils and the skin glycine and NO contents. Skin showed moderate epidermal acanthosis, and dermis had fibrosis, hemorrhage and loss of sebaceous glands and hair follicles. The extract group acquired 100% healing, normalized tested parameters and showed skin tissue thinning epidermis and intact dermal tissue with sebaceous glands and hair follicles. Conclusion: Results revealed aloe gel ethanol extract advantage over raw gel for wound healing which may be related to chemical constituents' variation interpreted in interest to the extract as an efficient therapeutic, cost-effective, available wound healing material. [ABSTRACT FROM AUTHOR]

Rabies remains a global health threat despite being preventable with post-exposure prophylaxis (PEP). This study assessed one-year humoral and T cell immunity in PEP recipients of the Insitut Pasteur du Cambodge (IPC) regimen, recommended by WHO. We analyzed rabies virus (RABV) neutralizing antibodies (nAbs) and T cell responses at baseline, 7 and 14 days, 6 and 12 months after PEP. A total of 148 patients were included, with 78 bitten by confirmed RABV-positive dogs receiving PEP and equine rabies immunoglobulins (eRIG), and 70 bitten by RABV-negative dogs receiving only PEP. Fourteen days after PEP, all but two individuals seroconverted for nAbs (≥ 0.5 IU/mL) with 87% maintaining this response even after 12 months. Interleukin-4 (IL-4) and interferon-gamma (IFN-γ)-secreting T cells were significantly elevated after 14 days and sustained for one year. No differences were observed between the RABV-exposed and -unexposed groups. This study demonstrates robust one-year immunity after IPC PEP. [ABSTRACT FROM AUTHOR]

Glioblastoma multiforme (GBM) is one of the most aggressive and deadly forms of brain cancer, which has a very complex tumor microenvironment (TME) promoting tumor growth, immune evasion, and resistance to therapy. The main players within this environment are represented by cytokines such as Interleukin-4, Interleukin-6, and Interleukin-13, along with the costimulatory molecule CD40. The paper draws back the curtain on the complex interactions played out by these molecules in contributing to the formation of a TME within GBM. IL-4 and IL-13 induce an immunosuppressive environment through the polarization of tumor-associated macrophages (TAMs) into a pro-tumoral M2 phenotype. In contrast, IL-6 takes part in the activation of the JAK–STAT3 pathway, enhancing survival and proliferation of tumor cells. In this context, CD40 either induces anti-tumor immunity through APC activation or facilitates tumors by angiogenesis and survival pathways. The synergistic actions of these molecules create feedback loops that keep up the malignancy of GBM and present a big problem for therapy. Knowledge of these interactions opens new ways for the development of multi-targeted therapeutic strategies at the other end. This may result in the interruption of the tumor-supportive environment in GBM, reducing tumor growth and improving patient outcomes by targeting IL-4, IL-6, IL-13, and CD40 simultaneously. [ABSTRACT FROM AUTHOR]

Allergic asthma is a chronic inflammatory disease characterized by airway inflammation and hyper-responsiveness. Silymarin is a natural compound recognized for its potential anti-inflammatory properties in various conditions, including asthma. In this study, we investigated the anti-inflammatory effects of silymarin on a mouse model of allergic asthma. Thirty-five mice were categorized into five groups (n = 7 per group). The normal control group received phosphate-buffered saline (PBS), while the remaining four groups were induced with allergic asthma using ovalbumin (OVA). One sensitized group was treated with PBS (Asthma/Baseline), another received beclomethasone, and two groups were administered silymarin (25 mg/kg and 50 mg/kg) intraperitoneally. Subsequently, we quantified the changes in inflammatory cell influx in bronchoalveolar lavage fluid (BALF) and the levels of interferon-γ (IFN-γ) and interleukin-4 (IL-4) in BALF and blood. Histopathological alterations of leukocytes were examined in the lung tissues of all animals. The results showed that silymarin reduced inflammatory cells, including eosinophils and lymphocytes, in the BALF. Additionally, the silymarin-treated groups exhibited decreased IL-4 levels and increased IFN-γ levels in the blood, surpassing the effects of beclomethasone. Furthermore, histopathological analysis demonstrated a significant decrease in leukocyte infiltration following silymarin treatment. Our findings demonstrate the anti-inflammatory effects of silymarin in allergic asthma, likely through the modulation of inflammatory cells. [ABSTRACT FROM AUTHOR]

Metastatic gastric cancer (GC) presents significant clinical challenges due to its poor prognosis and limited treatment options. To address this, we conducted a targeted protein biomarker discovery study to identify markers predictive of metastasis in advanced GC (AGC). Serum samples from 176 AGC patients (T stage 3 or higher) were analyzed using the Olink Proteomics Target panels. Patients were retrospectively categorized into nonmetastatic, metastatic, and recurrence groups, and differential protein expression was assessed. Machine learning and gene set enrichment analysis (GSEA) methods were applied to discover biomarkers and predict prognosis. Four proteins (MUC16, CAIX, 5'-NT, and CD8A) were significantly elevated in metastatic GC patients compared to the control group. Additionally, GSEA indicated that the response to interleukin-4 and hypoxia-related pathways were enriched in metastatic patients. Random forest classification and decision-tree modeling showed that MUC16 could be a predictive marker for metastasis in GC patients. Additionally, ELISA validation confirmed elevated MUC16 levels in metastatic patients. Notably, high MUC16 levels were independently associated with metastatic progression in T3 or higher GC. These findings suggest the potential of MUC16 as a clinically relevant biomarker for identifying GC patients at high risk of metastasis. [ABSTRACT FROM AUTHOR]

Neuroinflammation, a key pathological feature following subarachnoid hemorrhage (SAH), can be therapeutically targeted by inhibiting microglia M1 polarization and promoting phenotypic transformation to M2 microglia. Interleukin-4 (IL-4) is a pleiotropic cytokine known to its regulation of physiological functions of the central nervous system (CNS) and mediate neuroinflammatory processes. However, its specific role in neuroinflammation and microglia responses following SAH remains unexplored. In this investigation, we established both in vivo and in vitro SAH models and employed a comprehensive array of assessments, including ELISA, neurofunctional profiling, immunofluorescence staining, qRT-PCR, determination of phagocytic capacity, and RNA-Seq analyses. The findings demonstrate an elevated expression of IL-4 within cerebrospinal fluid (CSF) subsequent to SAH. Furthermore, exogenous administration of IL-4 ameliorates post-SAH neurofunctional deficits, attenuates cellular apoptosis, fosters M2 microglia phenotype conversion, and mitigates neuroinflammatory responses. The RNA-Seq analysis signifies that IL-4 governs the modulation of neuroinflammation in microglia within an in vitro SAH model through intricate cascades of signaling pathways, encompassing interactions between cytokines and cytokine receptors. These discoveries not only augment comprehension of the neuropathogenesis associated with post-SAH neuroinflammation but also present novel therapeutic targets for the management thereof. [ABSTRACT FROM AUTHOR]

Recently, scientists have focused on pro-inflammatory cytokines and immunological dysregulation in major depressive disorder (MDD). Some research suggests pro-inflammatory cytokines' role in MDD development, whereas anti-inflammatory studies are sparse. There is no systematic investigation of Bangladeshi MDD patients' pro- and anti-inflammatory cytokines. This study examines the blood levels of IL-12 and IL-4 in Bangladeshi patients and healthy controls (HCs) to determine the diagnostic accuracy of these cytokines to identify MDD patients from those without MDD. A total of 110 people with MDD from the department of psychiatry of a teaching hospital in Dhaka and 107 HCs from Dhaka participated in this case–control study. Depression and illness severity were gauged using DSM-5 criteria and Ham-D scores. Commercially marketed ELISA kits were used in accordance with manufacturer guidelines to measure the levels of IL-12 and IL-4 in peripheral blood, allowing a comparison of the patient and control groups. In comparison to HCs, MDD patients (5333.00 ± 307.40 pg/ml) showed noticeably higher levels of IL-12 than in HCs (2331.00 ± 207.40 pg/ml). The increased levels were positively correlated with Ham-D scores (male: r = 0.351, p < 0.050; female: r = 0.389, p < 0.050), suggesting a possible relationship to disease progression. Additionally, compared to HCs (272.81 ± 23.94 pg/ml), MDD patients had significantly higher peripheral blood levels of IL-4 (876.35 ± 66.73 pg/ml) (p < 0.001). Also, there was a positive correlation between IL-4 serum levels and Ham-D scores (male: r = 0.361, p < 0.050; female: r = 0.398, p < 0.050). Therefore, we observed increased levels of these serum cytokines and their association with the severity of depression. The results of this study demonstrate the possibility of IL-12 and IL-4 blood levels as distinct markers capable of differentiating between MDD patients and HCs, possibly acting as markers of MDD susceptibility. To ascertain the diagnostic effectiveness of these two cytokines, more research is necessary. [ABSTRACT FROM AUTHOR]

