Search

Failure to achieve complete elimination of triple negative breast cancer (TNBC) stem cells after adjuvant therapy is associated with poor outcomes. Aldehyde dehydrogenase 1 (ALDH1) is a marker of breast cancer stem cells (BCSCs), and its enzymatic activity regulates tumor stemness. Identifying upstream targets to control ALDH+ cells may facilitate TNBC tumor suppression. Here, we show that KK-LC-1 determines the stemness of TNBC ALDH+ cells via binding with FAT1 and subsequently promoting its ubiquitination and degradation. This compromises the Hippo pathway and leads to nuclear translocation of YAP1 and ALDH1A1 transcription. These findings identify the KK-LC-1-FAT1-Hippo-ALDH1A1 pathway in TNBC ALDH+ cells as a therapeutic target. To reverse the malignancy due to KK-LC-1 expression, we employ a computational approach and discover Z839878730 (Z8) as an small-molecule inhibitor which may disrupt KK-LC-1 and FAT1 binding. We demonstrate that Z8 suppresses TNBC tumor growth via a mechanism that reactivates the Hippo pathway and decreases TNBC ALDH+ cell stemness and viability.

The existing medical imaging tools have a detection accuracy of 97% for peritoneal metastasis(PM) bigger than 0.5 cm, but only 29% for that smaller than 0.5 cm, the early detection of PM is still a difficult problem. This study is aiming at constructing a deep convolution neural network classifier based on meta-learning to predict PM.Peritoneal metastases are delineated on enhanced CT. The model is trained based on meta-learning, and features are extracted using multi-modal deep Convolutional Neural Network(CNN) with enhanced CT to classify PM. Besides, we evaluate the performance on the test dataset, and compare it with other PM prediction algorithm.The training datasets are consisted of 9574 images from 43 patients with PM and 67 patients without PM. The testing datasets are consisted of 1834 images from 21 testing patients. To increase the accuracy of the prediction, we combine the multi-modal inputs of plain scan phase, portal venous phase and arterial phase to build a meta-learning-based multi-modal PM predictor. The classifier shows an accuracy of 87.5% with Area Under Curve(AUC) of 0.877, sensitivity of 73.4%, specificity of 95.2% on the testing datasets. The performance is superior to routine PM classify based on logistic regression (AUC: 0.795), a deep learning method named ResNet3D (AUC: 0.827), and a domain generalization (DG) method named MADDG (AUC: 0.834).we proposed a novel training strategy based on meta-learning to improve the model's robustness to "unseen" samples. The experiments shows that our meta-learning-based multi-modal PM predicting classifier obtain more competitive results in synchronous PM prediction compared to existing algorithms and the model's improvements of generalization ability even with limited data.

Background Cancer/testis antigens (CTAs) participate in the regulation of malignant biological behaviors in breast cancer. However, the function and mechanism of KK-LC-1, a member of the CTA family, in breast cancer are still unclear. Methods Bioinformatic tools, immunohistochemistry, and western blotting were utilized to detect the expression of KK-LC-1 in breast cancer and to explore the prognostic effect of KK-LC-1 expression in breast cancer patients. Cell function assays, animal assays, and next-generation sequencing were utilized to explore the function and mechanism of KK-LC-1 in the malignant biological behaviors of triple-negative breast cancer. Small molecular compounds targeting KK-LC-1 were also screened and drug susceptibility testing was performed. Results KK-LC-1 was significantly highly expressed in triple-negative breast cancer tissues than in normal breast tissues. KK-LC-1 high expression was related to poor survival outcomes in patients with breast cancer. In vitro studies suggested that KK-LC-1 silencing can inhibit triple-negative breast cancer cell proliferation, invasion, migration, and scratch healing ability, increase cell apoptosis ratio, and arrest the cell cycle in the G0–G1 phase. In vivo studies have suggested that KK-LC-1 silencing decreases tumor weight and volume in nude mice. Results showed that KK-CL-1 can regulate the malignant biological behaviors of triple-negative breast cancer via the MAL2/MUC1-C/PI3K/AKT/mTOR pathway. The small-molecule compound Z839878730 had excellent KK-LC-1 targeting ability and cancer cell killing ability. The EC50 value was 9.7 μM for MDA-MB-231 cells and 13.67 µM for MDA-MB-468 cells. Besides, Z839878730 has little tumor-killing effect on human normal mammary epithelial cells MCF10A and can inhibit the malignant biological behaviors of triple-negative breast cancer cells by MAL2/MUC1-C/PI3K/AKT/mTOR pathway. Conclusions Our findings suggest that KK-LC-1 may serve as a novel therapeutic target for triple-negative breast cancer. Z839878730, which targets KK-LC-1, presents a new path for breast cancer clinical treatment.

