Search

Aim: To analyze efficacy of endoscopic lithotripsy combined with drug lithotripsy as compared with drug lithotripsy for the treatment of phytobezoars. Methods: We collected and evaluated case records of 165 patients with phytobezoars from 2014 to 2023. And we analyzed demographic and clinical characteristics, imaging features, endoscopic features, complications of phytobezoars, and compared efficacy between endoscopic lithotripsy combined with drug lithotripsy (Group A) and drug lithotripsy (sodium bicarbonate combined with proton pump inhibitor) (Group B). Results: The median age of patients with phytobezoars was 67.84 ± 4.286 years old. Abdominal pain was the most common symptom and peptic ulcers (67.5%) were the most common complication. Bezoar-induced ulcers were more frequent in the gastric angle. The success rate of phytobezoars vanishing in Group A and Group B were similar (92.3% vs. 85.1% within 48 h, 98.7% vs. 97.7% within a week), while the average hospitalization period, average hospitalization cost, second endoscopy rate, and average endoscopic operation time were significantly lower in patients in Group B than in Group A. Conclusion: Drug lithotripsy is the preferred effective and safe treatment option for phytobezoars. We advise that an endoscopy should be completed after 48 h for drug lithotripsy. [ABSTRACT FROM AUTHOR]

Background: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known.Aims: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy.Methods: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis.Results: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9).Conclusions: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight. [ABSTRACT FROM AUTHOR]

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

Small intestinal obstruction is a common complication of primary gastrointestinal cancer or metastatic cancers. Patients with this condition are often poor candidates for surgical bypasses, and placement of self-expanding metal stent (SEMS) can be technically challenging. In this study, we examined the feasibility of combined application of single-balloon enteroscope (SBE) and colonoscope for SEMS placement in patients with malignant small intestinal obstruction. Thirty-four patients were enrolled in this study, among which 22 patients received SEMS placement by using SBE and colonoscope, while the other 12 patients received conservative medical treatment. The patients were followed up for one year. Stent placement was technically feasible in 95.5% (21/22). Clinical improvement was achieved in 86.4% (19/22). For the 19 clinical success cases, the average time of benefits from a gastric outlet obstruction scoring system (GOOSS) increase ≥1 was 111.9±89.5 days. For the 12 patients receiving conservative medical treatment, no significant improvement in GOOSS score was observed. Moreover, a significant increase of Short-Form-36 health survey score was observed in the 19 patients at time of 30 days after stent placement. By Kaplan-Meier analysis, a significant survival improvement was observed in patients with successful SEMS placement, compared with patients receiving conservative medical treatment. Taken together, combined use of SBE and colonoscope makes endoscopic stent placement feasible in patients with malignant small intestinal obstruction, and patients can benefit from it in terms of prolonged survival and improved quality of life. [ABSTRACT FROM AUTHOR]