Cryptosporidiosis is an intestinal infection that is triggered by the protozoan parasite Cryptosporidium spp. Cryptosporidium oocysts can spread from one host to another either through direct contact with infected hosts' faeces or through indirect means (consumption of contaminated water or food). Significant numbers of oocysts are produced as a result of the rapid growth of the parasite within the infected hosts. For proper care of cryptosporidiosis, a laboratory diagnosis is necessary. Therefore, this study aimed to produce anti-Cryptosporidium parvum (C. parvum) oocyst immunoglobulin (Ig)G polyclonal antibodies (pAbs). The produced pAbs were used in the detection of C. parvum oocysts antigens in stool and serum samples of infected calves. Moreover, pAbs were tested in protection of balb-c male mice from cryptosporidiosis infection. C. parvum oocysts were used in the preparation of antigens to be used in the immunization of New Zealand white rabbits. pAb was purified by ammonium sulphate precipitation method, caprylic acid purification method and diethylaminoethyl (DEAE) anion exchange chromatographic method. Sandwich enzyme-linked immunosorbent assay (ELISA) (using prepared pAb) scored higher sensitivity (85% and 95% for serum and stool samples) than that (80%) of microscopic examination of stool samples. Moreover, pAb significantly reduced the oocysts shedding, decreased inflammatory cytokines and enhanced the loss in the body weight of protected animals. The prepared pAb succeeded in the diagnosis of cryptosporidiosis in calves with high sensitivity either in the serum or stool samples. Our results indicated the usefulness of using the prepared pAb in protection against cryptosporidiosis. Key points: Importance of pAb in the diagnosis of cryptosporidiosis in calves. Protection of balb-c mice by anti-Cryptosporidium oocysts pAb. Sandwich ELISA has a higher sensitivity than microscopy. [ABSTRACT FROM AUTHOR]

Introduction: Interleukin-4 (IL-4) and interleukin-13 (IL-13) are two essential cytokines involved in the T helper 2 (Th2)-mediated inflammatory response to diseases, such as atopic dermatitis (AD). AK120 is a humanized immunoglobulin G subclass 4 (IgG4) monoclonal antibody (mAb) directed against the IL-4 receptor alpha (IL-4Rα) subunit shared by the IL-4 and IL-13 receptor complexes. This mAb inhibits the signaling of the IL-4 and IL-13 cytokines. Methods: The study consisted of two parts. Part 1 was a single ascending dose (SAD) study with five cohorts (receiving 15, 50, 150, 300 or 600 mg of AK120, respectively) of healthy subjects; part 2 was a multiple ascending dose (MAD) study with four cohorts (receiving AK120 at doses of 300 mg once every 2 weeks [Q2W], 300 mg once weekly [QW], 150 mg QW or 75 mg QW) of subjects with AD. A total of 81 subjects (40 in part 1, 41 in part 2) were enrolled in the study. Results: The compound was safe and well tolerated in both a SAD up to 600 mg in healthy subjects and in a MAD from 75 to 600 mg in subjects with AD. The exposure of AK120 increased in an approximately dose-dependent manner upon subcutaneous dosing. The levels of the biomarkers serum thymus and activation-regulated chemokine ligand 17 (TARC/CCL17) and immunoglobulin E decreased from baseline after AK120 administration, indicating the inhibition of the IL-4/IL-13 signaling pathways. AK120 showed improved Eczema Area and Severity Index (EASI) scores, and the proportion of subjects with Investigator Global Assessment (IGA) score 0/1 increased after AK120 treatment. Conclusions: AK120 exhibited an acceptable safety profile in healthy and AD subjects, and showed preliminary efficacy. These findings support the continued investigation of AK120 for treating AD. Clinical Trial Registration: ClinicalTrials.gov identification number: NCT04256174. [ABSTRACT FROM AUTHOR]

Non-healing wounds have a negative impact on quality of life and account for many cases of amputation and even early death among patients. Diabetic patients are the predominate population affected by these non-healing wounds. Despite the significant clinical demand, treatment with biologics has not broadly impacted clinical care. Interleukin-4 (IL-4) is a potent modulator of the immune system, capable of skewing macrophages towards a pro-regeneration phenotype (M2) and promoting angiogenesis, but can be toxic after frequent administration and is limited by its short half-life and low bioavailability. Here, we demonstrate the design and characterization of an engineered recombinant interleukin-4 construct. We utilize this collagen-binding, serum albumin-fused IL-4 variant (CBD-SA-IL-4) delivered in a hyaluronic acid (HA)-based gel for localized application of IL-4 to dermal wounds in a type 2 diabetic mouse model known for poor healing as proof-of-concept for improved tissue repair. Our studies indicate that CBD-SA-IL-4 is retained within the wound and can modulate the wound microenvironment through induction of M2 macrophages and angiogenesis. CBD-SA-IL-4 treatment significantly accelerated wound healing compared to native IL-4 and HA vehicle treatment without inducing systemic side effects. This CBD-SA-IL-4 construct can address the underlying immune dysfunction present in the non-healing wound, leading to more effective tissue healing in the clinic. [ABSTRACT FROM AUTHOR]

Introduction: Dupilumab is a drug that inhibits the action of interleukin (IL)-4 and IL-13 and is a potent therapeutic drug for allergic diseases such as atopic dermatitis. Although its use has been associated with significant ocular adverse drug reactions (ADRs), the IL-4 and IL-13 inhibition may also have favorable therapeutic effects. The aim of this study was to determine the disease spectrum in which the use of dupilumab may have been associated with an increase or decrease of ocular ADRs. Methods: We searched the World Health Organization's VigiBase for ADRs associated with the use of dupilumab for data up to 12 June 2022. The number of all ADRs that were retrieved was compared with the number of ocular ADRs associated with the use of dupilumab. Disproportionate reporting was assessed by calculating the information component (IC) values and odds ratios. Results: Since the introduction of dupilumab, 100,267 ADRs have been reported. Of all the ADRs associated with dupilumab, 28,522 ADRs were ocular complications, and it ranked fourth in the ocular complications by organ level. By assessments of the IC for age ≤ 44 years, the most significantly associated ADRs were dry eye followed by blepharitis including eyelid crusting and dryness and conjunctivitis. Crusting and dryness of the eyelids were the most significant ADRs for all age groups. Other ocular ADRs reported include meibomian gland dysfunction, keratitis, glaucoma, and retinal disorders. In contrast, periorbital edema, neuro-ophthalmic disorders, optic neuritis, and macular edema were significantly reduced by the use of dupilumab. Conclusions: Dupilumab-related ADRs included an increase or decrease of various ocular disorders. The results indicate that dupilumab also has potential therapeutic effects. [ABSTRACT FROM AUTHOR]

Abstract Pathogen‐induced inflammation comprises pro‐ and anti‐inflammatory processes, which ensure pathogen removal and containment of the proinflammatory activities. Here, we aimed to identify the development of inflammatory microenvironments and their maintenance throughout the course of a toll‐like receptor 2‐mediated paw inflammation. Within 24 h after pathogen‐injection, the immune cells were organized in three zones, which comprised a pathogen‐containing “core‐region”, a bordering proinflammatory (PI)‐region and an outer anti‐inflammatory (AI)‐region. Eosinophils were present in all three inflammatory regions and adapted their cytokine profile according to their localization. Eosinophil depletion reduced IL‐4 levels and increased edema formation as well as mechanical and thermal hypersensitivities during resolution of inflammation. Also, in the absence of eosinophils PI‐ and AI‐regions could not be determined anymore, neutrophil numbers increased, and efferocytosis as well as M2‐macrophage polarization were reduced. IL‐4 administration restored in eosinophil‐depleted mice PI‐ and AI‐regions, normalized neutrophil numbers, efferocytosis, M2‐macrophage polarization as well as resolution of zymosan‐induced hypersensitivity. In conclusion, IL‐4‐expressing eosinophils support the resolution of inflammation by enabling the development of an anti‐inflammatory framework, which encloses proinflammatory regions.

Purpose: Accumulating evidence has elucidated that the interaction between cancer cells and M2 macrophages plays an important role in the tumorigenesis of hepatocellular carcinoma (HCC). However, the mechanism connecting tumor-derived exosomes, M2 polarization of macrophages, and liver metastasis remain unclear. Therefore, it is necessary to explore their influence on the tumor microenvironment of HCC. Methods: Transmission electron microscopy, nanometer particle testing, and special biomarker analysis were utilized to characterize exosomes, while the differential expression of microRNAs was evaluated using high-throughput sequencing technology. The functions of miR-200b-3p exosomes were confirmed using in vitro and in vivo assays. The interactions between microRNAs and ZEB1 as well as cancer cells and macrophages were measured using RNA pull-down and luciferase gene reporter assays. Results: Using in silico analysis, we identified high levels of miR-200b-3p exosome expression in patients with HCC, particularly with relapsed HCC. We demonstrated that HCC cell-derived miR-200b-3p exosomes were internalized by M0 macrophages and induced M2 polarization by downregulating ZEB1 and upregulating interleukin-4. As a result, the JAK/STAT signaling pathway was activated in M2 macrophages, leading to increased PIM1 and VEGFα expression. These cell factors accelerated the proliferation and metastasis of HCC, resulting in a feedback loop between HCC cells and M2 macrophages. Conclusion: The study illustrates that HCC cell-derived miR-200b-3p exosomes facilitate the proliferation and polarization of macrophages by modulating cytokine secretion and the JAK/STAT signaling pathway, leading to the metastasis of HCC. These findings demonstrate the existence of a novel feedback loop between cancer cells and immune cells in the tumor microenvironment, presenting a new concept in cancer research. [ABSTRACT FROM AUTHOR]