Background Loss of G2-specific E3-like (G2E3) protein sensitizes tumor cells to chemotherapy. However, the role of G2E3 in breast cancer development and patient’s prognosis is unclear. Here, we explored the expression, prognostic significance, and regulatory pathway of G2E3 in breast cancer. Methods TCGA and UALCAN database were utilized to explore G2E3 expression in breast cancer and normal tissues and its expression in breast cancer based on clinicopathological characteristics, respectively. The Kaplan–Meier plotter database was utilized to determine the effect of G2E3 on the prognosis of breast cancer patients. RT-PCR was utilized to validate the G2E3 expression in cancerous and normal breast tissues. Immunohistochemistry analysis was utilized to validate the prognostic effect of G2E3 expression in breast cancer patients and the relationship between G2E3 expression and lymphocyte infiltration levels. Receiver operating characteristic (ROC) curves were also generated to validate the diagnostic value of G2E3 expression in recurrence/distant organ metastasis and death. The STRING database, DAVID database, and Sanger-box tools were utilized to perform GO functional, KEGG pathway enrichment, and GSEA analysis. The TISIDB database was utilized to determine the relationship between G2E3 expression and tumor immunity. Finally, CTD database was utilized to screen for potential therapeutic compounds that could reduce the G2E3 mRNA expression. Results TCGA data presented that G2E3 expression was higher in breast cancer tissues than in normal breast tissues. This result was further validated by RT-PCR (P = 0.003). The Kaplan–Meier plotter database suggested that patients with high G2E3 mRNA expression had significantly shorter RFS and OS than patients with low G2E3 mRNA expression. Immunohistochemistry analysis of 156 breast cancer clinical specimens also validated patients with G2E3-positive expression had a significantly shorter DFS and OS than patients with G2E3-negative expression. Thus, G2E3 expression was an independent prognostic predictor of DFS and OS. The G2E3-positive expression also has a high diagnostic value for recurrence/distant organ metastasis and death. GSEA analysis revealed that G2E3 might be enriched in the E2F, PI3K/AKT/mTOR signaling, DNA repair pathways, and other cancer-related signaling pathways. The TISIDB database showed that G2E3 expression was significantly negatively associated with lymphocyte infiltration. This result was further validated in clinical breast cancer samples (P = 0.048; R = −0.158). Using the CTD database, we found that (+)-JQ1 compound, 1,2-dimethylhydrazine, and other compounds may decrease the G2E3 mRNA expression. These compounds could serve as potential therapeutic compounds for the clinical treatment of breast cancer. Conclusions G2E3 expression was higher in breast cancer tissues than in normal tissues. G2E3-positive expression was related to a worse survival outcome in patients with breast cancer. Genes co-expressed with G2E3 may be enriched in the breast cancer-related signaling pathways. The G2E3 expression was significantly negatively associated with lymphocyte infiltration. G2E3 may serve as a novel prognostic biomarker and therapeutic target for breast cancer.