The rabbit VX2 bone tumor model is an ideal animal model for studying malignant bone tumors. Cytokines have been reported to play a role in tumor initiation and promotion, angiogenesis, and metastasis. However, few studies have investigated the relationship between cytokines and VX2 bone tumor development. This study investigated the effect of interferon-γ (IFN-γ) and interleukin-4 (IL-4) on proliferating cell nuclear antigen (PCNA) expression in tumor tissue. Thirty Japanese white rabbits were randomly divided into group A (n = 15) and group B (n = 15). The rabbit VX2 bone tumor model was constructed by implanting VX2 tumors on the medial side of the upper tibia. Group A was sacrificed in the first week of implantation, and group B in the second week of implantation. Peripheral venous blood, tumor tissue from the medullary cavity at the implantation site, and surrounding bone and soft tissue were harvested before implantation and execution in both experimental groups. IFN-γ and IL-4 expression levels in peripheral blood and PCNA levels in tumor tissues were measured by enzyme-linked immunosorbent assay (ELISA). The tumor tissue of the medullary cavity and surrounding bone and soft tissue was harvested for pathological examination. By the end of the experiment, 30 rabbits were included in the study. There was no significant difference in IFN-γ, IL-4 and PCNA expression levels in group A compared to group B before implantation (t = 1.187, p value = 0.255; t = 1.282, p value = 0.221; t = 0.499, p value = 0.626). IFN-γ and IL-4 expression levels before execution in group A were not significantly different from those before implantation (t = -1.280, p value = 0.213; t = 0.952, p value = 0.349), and PCNA expression levels were higher than those before implantation (t = 2.469, p value = 0.020). Group B had significantly lower IFN-γ expression levels before execution than before implantation (t = -3.741, p value = 0.001) and significantly higher IL-4 and PCNA expression levels before execution than before implantation (t = 6.279, p value < 0.01; t = 13.031, p value < 0.001). IFN-γ expression levels before execution in group B was significantly lower than those before execution in group A (t = 17.184, p value < 0.001), and IL-4 and PCNA expression before execution in group B was significantly higher than that before execution in group A (t = -26.235, p value < 0.001; t = -24.619, p value < 0.001). The correlation between IFN-γ and PCNA levels before execution in groups A and B was negative (r = -0.566, p value = 0.028; r = -0.604, p value = 0.017), and the correlation between IL-4 and PCNA levels was positive (r = 0.583, p value = 0.023; r = 0.884, p value < 0.001). In the rabbit VX2 bone tumor model, extending the period of time after tumor implantation resulted in a negative correlation between IFN-γ and PCNA levels and a positive correlation between IL-4 and PCNA levels. [ABSTRACT FROM AUTHOR]

Background: Hypereosinophilic dermatitis (HED) is a subtype of hypereosinophilic syndrome (HES). Glucocorticoids are preferred for treatment but carry substantial side effect profiles. Symptoms of HED may recur after systemic glucocorticoid tapering. As an interleukin-4 receptor (IL-4Rα) monoclonal antibody targeting interleukin-4 (IL-4) and interleukin-13 (IL-13), dupilumab might be an efficacious adjuvant therapy for HED. Method: We report a young male diagnosed with HED who suffered from erythematous papules with pruritus for over five years. Once reducing the dosage of glucocorticoid was, his skin lesions relapsed. Results: After using dupilumab, the patient's condition significantly improved with the glucocorticoid dosing decreased successfully. Conclusion: In conclusion, we report a new application of dupilumab in HED patients, especially with difficulties in reducing the glucocorticoid dose. [ABSTRACT FROM AUTHOR]

Physical and psychological stress modulates the hypothalamic pituitary adrenal (HPA) axis, and the redox and inflammatory systems. Impairments in these systems have been extensively reported in major depression (MD) patients. Therefore, our study aimed to investigate the effects of the intranasal administration of interleukin-4 (IL-4) in mice with depressive-like behavior induced by chronic unpredictable mild stress (CUMS) for 28 days. On the 28th day, mice received IL-4 intranasally (1 ng/mouse) or vehicle (sterile saline), and after 30 min, they were submitted to behavioral tests or euthanasia for blood collection and removal of the adrenal glands, axillary lymph nodes, spleen, thymus, prefrontal cortices (PFC), and hippocampi (HC). A single administration of IL-4 reversed CUMS-induced depression-like behavior in the tail suspension test and splash test, without evoking locomotor changes. IL-4 administration reduced the plasma levels of corticosterone and the increased weight of suprarenal glands in stressed mice. Moreover, IL-4 restored the expression of nuclear factor erythroid 2-related factor 2 (NRF2), nuclear factor kappa B (NF-kB), interleukin 1 beta (IL-1β), IL-4, brain derived neurotrophic factor (BDNF), and indoleamine 2,3-dioxygenase (IDO) in the PFC and HC and modulated oxidative stress markers in these brain structures in stressed mice. Our results showed for the first time the antidepressant-like effect of IL-4 through the modulation of neuroinflammation and oxidative stress. The potential effect of IL-4 administered intranasally arises as an innovative strategy for MD treatment. [ABSTRACT FROM AUTHOR]

Current approved therapies for acute ischemic stroke have a restricted therapeutic time window. Delayed recanalization, which has been utilized clinically in patients who have missed the time window for administration, may be a promising alternative for stroke patients. However, the underlying molecular mechanisms remain undiscovered. Herein, we hypothesized that delayed recanalization would increase M2 microglial polarization through the IL-4R (interleukin-4 receptor)/STAT6 (signal transducer and activators of transcription 6)/PPARγ (peroxisome proliferator–activated receptor γ) pathway, subsequently promoting stroke recovery in rats. The permanent middle cerebral artery occlusion (pMCAO) model was induced via intravascular filament insertion. Recanalization was induced by withdrawing the filament at 3 days after MCAO (rMCAO). Interleukin (IL)-4 was administered intranasally at 3 days after pMCAO. AS1517499, a specific STAT6 inhibitor, was administered intranasally at 3 days after MCAO induction. Immunofluorescence staining, enzyme-linked immunosorbent assay (ELISA), western blot analysis, volumetric measurements of brain infarct, and neurological behavior tests were conducted. Delayed recanalization at 3 days after MCAO increased the polarization of M2 microglia, decreased inflammation, and improved neurological behavior. IL-4 treatment administered on the 3rd day after pMCAO increased M2 microglial polarization, improved neurological behavior, and reduced infarction volume of pMCAO rats. The inhibition of STAT6 decreased the level of p-STAT6 and PPARγ in rats treated with delayed recanalization. Delayed recanalization improved neurological function by increasing microglial M2 polarization, possibly involved with the IL-4R/STAT6/PPARγ pathway after MCAO in rats. [ABSTRACT FROM AUTHOR]

Immune responses play a key role in the pathogenesis and progression of myeloproliferative neoplasms (MPN) and age-related macular degeneration (AMD). Recent studies suggested using MPNs as a "Human Inflammation Model" of drusen development and previous results showed interleukin-4 (IL-4) dysregulation in MPN and AMD. IL-4, IL-13 and IL-33 are all cytokines involved in the type 2 inflammatory response. This study investigated the cytokine levels of IL-4, IL-13 and IL-33 in serum of MPN and AMD patients. This cross-sectional study included 35 patients with MPN with drusen (MPNd) and 27 with MPN and normal retinas (MPNn), 28 patients with intermediate AMD (iAMD) and 29 with neovascular AMD (nAMD). With immunoassays, we quantified and compared levels of IL-4, IL-13 and IL-33 in serum between the groups. The study was conducted at Zealand University Hospital, Roskilde, Denmark, between July 2018 and November 2020. The serum levels of IL-4 were significantly higher in the MPNd group than in the MPNn group (p = 0.003). In regard to IL-33, the difference between MPNd and MPNn was not significant (p = 0.069), however, when subdivided into subgroups, a significant difference was found between polycythemia vera patients with drusen and those without drusen (p = 0.005). We found no IL-13 difference between the MPNd and MPNn groups. Our data didn't show any significant IL-4 or IL-13 serum level difference between the MPNd and iAMD groups but in regard to IL-33, data recorded a significant serum level difference between the two groups. There was no statistically significant difference between the MPNn, iAMD and nAMD groups in levels of IL-4, IL-13 and IL-33. These findings suggested that the serum levels of IL-4 and IL-33 might play a role in drusen development in MPN patients. The results might represent the type 2 inflammatory arm of the disease. The findings support the association between chronic inflammation and drusen. [ABSTRACT FROM AUTHOR]

Atopic dermatitis (AD) is a common chronic inflammatory skin condition that significantly impairs patients’ quality of life as a result of intense itching and persistent eczematous lesions. Although AD has a multifaceted etiology—including genetic predisposition, environmental triggers, barrier dysfunction, and dysregulated immune responses—interleukin-4 (IL-4) has a recognized central role in its pathogenesis. This narrative review explores the role of IL-4 in the pathophysiology of AD, its contribution to the atopic march, and the therapeutic impact of IL-4 inhibition. IL-4 plays a critical role in skin barrier dysfunction, dysbiosis, pruritus, and inflammation, all of which contribute to the debilitating symptoms of AD. Moreover, IL-4 is implicated in other atopic conditions, such as asthma, allergic rhinitis, and food allergies, underscoring its role beyond AD and its importance in the atopic march. Recent advances in targeted therapies, particularly IL-4/IL-13 signaling inhibitors, have changed AD management. Dupilumab, an IL-4 receptor antagonist, has demonstrated significant efficacy in reducing AD symptoms and enhancing patient outcomes in both children and adults. In addition to symptomatic relief, suppressing IL-4 signaling may also offer potential for disease modification, altering AD’s progression and possibly preventing the onset of other atopic conditions. This review highlights the crucial role of IL-4 as a therapeutic target in AD. By understanding the role of IL-4 in AD pathogenesis and exploring the therapeutic implications of targeting IL-4 pathways, this work can contribute to guide future research concerning treatment approaches and also emphasize the need for early and targeted interventions to mitigate disease impact and ultimately improve patient quality of life. [ABSTRACT FROM AUTHOR]

Pathogen‐induced inflammation comprises pro‐ and anti‐inflammatory processes, which ensure pathogen removal and containment of the proinflammatory activities. Here, we aimed to identify the development of inflammatory microenvironments and their maintenance throughout the course of a toll‐like receptor 2‐mediated paw inflammation. Within 24 h after pathogen‐injection, the immune cells were organized in three zones, which comprised a pathogen‐containing "core‐region", a bordering proinflammatory (PI)‐region and an outer anti‐inflammatory (AI)‐region. Eosinophils were present in all three inflammatory regions and adapted their cytokine profile according to their localization. Eosinophil depletion reduced IL‐4 levels and increased edema formation as well as mechanical and thermal hypersensitivities during resolution of inflammation. Also, in the absence of eosinophils PI‐ and AI‐regions could not be determined anymore, neutrophil numbers increased, and efferocytosis as well as M2‐macrophage polarization were reduced. IL‐4 administration restored in eosinophil‐depleted mice PI‐ and AI‐regions, normalized neutrophil numbers, efferocytosis, M2‐macrophage polarization as well as resolution of zymosan‐induced hypersensitivity. In conclusion, IL‐4‐expressing eosinophils support the resolution of inflammation by enabling the development of an anti‐inflammatory framework, which encloses proinflammatory regions. Synopsis: Multiplex immunohistochemistry identified a regional architecture in TLR‐type 2 inflammation, which comprised the pathogen‐containing core region, a surrounding pro‐inflammatory region, and an outer anti‐inflammatory region. Once established, the regions were stable throughout the course of inflammation. Eosinophils were found in all three regions and adapted their cytokine profile to their specific microenvironments.Depletion of eosinophils destroyed the regional structure outside of the core region.Depletion of eosinophils increased neutrophil recruitment, edema formation and thermal hypersensitivity.IL‐4 application rescued the regional structure and allowed a normal immune response in eosinophil‐depleted mice. [ABSTRACT FROM AUTHOR]

Immune cell function can be altered by lipids in circulation, a process potentially relevant to lipid-associated inflammatory diseases including atherosclerosis and rheumatoid arthritis. To gain further insight in the molecular changes involved, we here perform a transcriptome-wide association analysis of blood triglycerides, HDL cholesterol, and LDL cholesterol in 3229 individuals, followed by a systematic bidirectional Mendelian randomization analysis to assess the direction of effects and control for pleiotropy. Triglycerides are found to induce transcriptional changes in 55 genes and HDL cholesterol in 5 genes. The function and cell-specific expression pattern of these genes implies that triglycerides downregulate both cellular lipid metabolism and, unexpectedly, allergic response. Indeed, a Mendelian randomization approach based on GWAS summary statistics indicates that several of these genes, including interleukin-4 (IL4) and IgE receptors (FCER1A, MS4A2), affect the incidence of allergic diseases. Our findings highlight the interplay between triglycerides and immune cells in allergic disease. Circulating lipids can influence immune cell function, which could have implications for inflammatory diseases such as rheumatoid arthritis. Here, the authors use Mendelian randomization to identify genes whose expression is influenced by triglyceride levels in blood, implicating genes involved in lipid metabolism and allergic response. [ABSTRACT FROM AUTHOR]

Barth syndrome (BTHS) is a rare X-linked genetic disease caused by mutations in TAFAZZIN. The tafazzin (Taz) protein is a cardiolipin remodeling enzyme required for maintaining mitochondrial function. Patients with BTHS exhibit impaired mitochondrial respiratory chain and metabolic function and are susceptible to serious infections. B lymphocytes (B cells) play a vital role in humoral immunity required to eradicate circulating antigens from pathogens. Intact mitochondrial respiration is required for proper B-cell function. We investigated whether Taz deficiency in mouse B cells altered their response to activation by anti-cluster of differentiation 40 (anti-CD40) + interleukin-4 (IL-4). B cells were isolated from 3–4-month-old wild type (WT) or tafazzin knockdown (TazKD) mice and were stimulated with anti-CD40 + IL-4 for 24 h and cellular bioenergetics, surface marker expression, proliferation, antibody production, and proteasome and immunoproteasome activities determined. TazKD B cells exhibited reduced mRNA expression of Taz, lowered levels of cardiolipin, and impairment in both oxidative phosphorylation and glycolysis compared to WT B cells. In addition, anti-CD40 + IL-4 stimulated TazKD B cells expressed lower levels of the immunogenic surface markers, cluster of differentiation 86 (CD86) and cluster of differentiation 69 (CD69), exhibited a lower proliferation rate, reduced production of immunoglobulin M and immunoglobulin G, and reduced proteasome and immunoproteasome proteolytic activities compared to WT B cells stimulated with anti-CD40 + IL-4. The results indicate that Taz is required to support T-cell-dependent signaling activation of mouse B cells. [ABSTRACT FROM AUTHOR]

As the SARS-CoV-2 pandemic evolves, vaccine evaluation needs to include consideration of both durability and cross-reactivity. This report expands on previously reported results from a Phase 1 trial of an AS03-adjuvanted, plant-based coronavirus-like particle (CoVLP) displaying the spike (S) glycoprotein of the ancestral SARS-CoV-2 virus in healthy adults (NCT04450004). Humoral and cellular responses against the ancestral strain were evaluated 6 months post-second dose (D201) as secondary outcomes. Independent of dose, all vaccinated individuals retain binding antibodies, and ~95% retain neutralizing antibodies (NAb). Interferon gamma and interleukin-4 responses remain detectable in ~94% and ~92% of vaccinees respectively. In post-hoc analyses, variant-specific (Alpha, Beta, Delta, Gamma and Omicron) NAb were assessed at D42 and D201. Using a live virus neutralization assay, broad cross-reactivity is detectable against all variants at D42. At D201, cross-reactive antibodies are detectable in almost all participants against Alpha, Gamma and Delta variants (94%) and the Beta variant (83%) and in a smaller proportion against Omicron (44%). Results are similar with the pseudovirion assay. These data suggest that two doses of 3.75 µg CoVLP+AS03 elicit a durable and cross-reactive response that persists for at least 6 months post-vaccination. Here, the authors report results from a Phase 1 trial with an AS03-adjuvanted, plant-based virus-like particle displaying the spike protein of the ancestral SARS-CoV-2. Six months post-second dose, they observe good neutralizing antibody titers and T cell responses to ancestral virus and variants of concern in participants. [ABSTRACT FROM AUTHOR]

Rationale: Neuroinflammation can be alleviated via M2 microglia polarization, which could promote the recovery of perimenopausal depression. Astragalin (AST) possesses anti-neuroinflammatory activity. However, the effects of AST on perimenopausal depression and the molecular mechanism in regulating microglia polarization remained unknown. Objectives: The purpose was to investigate the effects of AST on mice with simulated perimenopausal depression through regulating microglia polarization. It was aimed to clarify the molecular mechanism related to the interleukin-4 receptor (IL-4R)/janus kinase (JAK) 1/signal transducer and activator of transcription (STAT) 6 signaling pathway. Methods: The ovariectomy (OVX)/chronic unpredictable mild stress (CUMS)-induced murine model of perimenopausal depression was established and treated with AST. Then the depression-like behaviors and cognitive ability of mice were examined. After that, we detected the markers of microglia polarization and its regulatory signals. In addition, lipopolysaccharides (LPS)/adenosine triphosphate (ATP)-induced inflammatory BV2 model were used to verify the potential molecular mechanism. Results: AST alleviated perimenopausal depression-like behaviors and memory deficits. AST alleviated microglia activation and increased Ki67-positive cells in dentate gyrus (DG). The viability of BV2 decreased by LPS/ATP was raised by AST. Moreover, both in vivo and in vitro, AST switched microglia from M1 phenotype caused by OVX/CUMS or LPS/ATP to M2 phenotype. The IL-4R/JAK1/STAT6 signaling was restored, and the levels of inducible nitric oxide synthase (iNOS), nuclear NF-KappaB-p65 were reduced by AST. Importantly, AST showed prevention against the ubiquitination modification and degradation of STAT6. Conclusions: Our results revealed new insights into molecular mechanism associated with microglia polarization in the effect of AST on the mouse model of perimenopausal depression. [ABSTRACT FROM AUTHOR]