Nanoscale zero-valent iron (nZVI) supported on polymeric graphitic carbon nitride (CN) composite (nZVI@CN) was synthesized via liquid phase reduction method as peroxymonosulfate (PMS) activator, and had been achieved efficient degradation of paraxylene (PX) in this study. The physicochemical properties of nZVI@CN were characterized by X-ray diffraction, X-ray photoelectron spectroscopy, Fourier transform infrared spectrometer, Scanning electron microscopy and Brunauer–Emmett–Teller. The results indicated that catalyst prepared with 1:1 of nZVI and CN mass ration showed the best catalytic performance for the PX degradation. The removal efficiency of PX was 90.9% within 30 min treatment with the optimal reaction conditions (1 mM PMS, 0.1 g/L nZVI@CN, 20 mg/L PX and pH 6.86), and the mineralization rate measured by the removal of total organic carbon had reached 82.6%. Radical quenching and Electron paramagnetic resonance detection confirmed that sulfate and hydroxyl radicals generated by PMS activation were responsible for the degradation of PX, and sulfate radicals were the dominant active species. In addition, the possible reaction mechanism was proposed based on the experimental results. The nZVI@CN can not only be suitable for wide pH range (3–9) to effectively remove PX, but also has good stability and reusability. The removal efficiency of PX was higher than 60% in the fifth reuse experiment, which indicated that nZVI@CN was a stable PMS activator for efficiently PX removal in water.

TIGIT is a lymphocyte surface receptor, which is mainly expressed on the surface of CD8+T cells. The role of TIGIT in colorectal cancer and its expression pattern in colorectal cancer infiltrating lymphocytes are still controversial. This study aimed at identifying the function of TIGIT in colorectal cancer. Patients with colorectal cancer showed significantly higher TIGIT+CD8+T cell infiltration in tumor tissues, metastases compared with paired PBMC and normal tissues through flow cytometry. TIGIT+CD8+T cells showed an exhausted phenotype and expressed low levels of killer cytokines IFN-γ, IL-2, TNF-α. In addition, more inhibitory receptors such as PD-1, LAG-3, and TIM-3 were expressed on the surface of TIGIT+CD8+T cells. TGF-β1 could promote the expression of TIGIT and inhibit CD8+T cell function in vitro. Moreover, the accumulation of TIGIT+T cells in tumors was associated with advanced disease, predicted early recurrence, and reduced survival rates in colorectal cancer patients. Our results indicate that TIGIT can be a biological marker for the prognosis of colorectal cancer, and TIGIT can be used as a potential target for treatment.

The age-dependent decline in remyelination potential of the central nervous system during ageing is associated with a declined differentiation capacity of oligodendrocyte progenitor cells (OPCs). The molecular players that can enhance OPC differentiation or rejuvenate OPCs are unclear. Here we show that, in mouse OPCs, nuclear entry of SIRT2 is impaired and NAD+ levels are reduced during ageing. When we supplement β-nicotinamide mononucleotide (β-NMN), an NAD+ precursor, nuclear entry of SIRT2 in OPCs, OPC differentiation, and remyelination were rescued in aged animals. We show that the effects on myelination are mediated via the NAD+-SIRT2-H3K18Ac-ID4 axis, and SIRT2 is required for rejuvenating OPCs. Our results show that SIRT2 and NAD+ levels rescue the aged OPC differentiation potential to levels comparable to young age, providing potential targets to enhance remyelination during ageing.