Accumulating evidences suggest that M2 macrophages are involved with repair processes in the nervous system. However, whether M2 macrophages can promote axon regeneration by directly stimulating axons nor its precise molecular mechanism remains elusive. Here, the current study demonstrated that typical M2 macrophages, which were generated by IL4 simulation, had the capacity to stimulate axonal growth by their direct effect on axons and that the graft of IL4 stimulated macrophages into the region of Wallerian degeneration enhanced axon regeneration and improved functional recovery after PNI. Importantly, uPA (urokinase plasminogen activator)-uPA receptor (uPAR) was identified as the central axis underlying the axon regeneration effect of IL4 stimulated macrophages. IL4 stimulated macrophages secreted uPA, and its inhibition abolished their axon regeneration effect. Injured but not intact axons expressed uPAR to be sensitive to uPA. These results unveil a cellular and molecular mechanism underlying the macrophage related axon regeneration and provide a basis of a novel therapy for PNI. [ABSTRACT FROM AUTHOR]

Chronic low back pain (CLBP) is a common symptom of lumbar degenerative disease. Degeneration of the lumbar paravertebral muscles causes a loss of muscle mass and strength, which is a vital factor causing CLBP and often accompanied by lipid infiltration. Tandem mass spectrometry (TMT) was used to identify differentially expressed proteins in lipid-infiltrated and normal muscles. The results show that fatty acid binding protein 4 (FABP4) participated in the peroxisome proliferator-activated receptor-γ (PPAR γ) signaling pathway as an up-regulated protein, which is related to lipogenesis in diverse cells. In addition, chronic inflammation is believed to be involved in lumbar muscle degeneration and lipogenesis, with interleukin-4 (IL-4) considered as the predominant contributor. In present study, we investigate the effect of FABP4 on lipogenesis in human skeletal muscle cells (HSMCs) stimulated by Interleukin-4 (IL-4) and explore the mechanistic basis. We found expression level of FABP4 in lipid-infiltrated muscles was significantly higher than that in normal muscles. Lipogenesis in HSMCs could be increased by IL-4 treatment, as well as by FABP4 overexpression. FABP4 inhibition suppressed IL-4-mediated lipogenesis in HSMCs, whereas the PPAR γ inhibitor alleviated lipogenesis in both IL-4-treated and FABP4-overexpressed HSMCs. Collectively, the results indicate that FABP4 induces lipogenesis in HSMCs stimulated with IL-4 via activating the PPAR γ signaling pathway. Our study offers a detailed perspective on the pathogenesis of muscle lipid infiltration and provides a potential target for the clinical treatment strategy of muscle lipid infiltration and CLBP. [ABSTRACT FROM AUTHOR]

Among the new biological therapies for atopic diseases, dupilumab is a fully human monoclonal antibody directed against IL-4Rα, the common chain of interleukin-4 and interleukin-13 receptors. Dupilumab showed clinical improvements in patients with atopic dermatitis, asthma, and chronic rhinosinusitis and is currently under development for other indications. While dupilumab is considered to be well tolerated, a number of recent publications have reported various adverse events. This review aims to summarize the current knowledge about these adverse events, which may help clinicians to improve the follow-up of patients on dupilumab. Injection-site reactions are the most common reported adverse event. However, dupilumab has also been shown to cause ophthalmic complications (e.g., dry eyes, conjunctivitis, blepharitis, keratitis, and ocular pruritus), head and neck dermatitis, onset of psoriatic lesions, progression of cutaneous T-cell lymphoma exacerbation, alopecia areata, hypereosinophilia, and arthritis. Most are managed during dupilumab treatment continuation, but some (e.g., severe conjunctivitis) may result in a discontinuation of treatment. Their molecular origin is unclear and requires further investigations. Among other hypothesis, it has been suggested that T helper (Th)2-mediated pathway inhibition may worsen Th1/Th17-dependent immune responses. An ophthalmological examination for the presence of potential predictive indicators of ophthalmic adverse events is recommended before initiation of dupilumab therapy. [ABSTRACT FROM AUTHOR]

Introduction: The comparative efficacy of targeted systemic therapies for moderate to severe atopic dermatitis (AD) has not been systematically assessed using recent phase 3 data. This network meta-analysis assesses the comparative efficacy of targeted systemic therapies without the addition of topical corticosteroids (TCS) and/or topical calcineurin inhibitors (TCI) in adults with moderate to severe AD. Methods: The systematic literature review searched through 17 May 2021 for phase 3/4 trials with upadacitinib, interleukin-4 (IL-4), interleukin-13 (IL-13), or JAK inhibitors compared with placebo or active intervention for adults and adolescents with moderate to severe AD with inadequate response to TCS/TCI or for whom TCS/TCI was medically inadvisable, without restrictions on year or region. Researchers assessed data using PRISMA guidelines. The proportion of patients achieving trial co-primary endpoints [Investigator Global Assessment (IGA) score of 0 or 1 (clear or almost clear) and reduction of ≥ 2 points from baseline; proportion of patients achieving Eczema Area and Severity Index (EASI) improvement ≥ 75% from baseline (EASI-75)]; EASI improvement ≥ 90% from baseline (EASI-90); and ≥ 4-point improvement on Pruritus Numerical Rating Scale from baseline (ΔNRS ≥ 4) were evaluated using Bayesian network meta-analysis. Results: Of 3415 initially identified records, network meta-analysis (NMA) ultimately included 6 records representing 9 unique studies. Two upadacitinib trials were also included. Eleven clinical trials including 6254 patients were analyzed. Upadacitinib 30 mg daily was the most efficacious therapy across all endpoints at the primary endpoint (week 12 or 16) and at earlier timepoints, followed by upadacitinib 15 mg daily and abrocitinib 200 mg daily. Discussion: Many factors need to be considered for treatment selection for AD. These findings can help healthcare providers when personalizing a patient's treatment. Conclusion: Upadacitinib 30 mg daily, upadacitinib 15 mg daily, and abrocitinib 200 mg daily may be the most efficacious targeted systemic therapies over 12–16 weeks of therapy in AD. [ABSTRACT FROM AUTHOR]

Lipoxin A4 (LXA4) has been shown to have anti-inflammatory activity, but its underlying molecular mechanisms are not clear. Herein, we investigated the potential role of LXA4 in macrophage polarization and elucidated its possible molecular mechanism. The RAW264.7 macrophage cell line was pretreated with LXA4 with or without lipopolysaccharides (LPSs) and interleukin-4 (IL-4). In cultured macrophages, LXA4 inhibited LPS-induced inflammatory polarization, thereby decreasing the release of proinflammatory cell factors (IL-1β, IL-6, TNF-α) and increasing the release of anti-inflammatory cytokines (IL-4 and IL-10). Notably, the inhibitory effect of LXA4 on inflammatory macrophage polarization was related to the downregulation of p-NF-κB p65 and IRF5 activity, which reduced the LPS-induced phenotypic and functional polarization of M1 macrophages via the FPR2/IRF5 signaling pathway. Moreover, LXA4 also induced the IL-4-induced polarization of M2 macrophages by promoting the FPR2/IRF4 signaling pathway. Therefore, LXA4 regulates M1/M2 polarization of macrophages via the FPR2–IRF pathway. [ABSTRACT FROM AUTHOR]

Coccidiosis is an intestinal parasitic disease that causes huge economic losses to the poultry industry globally. Eimeria tenella belonging to protozoon is the causative agent of cecal coccidiosis in chicken, and it causes enormous damage to poultry industry. The surface antigens (SAGs) of apicomplexan parasites have functions of attachment and invasion in host-parasite interaction. As a result of parasitic invasion, host immune response is triggered. However, the immunogenicity and potency of E. tenella surface antigen 6 and 15 (EtSAG 6 and 15), as vaccinal candidate antigen, remain largely unknown. Therefore, gene fragments of E. tenella EtSAG 6 and 15 were amplified and transformed to pET28a prokaryotic vector for recombinant protein expression. The pEGFP-N1 eukaryotic vectors with EtSAG 6 and 15 amplification fragments (pEGFP-N1-EtSAG 5 and 16) were transformed into 293 T cell line. The results of reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis revealed successful expressions of EtSAG 6 and 15 in Escherichia coli and 293 T cells. Subsequently, animal experiments of 49 cobb broilers were performed to evaluate immunoprotection of recombinant proteins and DNA vaccines derived from E. tenella EtSAG 5 and 16 with an immunizing dose of 100 μg, respectively. Chickens vaccinated with rEtSAG 6 protein, rEtSAG 15 protein, pEGFP-N1-EtSAG 6 plasmid, or pEGFP-N1-EtSAG 15 plasmid showed no significant increase in IFN-γor interleukin-4 (IL-4) level compared with control groups. Chickens vaccinated with protein rEtSAG 6, protein rEtSAG 15, pEGFP-N1-EtSAG 6 plasmid, or pEGFP-N1-EtSAG 15 exhibited higher weight gains, lower oocyst output, and lower mean lesion scores, compared with infection control group. Among the four immunized groups, plasmid EGFP-N1-EtSAG 6 (100 μg) group exhibited the highest anticoccidial index (ACI) value (150.20). Overall, plasmids EGFP-N1-EtSAG 6 and 15, as DNA vaccines, provided a more effective immunoprotection for chickens against E. tenella than protein rEtSAG 6 and protein rEtSAG 15 as subunit vaccines. EtSAG 6 and 15 are promising candidate antigen genes for developing coccidiosis vaccine. [ABSTRACT FROM AUTHOR]

Janus kinases (JAKs) are a family of non-receptor kinases that play a key role in cytokine signaling and their aberrant activities are associated with the pathogenesis of various immune diseases. The JAK1 isoform plays an essential role in the types 1 and II interferon signaling and elicits signals from the interleukin-2, interleukin-4, gp130, and class 2 receptor families. It is ubiquitously expressed in humans and its overexpression has been linked with autoimmune diseases such as myeloproliferative neoplasm. Although JAK1 inhibitors such as Tofacitinib have been approved for medical use, the low potency and off-target effects of these inhibitors have limited their use and calls for the development of novel JAK1 inhibitors. In this study, we used computational methods on a series of pyrrolopyridine derivatives to design new JAK1 inhibitors. Molecular docking and molecular dynamics simulation methods were used to study the protein-inhibitor interactions. 3D-quantitative structure–activity relationship models were developed and were used to predict the activity of newly designed compounds. Free energy calculation methods were used to study the binding affinity of the inhibitors with JAK1. Of the designed compounds, seventeen of the compounds showed a higher binding energy value than the most active compound in the dataset and at least six of the compounds showed higher binding energy value than the pan JAK inhibitor Tofacitinib. The findings made in this study could be utilized for the further development of JAK1 inhibitors. [ABSTRACT FROM AUTHOR]

Visceral obesity increases risk of cognitive decline in humans, but subcutaneous adiposity does not. Here, we report that beige adipocytes are indispensable for the neuroprotective and anti-inflammatory effects of subcutaneous fat. Mice lacking functional beige fat exhibit accelerated cognitive dysfunction and microglial activation with dietary obesity. Subcutaneous fat transplantation also protects against chronic obesity in wildtype mice via beige fat-dependent mechanisms. Beige adipocytes restore hippocampal synaptic plasticity following transplantation, and these effects require the anti-inflammatory cytokine interleukin-4 (IL4). After observing beige fat-mediated induction of IL4 in meningeal T-cells, we investigated the contributions of peripheral lymphocytes in donor fat. There was no sign of donor-derived lymphocyte trafficking between fat and brain, but recipient-derived lymphocytes were required for the effects of transplantation on cognition and microglial morphology. These findings indicate that beige adipocytes oppose obesity-induced cognitive impairment, with a potential role for IL4 in the relationship between beige fat and brain function. Visceral adiposity is a risk factor for cognitive decline, but subcutaneous adipose tissue (SAT) is not and may be protective. Here, the authors show that beige adipocytes are indispensable for the neuroprotective effects of SAT. Beige fat knockout mice were more susceptible to the neuroimmune and cognitive effects of obesity, and in normal mice, SAT transplants protected against chronic obesity via beige fat-dependent mechanisms. [ABSTRACT FROM AUTHOR]

The positron emission tomography probes 2-deoxy-2-[18F]fluoro-D-glucose ([18F]FDG) and 2-tert-butyl-4-chloro-5-{6-[2-(2-[18F]fluoroethoxy)-ethoxy]-pyridin-3-ylmethoxy}-2H-pyridazin-3-one ([18F]BCPP-EF) are designed to evaluate glycolysis and oxidative phosphorylation, respectively, and are both used to estimate neuronal activity. However, previous studies have shown a discrepancy in these probes' accumulation in the compromised region, possibly due to the presence of activated microglia acting like deleterious or neuroprotective phenotypes. Hence, we evaluated lipopolysaccharide (LPS)- and interleukin 4 (IL4)-stimulated microglial uptake of [14C]2DG and [18F]BCPP-EF to give a new insight into the hypothesis that different uptake of [18F]FDG and [18F]BCPP-EF can be ascribed to the different metabolic pathways activated during microglial activation. LPS or IL4 stimulation increased the proinflammatory or anti-inflammatory marker gene expression in microglial cells. In LPS-stimulated cells, [14C]2DG uptake and glycolysis related gene expression were elevated, and [18F]BCPP-EF uptake was reduced. In IL4-stimulated cells, [18F]BCPP-EF uptake was increased, and [14C]2DG uptake was decreased. The expression of genes involved in glycolysis and mitochondrial complex I subunits was not changed by IL4 stimulation. The uptake of [14C]2DG and [18F]BCPP-EF differs in LPS- and IL4-stimulated polarized microglial cells. The present results suggest that the in vivo accumulation of metabolic tracers [18F]FDG and [18F]BCPP-EF can be influenced by the different aspects of neuroinflammation. [ABSTRACT FROM AUTHOR]

Background: Interleukin-4 (IL-4) is a multifunctional cytokine; involved in the regulation of immune responses, as well as in the pathogenicity of many diseases, such as diabetes mellitus. Some researchers suggested that IL-4 protects the human pancreatic islet from cytotoxic damages, whereas others suggested some inhibitory actions of IL-4 on pancreatic islets. This study aimed to assess the role of IL-4 genotypes of intron 3 variable number of tandem repeats of the IL-4 gene in diabetic retinopathy and diabetic neuropathy in Sudanese patients with type 2 diabetes mellitus (T2DM). This case–control study was performed in a number of Khartoum state hospitals in Sudan. The study enrolled 181 Sudanese patients, 115 (57 females and 58 males) diagnosed with T2DM and 66 (29 females and 37 males) healthy persons who served as control subjects. Polymerase chain reaction was used for the analysis of IL-4, which was amplified using the following amplification sequence (forward primer: CACGACGTTGTAAAACGACTAGGCTGAAAGGGGGAAAGC; reverse primer: CTGTTCACCTCAACTGCTCC). Biochemical analyses for highly sensitive C- reactive protein (hs-CRP), glycated hemoglobin (HbA1c), fasting plasma glucose, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein were performed using a chemical analyzer. Results: The study showed that in the diabetic group, 49(42.6%) had diabetic retinopathy, whereas 7(6.1%) had diabetic neuropathy. The B1B1 genotype was found to be a higher risk factor for developing diabetic retinopathy than B2B2 [P = 0.028; Odds ratio (OR) = 1.381; 95% confidence interval (CI) 1.344–9.062], whereas the B1B2 genotype was found to be insignificantly associated with retinopathy (P = 0.357; OR = 1.570; 95% CI 0.654–3.887). Furthermore, hs-CRP and HbA1c were significantly increased in diabetic neuropathy with IL-4 B1B1 genotype. Conclusions: IL-4 gene polymorphisms can be good markers for the early identification of risk for diabetic retinopathy and neuropathy in Sudanese people. The hs-CRP and HbA1c in diabetic patients with IL-4 B1B1 genotype may be predisposition predictors of diabetic neuropathy. [ABSTRACT FROM AUTHOR]

New Onset Diabetes After Transplantation (NODAT) is a serious metabolic complication. While β-cell dysfunction is considered the main contributing factor in the development of NODAT, the precise pathogenesis is not well understood. Cytokines are thought to be involved in the inflammation of islet β-cells in diabetes; however, few studies have investigated this hypothesis in NODAT. A total of 309 kidney transplant recipients (KTRs) were included in this study. An association between kidney transplants, and the development of diabetes after transplant (NODAT) was investigated. Comparison was made between KTRs who develop diabetes (NODAT cases) or did not develop diabetes (control), using key cytokines, IL-6 G (− 174)C, macrophage mediator; IL-4 C (− 490)T, T helper (Th)-2 cytokine profile initiator; Th-1 cytokine profile initiator interferon-γ T (+ 874) A gene and TGF β1 C (+ 869) T gene polymorphisms were investigated. The genes were amplified using well-established polymerase chain reaction (PCR) techniques in our laboratory. Compared to the AA and AT genotypes of interferon gamma (IFNG), there was a strong association between the TT genotype of IFNG and NODAT kidney transplant recipients (KTRs) versus non-NODAT KTRs (p = 0.005). The AA genotype of IFNG was found to be predominant in the control group (p = 0.004). Also, significant variations of IL6 G (− 174) C, IL-4 C (− 590) T, interferon-γ T (+ 874) A gene and transforming growth factor β1 C (+ 869) T may contribute to NODAT. Our data is consistent with theTh-1/T-reg pathway of immunity. Further larger pan Arab studies are required to confirm our findings. [ABSTRACT FROM AUTHOR]

Kynurenine 3-monooxygenase (KMO) regulates the levels of neuroactive metabolites in the kynurenine pathway (KP), dysregulation of which is associated with Huntington's disease (HD) pathogenesis. KMO inhibition leads to increased levels of neuroprotective relative to neurotoxic metabolites, and has been found to ameliorate disease-relevant phenotypes in several HD models. Here, we crossed KMO knockout mice to R6/2 HD mice to examine the effect of KMO depletion in the brain and periphery. KP genes were dysregulated in peripheral tissues from R6/2 mice and KMO ablation normalised levels of a subset of these. KP metabolites were also assessed, and KMO depletion led to increased levels of neuroprotective kynurenic acid in brain and periphery, and dramatically reduced neurotoxic 3-hydroxykunurenine levels in striatum and cortex. Notably, the increased levels of pro-inflammatory cytokines TNFa, IL1β, IL4 and IL6 found in R6/2 plasma were normalised upon KMO deletion. Despite these improvements in KP dysregulation and peripheral inflammation, KMO ablation had no effect upon several behavioural phenotypes. Therefore, although genetic inhibition of KMO in R6/2 mice modulates several metabolic and inflammatory parameters, these do not translate to improvements in primary disease indicators—observations which will likely be relevant for other interventions targeted at peripheral inflammation in HD. [ABSTRACT FROM AUTHOR]