Chitinases (Chi), an important resistance-related protein, act against fungal pathogens by catalyzing the fungal cell wall, whereas are involved in different biological pathways in grape. In this study, we found 42 Chi family genes in Vitis vinifera L. (VvChis) and evaluated their expression levels after Botrytis infection, stress hormones like ethylene (ETH) and methyl-jasmonate (MeJA), and abiotic stresses like salinity and temperature changes in ripened fruits. VvChis were categorized into five groups including A, B, C, D, and E belonged to glycoside hydrolase family 18 and 19 (GH18 and GH19) according to genes structure, which expression analysis showed distinct temporal and spatial expression patterns changed in different tissues and various development stages. Different responsive elements to biotic and abiotic stresses were determined in the promoter regions of VvChis, specially elicitor-responsive element that was conserved among all VvChis genes. The expression levels of VvChis in groups A, B, and E increased after Botrytis cinerea infection in leaves and berries. Meanwhile, VvChis in glycoside hydrolase family 18 (GH18) were up-regulated under MeJA and ETH treatment, although the induction of VvChis by low temperature was more significant than high temperature. The expression of VvChis was also positively correlated with the concentration of NaCl treatment. Furthermore, differential gene-overexpression of VvChi5, VvChi17, VvChi22, VvChi26, and VvChi31 in strawberry and tomato fruits demonstrated the involvement of various isoforms in resistance to Botrytis infection through antioxidant system and lignin accumulation, which led to a reduction of damage. Among different isoforms of VvChis, we confirmed the interaction of Chi17 with Metallothionein (MTL) as oxidative stress protection, which suggests VvChis can modulate oxidative stress during postharvest storage in ripened fruits.

Grape (Vitis vinifera L.), a commercial fruit crop, is profoundly sensitive to gibberellic acid (GA), however exogenous application can significantly induce seedless grape berries. Nevertheless, the underlying molecular mechanism of grape leafy cotyledon 1 (LEC1) on seedless induction remains intangible. Herein, the morphological changes of ‘Wink’ grape cultivar during berry development in response to GA treatments were recorded. To better comprehend the function of VvLEC1 in grape seedless berry induced by GA, the gene and protein sequence were determined by bioinformatics methods, of which motif elements analysis intimates the potential function in seed development. The expression level of VvLEC1 which was repressed by GA treatment, determined by RT PCR, exhibited highest up-regulation at four weeks after flowering in the seed. Furthermore, VvLEC1, a member of the nuclear factor Y subunit B (NF-YB-type) transcription factor, interacts with five proteins which belong to the NF-YC-type transcription factor by the prediction of protein interaction network, thus indicating their collective effects on the development of grape seed. Our research findings elucidate a novel molecular insight into the role of VvLEC1 responsive to GA in accentuating grapevine seed development, which is crucial for the molecular breeding of high-quality seedless grapes.

Circular RNAs (circRNAs) play a vital role in the occurrence and development of tumors, including gastric cancer (GC). However, there are still many circRNAs related to GC whose functions and molecular mechanisms remain undetermined. Herein, we discover circRNA RELL1, which has not been investigated in GC, and it is markedly downregulated in GC tissues, which is related with poor prognosis, more pronounced lymph node metastasis and poor TNM stage. After confirming the circular structure of circRELL1, we found that circRELL1 could block cell proliferation, invasion, migration, and anti-apoptosis in patients with GC by a series of in vivo and in vitro function-related studies. Further mechanism investigation demonstrated that circRELL1 could sponge miR-637 and indirectly unregulated the expression of EPHB3 via modulating autophagy activation in GC. Additionally, circRELL1 can be transmitted by exosomal communication, and exosomal circRELL1 suppressed the malignant behavior of GC in vivo and in vitro. Taken together, this study elucidates the suppressive roles of circRELL1/miR-637/EPHB3 axis through autophagy activation in GC progression, inspiring for further understanding of the underlying molecular mechanisms of GC and providing a promising novel diagnostic circulating biomarker and therapeutic target in GC.

Remarkable progress in ageing research has been achieved over the past decades. General perceptions and experimental evidence pinpoint that the decline of physical function often initiates by cell senescence and organ ageing. Epigenetic dynamics and immunometabolic reprogramming link to the alterations of cellular response to intrinsic and extrinsic stimuli, representing current hotspots as they not only (re-)shape the individual cell identity, but also involve in cell fate decision. This review focuses on the present findings and emerging concepts in epigenetic, inflammatory, and metabolic regulations and the consequences of the ageing process. Potential therapeutic interventions targeting cell senescence and regulatory mechanisms, using state-of-the-art techniques are also discussed.