Tumor xenograft models can create a high capacity to study human tumors and discover efficient therapeutic approaches. Here, we aimed to develop the gamma-radiated immunosuppressed (GIS) mice as a new kind of tumor xenograft model for biomedical studies. First, 144 mice were divided into the control and treated groups exposed by a medical Cobalt-60 apparatus in 3, 4, and 5 Gy based on the system outputs. Then, 144 BALB/c mice were divided into four groups; healthy, xenograft, radiation, and radiation + xenograft groups. The animals in the xenograft and radiation + xenograft groups have subcutaneously received 3 × 106 MCF-7 cells 24 h post-radiation. On 3, 7, 14, and 21 days after cell injection, the animals were sacrificed. Then, the blood samples and the spleen and tumor tissues were removed for the cellular and molecular analyses. The whole-body gamma radiation had a high immunosuppressive effect on the BALB/c mice from 1 to 21 days post-radiation. The macroscopic and histopathological observations have proved that the created clusters' tumor structure resulted in the xenograft breast tumor. There was a significant increase in tumor size after cell injection until the end of the study. Except for Treg, the spleen level of CD4, CD8, CD19, and Ly6G was significantly decreased in Xen + Rad compared to the Xen alone group on 3 and 7 days. Unlike IL-4 and IL-10, the spleen level of TGF-β, INF-γ, IL-12, and IL-17 was considerably decreased in the Xen + Rad than the Xen alone group on 3 and 7 days. The spleen expressions of the VEGF, Ki67, and Bax/Bcl-2 ratio were dramatically increased in the Xen + Rad group compared to the Xen alone on 3, 7, 14, and 21 days. Our results could confirm a new tumor xenograft model via an efficient immune-suppressive potential of the whole-body gamma radiation in mice. [ABSTRACT FROM AUTHOR]

Neurons of the central nervous system (CNS) that project long axons into the spinal cord have a poor axon regenerative capacity compared to neurons of the peripheral nervous system. The corticospinal tract (CST) is particularly notorious for its poor regeneration. Because of this, traumatic spinal cord injury (SCI) is a devastating condition that remains as yet uncured. Based on our recent observations that direct neuronal interleukin-4 (IL-4) signaling leads to repair of axonal swellings and beneficial effects in neuroinflammation, we hypothesized that IL-4 acts directly on the CST. Here, we developed a tissue culture model for CST regeneration and found that IL-4 promoted new growth cone formation after axon transection. Most importantly, IL-4 directly increased the regenerative capacity of both murine and human CST axons, which corroborates its regenerative effects in CNS damage. Overall, these findings serve as proof-of-concept that our CST regeneration model is suitable for fast screening of new treatments for SCI. [ABSTRACT FROM AUTHOR]

Human paraoxonase-1 (PON1) is a hydrolytic enzyme related in the onset, establishment, and progression of inflammatory illnesses, including cardiovascular diseases (CVD). Therefore, the primary goal of this investigation was to determinate the influence of the PON1 gene polymorphism (Q192R) on prognostic biomarkers of CVD in women (n = 350) from San Luis Potosi, Mexico. For everyone enrolled, anthropometric, clinical, and biochemical measurements were acquired. Q192R polymorphism of the PON1 gene was assessed by real-time PCR using TaqMan probes. Also, quantification and/or calculation of suggested predictive CVD biomarkers were completed. The association between PON1(Q192R) polymorphism with clinical predictive CVD biomarkers was assessed using univariate and multivariate logistic regression models. Genotype PON1 (Q192R) frequencies were: 18%, 47% and 35% for QQ, QR, and RR, respectively. Besides, the frequency of the variant R allele was 0.58. Furthermore, robust significant associations were found between PON1 (Q192R) polymorphism with serum ADMA [OR (95% CI); 3.50 (1.20–5.00), p < 0.01]; FABP4 [2.50 (2.15–3.95), p < 0.01]; and miR-126 [1.50 (1.15–2.00), p < 0.01] levels after adjusting for probable confounders. Data found in this research strongly support the notion that proposes a crucial role of PON1 enzyme (Q192R polymorphism) as a genetic determinant in the CVD risk in Mexican women. [ABSTRACT FROM AUTHOR]

The method for assessing the level of nitric oxide (II) (NO) by voltammetric monitoring of nitrite ions was carried out on models M1 and M2 of polarized macrophages induced from monocytes of human peripheral blood with the addition of lipopolysaccharide (LPS) and interleukin-4 (IL-4), respectively. The model of induction of M1 and M2 macrophages was used in the work to achieve the corresponding shifts in the functional status of studied cells. Ethyl nitrite (EtONO) was used as a standard compound of nitrite ions for electrochemical measurements. Electrochemical determination of nitrite ions was performed by anodic linear sweep voltammetry in the first-order derivative mode (ALSV FOD) in Britton-Robinson (BR) buffer with pH 4.02 on carbon ink modified graphite electrode. EtONO calibrations were linear over a concentration range from 2 to 9 μmol L−1 with corresponding regression equation y = 0.768c − 0.048. Limit of detection (LOD) (S/N = 3) was 0.38 μmol L−1. The results of the study showed the fundamental possibility of using voltammetry to assess indirectly the production of nitric oxide by cells in supernatants of the monocytic macrophage lineage. The level of nitric oxide metabolites (nitrite ions) in supernatants was associated with the functional state of macrophages. [ABSTRACT FROM AUTHOR]

The nature of the early post-natal immune response in rodents appears to influence cardiac regeneration even though the underlying molecules remain poorly understood. Consistent with this idea, we show now significant changes in the expression of immune and cell movement gene pathways in heart samples from 1- and 7-day-old rats with ventricle resection. We then tested whether conditioned media from adult M2 anti-inflammatory macrophages target neonatal cardiac cells to a pro-regenerative like phenotype compared to the M1 pro-inflammatory macrophages. We found that M2 compared to M1 macrophage-conditioned media upregulates neonatal cardiomyocyte proliferation, suppresses myofibroblast-induced differentiation and stimulates endothelial cell tube formation. Using a cytokine array, we selected four candidate cytokine molecules uniquely expressed in M2 macrophage-conditioned media and showed that two of them (IL-4 and IL-6) induce endothelial cell proliferation whilst IL-4 promotes proliferation in neonatal cardiomyocytes and prevents myofibroblast-induced collagen type I secretion. Altogether, we provided evidence that adult M2 macrophage-conditioned media displays a paracrine beneficial pro-regenerative response in target cardiac cells and that IL-4 and IL-6 recapitulate, at least in part, these pleiotropic effects. Further characterization of macrophage immune phenotypes and their secreted molecules may give rise to novel therapeutic approaches for post-natal cardiac repair. [ABSTRACT FROM AUTHOR]

Exposure to pesticides such as rotenone is a risk factor for Parkinson's disease. Dopaminergic neurons are especially sensitive to the toxicity of compounds that inhibit the mitochondrial respiratory chain such as rotenone and 1-methyl-4-phenylpyridinium (MPP+). However, there is scarce information on their effects on glia. To evaluate whether these neurotoxicants affect the immune response of glia, primary mouse mixed glial and microglial cultures were treated with interleukin (IL) 4 in the absence and presence of MPP+ or rotenone. Using qRTPCR or western blot, we determined the expression of anti-inflammatory markers, the CD200R1 microglial receptor and its ligand CD200, and genes regulating glycolysis and oxidative metabolism. ATP and lactate levels were additionally determined as an index of cell metabolism. Microglial phagocytosis was also evaluated. MPP+ and rotenone clearly abrogated the IL4-induced expression of anti-inflammatory markers in mixed glial cultures. CD200 and CD200R1 expression and microglia phagocytosis were also affected by the neurotoxicants. Changes in the mRNA expression of the molecules regulating glycolysis and oxidative metabolism, as well as in ATP levels and lactate release suggested that metabolic reprogramming in response to MPP+ and rotenone differs between microglial and mixed glial cultures. These findings support the hypothesis that parkinsonian neurotoxicants may impair brain immune response altering glial cell metabolism. [ABSTRACT FROM AUTHOR]

An abdominal aortic aneurysm (AAA) is a relatively common, life-threatening disease prevalent in persons over the age of 65. In recent years, an increasing number of studies have suggested that pattern-recognition receptors (PRRs), including Toll-like receptors (TLRs), may serve as important regulators in the development of AAAs. In this study, we evaluated the TLR2 and TLR4 expression in the aortic wall and blood of patients with AAA. The TLR2 and TLR4 mRNA expression were significantly higher in the blood of patients with AAA than in the blood of healthy volunteers (p = 0.009 and p = 0.010, respectively). The expression of TLR2 and TLR4 transcripts was also higher in the blood compared with the aortic wall tissue of AAA patients (p = 0.001 for both). Higher TLR2 protein expression was observed in the aortic wall of AAA patients compared with the blood (p = 0.026). A significantly higher concentration of TNF-α and IL-4 in patients with AAA than in healthy volunteers (p < 0.001 for both) was noticed. This study suggests that TLR2 may play a role in the inflammatory response in the aorta, both locally and systemically, in patients with AAA. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Acupuncture & Tuina Science is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Exposure to chloromethylisothiazolinone/methylisothiazolinone (CMIT/MIT) has been associated with allergic contact dermatitis and occupational asthma. Despite this association however, no study has investigated the effects of CMIT/MIT exposure on the development of atopic dermatitis (AD). This study was conducted to investigate the influence of epicutaneous exposure to CMIT/MIT on AD in a mouse model and the underlying biological mechanisms. BALB/C mice were exposed to CMIT/MIT for 3 weeks and AD was developed using ovalbumin (OVA) epidermal sensitization. CMIT/MIT epicutaneous exposure in normal mice significantly enhanced AD-like phenotypes (e.g., transepidermal water loss, clinical score, total serum immunoglobulin E level and infiltration of inflammatory cells). In addition, CMIT/MIT exposure significantly augmented the mRNA expression level of T helper (Th) 2-related cytokines (thymic stromal lymphopoietin, interleukin (IL)-6 and IL-13), Th2 chemokine (chemokine (C-C motif) ligand 17) and the population of CD4+IL-4+ cells in the skin. Moreover, mice exposed to CMIT/MIT in the OVA challenge had greater AD-like phenotypes, higher IL-4 and IL-17A skin mRNA expression levels, and a larger population of CD4+IL-4+- and IL-17A+-producing cells in the skin-draining lymph nodes. Our current findings in a mouse model thus suggest that CMIT/MIT exposure may cause AD symptoms through the dysregulation of Th2/Th17-related immune responses. [ABSTRACT FROM AUTHOR]