The xylem sap of fruit trees ensures the survival during the dormant period, and its flow during the bleeding period is correlated with the start of a new life cycle. Though the simple exploration on ingredients in the sap was carried out in the early years, the specific life activities and physiology functions of the sap during bleeding period have not been reported yet and the bleeding period is still a fruit tree development period worthy of attention. In this study, the microbial community composition during bleeding period were revealed by metatranscriptome and transcriptomic data. For the first time, the microorganism genome and grape genome in xylem sap were analyzed on transcriptional level, based on which the main physiological functions of the sap were also determined. The genomic RNA in the sap was isolated and sequenced. Kyoto Encyclopedia of Gene and Genome (KEGG), Evolutionary genealogy of genes: Non-supervised Orthologous Groups (eggNOG) and Carbohydrate-Active enzymes Database (CAZy) functional annotation were used to analysis the function of micro-organisms in xylem sap. DEGs were analyzed by gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). The genes responsive to biotic and abiotic stresses were finally screened by transcriptome screening, stress data analysis and vitro validation experiments. The analysis exhibited 36,144,564 micro-related clean reads and 244,213 unigene. KEGG, eggNOG and CAZy functional annotation analysis indicated that signal transduction and material metabolism were the most important function of xylem sap. DEGs analysis were mainly about disease resistance, carbon source metabolism and hormone signal transduction, especially in P3 vs P1, enriched in the plant-pathogen interaction pathway. Analysis on grape genome information revealed xylem sap had little RNA with weak life activity. Metabolic pathways, biosynthesis of secondary metabolites, plant hormone signal transduction and plant-pathogen interaction were the four pathways with the largest number of enriched genes. Moreover, 16 genes responsive to biotic and abiotic stresses were screened out. Promoting plant growth and resisting pathogens were the most important function of xylem sap during the bleeding period, and the function of microbial community were closely related to microorganisms growth and disease resistance. The 16 stress-related genes might be used for the future grape resistance research.

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.

Insulin is a key regulator of metabolism and inflammation in the body. However, the mechanism of the anti-inflammatory effect of insulin is not fully understood. In the present study, we investigated the role of the class A1 scavenger receptor (SR-A1), a prototypic member of the pattern recognition receptor family, in the insulin-mediated suppression of inflammatory responses in macrophages. Our murine in vivo studies show that insulin can attenuate lipopolysaccharide (LPS)-induced endotoxemia in a SR-A1-dependent manner, and this was consistent with our in vitro results which demonstrate that the SR-A1 is necessary for insulin to antagonize the LPS-induced inflammatory responses in macrophages. The effect of SR-A1 on the anti-inflammatory action of insulin might be associated with the activation of the extracellular signal-regulated kinases (ERK) signaling pathway in macrophages. Insulin could inhibit macrophage polarization to a pro-inflammatory phenotype via the SR-A1/ERK cascade. Collectively, our results suggest that SR-A1 may be a pivotal element for the anti-inflammation effect of insulin in macrophages.

Background Circular RNAs (circRNAs) are a class of noncoding RNAs (ncRNAs) and can modulate gene expression by binding to miRNAs; further, circRNAs have been shown to participate in several pathological processes. However, the expression and biological function of circCUL2 in gastric cancer (GC) remains largely unknown. Methods circRNA microarrays and quantitative real-time PCR (qRT-PCR) were used to identify differentially expressed circRNAs in GC tissues and cell lines. circCUL2 knockdown and overexpression were performed to indicate the functional role of circCUL2 in vitro and in vivo. The expression and regulation of circCUL2, miR-142-3p and ROCK2 were evaluated using fluorescence in situ hybridization (FISH), dual-luciferase assays, RNA pull-down assays, RNA immunoprecipitation (RIP) and rescue experiments. Furthermore, the regulation of cisplatin sensitivity and autophagy by circCUL2/miR-142-3p/ROCK2 was demonstrated by cellular apoptosis assays, western blot, immunofluorescence and transmission electron microscopy analyses. Results The level of circCUL2, which is stable and cytoplasmically localized, was significantly reduced in GC tissues and cells. Overexpressed circCUL2 inhibited malignant transformation in vitro and tumorigenicity in vivo. In the AGS and SGC-7901 cell lines, circCUL2 sponged miR-142-3p to regulate ROCK2, thus modulating tumor progression. Furthermore, in the AGS/DDP and SGC-7901/DDP cell lines, circCUL2 regulated cisplatin sensitivity through miR-142-3p/ROCK2-mediated autophagy activation. Conclusion circCUL2 may function as a tumor suppressor and regulator of cisplatin sensitivity through miR-142-3p/ROCK2-mediated autophagy activation, which could be a key mechanism and therapeutic target for GC.

Microbial mutation breeding has been widely used because it is one of the most efficient and practical breeding strategies in the fermentation industry. However, different mutagenesis methods cause various degrees of DNA damage to individual microorganisms, which lead to diverse characteristics of the mutants. In this study, the effects of four different mutagenesis methods on the mutation breeding of Streptomyces avermitilis for improving avermectin B1a production were investigated with an optimized liquid microtiter plate (MTP) culture system. First, an effective and feasible MTP system for mutant strain screening was evaluated through the optimization of the oxygen transfer rate and rapid titer determination. Then, high energy carbon heavy ion irradiation, diethyl sulfate, ultraviolet- (UV) irradiation combined with lithium chloride, and sodium nitrite were used as the mutagens for mutation breeding, respectively. Results showed that carbon heavy ion irradiation had the advantages of possessing the highest positive mutation rate and mean-production of positive mutant strains in the first generation. Sodium nitrite treatment resulted in mutant strains with better inherited stability than the other three methods. Through the combined treatment of carbon heavy ion irradiation and sodium nitrite treatment, an inheritstable mutant S. avermitilis S-233 with high avermectin B1a production was successfully obtained. The fermentation verification in a 500-liter (L) bioreactor demonstrated that the avermectin B1a produced by mutant S. avermitilis S-233 reached 6818 μg/mL, which was 23.8% higher than that of parent strains.

This study examined the influence of welded depth and CuCl2 pretreated dowels on wood dowel welding. In untreated group without pretreatment (group A), test results indicated that welded depth 40 mm exhibited higher pullout resistance than the other welded depths. In the same welded depth of 30 mm, specimens with dowels immersed in CuCl2 solution for 30 min (group B) exhibited the highest pullout resistance than the other specimens. According to the failure behavior, the pullout resistance of group B was considered to be the maximum theory pullout resistance in the welded depth of 30 mm. Weibull distribution could be applied reasonably to analyze pullout resistance of different welded depth. The linear simulation and Eckelman formula could not fit the relation of pullout resistance and welded depth. While the nonlinear simulation of sine function could fit the relation accurately. Based on the Weibull distribution, 95% reliability pullout resistance was calculated. The nonlinear simulation of sine function also existed between 95% reliability pullout resistance and welded depth. The temperature difference of group A-30 and group B was tested to study the reason of different pullout resistance. Both of the two groups, the temperature of point 1 was the highest, and the point 3 was the lowest. The pullout resistance was affected significantly by the temperature of point 2 and 3. For point 1, 260 °C was an excessive temperature, while 224.3 °C was the better choice for welding in this study.