Skin fibrosis, characterized by excessive fibroblast proliferation and extracellular matrix deposition in the dermis, is the histopathologic hallmark of dermatologic diseases such as systemic sclerosis, hypertrophic scars, and keloids. Effective anti-scarring therapeutics remain an unmet need, underscoring the complex pathophysiologic mechanisms of skin fibrosis. The Th2 cytokines interleukin (IL)-4 and IL-13 have been implicated as key mediators in the pathogenesis of fibroproliferative disorders. The goal of this article is to summarize the current understanding of the role of the IL-4/IL-13 axis in wound healing and skin fibrosis. We conducted a literature search to identify research studies investigating the roles of IL-4 and IL-13 in fibrotic skin diseases. While transforming growth factor-beta has long been regarded as the main driver of fibrotic processes, research into the cellular and molecular biology of wound healing has revealed other pathways that promote scar tissue formation. IL-4 and IL-13 are important mediators of skin fibrosis, supported by evidence from in vitro data, animal models of fibrosis, and clinical studies. Overactive signaling of the IL-4/IL-13 axis contributes to the initiation and perpetuation of fibrotic skin diseases. Further insights into the IL-4/IL-13 axis may reveal potential targets for the development of novel therapies that prevent or treat fibrotic skin diseases. [ABSTRACT FROM AUTHOR]

Obesity and latent inflammation can give rise to insulin resistance and type 2 diabetes. Here we established an insulin resistance model of osteoblasts to explore the restoration effect of anti-inflammatory interleukin-4 (IL-4) on insulin sensitivity and its mechanism. We found that IL-4 inhibited cell proliferation in a concentration- and time-dependent manner. Insulation resistance significantly reduced the phosphorylation levels of the insulin receptor substrate 1 (IRS1; Tyr612), Akt (Ser473), and AS160 (Ser318) proteins. The addition of IL-4 to the insulin resistance model led to a dose-dependent stimulation of the phosphorylation of IRS1, Akt, and AS160. IL-4 fully restored the activation of the insulin cascade in insulin-resistant cells at the concentration of 50 ng/ml. Additionally, IL-4 promoted the expression of IRS1 in a time-dependent manner. We conjecture that IL-4 restores insulin sensitivity in osteoblasts by upregulating the expression of IRS1. It was also found that IL-4 promoted the expression of osteoprotegerin depending on the time of exposure. This effect may play an important role in the regulation of the energy metabolism in the whole body. [ABSTRACT FROM AUTHOR]

Background: Tolerogenic dendritic cells (tDCs) are considered a novel therapeutic tool in treating autoimmune diseases, allergies, and transplantation reactions. Among numerous pharmacological immune modulators, dexamethasone (Dex) is known to induce potent tolerogenicity in DCs generated from human monocytes with granulocyte–macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL-4), and these cells (IL-4-DCs/Dex) are being appraised as a tDC-based platform in clinical settings. Interferon-α (IFNα) represents another powerful inducer of monocyte-derived DCs, which possess higher migratory activity and stability. However, the functions of IFN-DCs/Dex have not been sufficiently analyzed and there are no comparative studies of the tolerogenicity of IFN-DCs/Dex and IL-4-DCs/Dex. This study aimed to investigate the properties of IFN-DCs/Dex in comparison with IL-4-DCs/Dex. Results: DCs were obtained by cultivation of an adherent fraction of peripheral blood mononuclear cells (MNCs) in the presence of GM-CSF and IFNα or IL-4 with subsequent lipopolysaccharide-driven maturation. Dex (10−6 M) was added to the cultures at day 3. We showed that generation of IFN-DCs with Dex resulted in decrease in percentage of CD83+ and CD86+ DCs and increase in numbers of CD14+, B7-H1+, and Toll-like receptor 2 (TLR2+) DCs. Treatment with Dex downregulated pro-inflammatory cytokine production, reduced DC allostimulatory activity, and inhibited DC capacity to stimulate Th1/pro-inflammatory cytokine production, altogether evidencing the induction of a tolerogenic phenotype. As compared to IL-4-DCs/Dex, IFN-DCs/Dex were characterized by larger proportion of TLR2+ and CD14+ cells, higher production of IL-10 and lower TNFα/IL-10 ratio, more potent capacity to induce T cell anergy, and more efficiently skewed T cell cytokine balance towards Th2/anti‐inflammatory profile. Conclusions: The data obtained indicate that potent tDCs could be generated by treating IFN-DCs with dexamethasone. The tolerogenic properties of IFN-DCs/Dex are better than or at least equal to those of the IL-4-DCs/Dex, as assessed by in vitro phenotypic and functional assays, suggesting these cells as a new tolerogenic vaccine platform. [ABSTRACT FROM AUTHOR]

Multiple sclerosis (MS) is a neurodegenerative autoimmune disease, in which cytokines play a prominent role. Among these cytokines are interleukin-4 (IL-4) and IL-10, which have been demonstrated to be involved in immunopathogenesis of the disease. The present case-control study inspected the association between seven single nucleotide polymorphisms (SNPs) of IL4 (IL4-1098: rs2243248, IL4-590: rs2243250, and IL4-33: rs2070874), IL4RA (IL4RA+1902: rs1801275), and IL10 (IL10-1082: rs1800896, IL10-819: rs1800871, and IL10-592: rs1800872) genes and MS in Iraqi patients. Sixty-eight clinically definite relapsing-remitting MS Iraqi patients and 158 age- and gender-matched healthy control subjects were enrolled in the study. The SNPs were detected by the PCR-SSP (polymerase chain reaction-sequence specific primer) method. Results revealed that only IL4-1098, IL4-590, IL4-33, and IL10-592 SNP allele and/or genotype frequencies showed a significant variation between MS patients and control. At the haplotype level, the estimated frequency of TCC (IL4-1098-IL4-590-IL4-33) and GCC (IL10-1082-IL10-819-IL10-592) haplotypes was significantly increased in patients compared to control (TCC: 63.2 vs. 48.0%; odds ratio = 2.81; 95% confidence interval = 1.86–4.25; pc = 5.0 × 10-6; GCC 39.0 vs. 22.2%; odds ratio = 2.24; 95% confidence interval = 1.45–3.46; pc = 0.002). In conclusion, IL4 and IL10 genes harbor important SNPs that may confer MS susceptibility. In addition, their role in reducing the risk of disease is also suggested. However, the susceptibility of the investigated role can be better evaluated in terms of haplotype frequencies. [ABSTRACT FROM AUTHOR]

Rationale: Converging evidence suggests that neuroimmunity plays an important role in the pathophysiology of anxiety. Interleukin (IL)-4 is a key cytokine regulating neuroimmune functions in the central nervous system. More efficient anxiolytics with neuro-immune mechanisms are urgently needed. Objective: To determine whether 3′-deoxyadenosine (3′-dA) exerts an anxiolytic effect and to examine the role of IL-4 in the anxiolytic effect of 3′-dA in mice. Methods: We investigated the effects of 3′-dA on anxiety-like behaviors using elevated plus maze (EPM) or light-dark box (LDB) tests after 45 min or 5 days of treatment. Expression of IL-4, IL-10, IL-1β, TNF-α, and IL-6 in the prefrontal cortex (PFC) was detected by Western blot and/or double immunostaining. Intracerebroventricular injection of RIL-4Rα (an IL-4-specific inhibitor) and intraperitoneal injection of 3′-dA or imipramine were co-administered, followed by EPM test. Results: 3′-dA exhibited a stronger and faster anxiolytic effect than imipramine in behavioral tests. Furthermore, 3′-dA enhanced IL-4 expression after 45 min or 5 days, TNF-α and IL-1β expression decreased significantly after a 5-day treatment with 3′-dA, and IL-10 expression increased after a 5-day treatment with 3′-dA or imipramine in the PFC. IL-4 was expressed in neurons and in some astrocytes and microglia. IL-4 expression showed a strong positive correlation with reduced anxiety behaviors. RIL-4Rα completely blocked the anxiolytic effects induced by 3′-dA and imipramine. Conclusions: This study identifies a novel and common anxiolytic IL-4 signaling pathway and provides an innovative drug with a novel neuro-immune mechanism for treating anxiety disorder. [ABSTRACT FROM AUTHOR]