This study examined the mechanics and pyrolysis analyses of rotation welding with treated dowels. Test results indicated that welding specimens with dowels immersed in CuCl2 solution exhibited higher pullout resistance than untreated specimens. Scanning electron microscopy was used to observe and analyze the welding interface. Wood dowels immersed in CuCl2 solution provided more flowing molten polymer to obtain better connection than untreated wood dowels. Based on the chemical analyses of X-ray photoelectron spectroscopy, and thermogravimetric analyses, the hydrolysis of cellulose and hemicellulose was detected after immersion of the dowels in a CuCl2 solution. Pyrolysis of cellulose, hemicellulose and lignin occurred during the welding process. The hydrolysis of cellulose and hemicellulose may promote the pyrolysis and efficient connection of wood components during the welding process.

Background Major vault protein (MVP) is the major component of vault, a eukaryotic organelle involved in multiple cellular processes, and is important in multiple cellular processes and diseases including the drug resistance in cancer chemotherapies. However, the role of MVP in lung cancer remains unclear. Methods We examined MVP expression in 120 non-small cell lung cancer (NSCLC) tumors and matched normal tissues by immunohistochemistry. Its relationship with NSCLC prognosis was determined by investigating the patient cohort and analyzing the data from a published dataset consisting with more than 1900 lung cancer patients. We further performed shRNA-introduced knockdown of MVP in Lewis lung carcinoma (LLC) cells and examined its effects on the tumor formation in a xenograft mouse model and the tumor cell proliferation, apoptosis, and signal transduction in vitro. Results We found that MVP was up-regulated significantly in tumor tissues compared with the matched tumor-adjacent normal tissues. The increased expression of MVP in lung adenocarcinoma was associated with a better prognosis. Knockdown of MVP in LLC cells promoted xenografted lung cancer formation in mice, which was accompanied with accelerated tumor cell proliferation and suppressed cell apoptosis in vitro. Knockdown of MVP stimulated STAT3 phosphorylation, nuclear localization, and activation of JAK2 and RAF/MEK/ERK pathways in LLC cells. Administration of STAT3 inhibitor WP1066 could prevent MVP knockdown induced tumorigenesis. Conclusions Our findings demonstrate that MVP may act as a lung tumor suppressor via inhibiting STAT3 pathway. MVP would be a potential target for novel therapies of lung adenocarcinoma. Electronic supplementary material The online version of this article (10.1186/s12885-019-5665-6) contains supplementary material, which is available to authorized users.

A wound is damage of a tissue usually caused by laceration of a membrane, generally the skin. Wound healing is accomplished in three stages in healthy individuals, including inflammatory, proliferative, and remodeling stages. Healing of wounds normally starts from the inflammatory phase and ends up in the remodeling phase, but chronic wounds remain in an inflammatory stage and do not show progression due to some specific reasons. Chronic wounds are classified in different categories, such as diabetic foot ulcer (DFU), venous leg ulcers (VLU) and pressure ulcer (PU), surgical site infection (SSI), abscess, or trauma ulcers. Globally, the incidence rate of DFU is 1-4 % and prevalence rate is 5.3-10.5 %. However, colonization of pathogenic bacteria at the wound site is associated with wound chronicity. Most chronic wounds contain more than one bacterial species and produce a synergetic effect that results in previously non-virulent bacterial species becoming virulent and causing damage to the host. While investigating bacterial diversity in chronic wounds, Staphylococcus, Pseudomonas, Peptoniphilus, Enterobacter, Stenotrophomonas, Finegoldia, and Serratia were found most frequently in chronic wounds. Recently, it has been observed that bacteria in chronic wounds develop biofilms that contribute to a delay in healing. In a mature biofilm, bacteria grow slowly due to deficiency of nutrients that results in the resistance of bacteria to antibiotics. The present review reflects the reasons why acute wounds become chronic. Interesting findings include the bacterial load, which forms biofilms and shows high-level resistance toward antibiotics, which is a threat to human health in general and particularly to some patients who have acute wounds.

Astrocyte-elevated gene-1 (AEG-1), also known as metadherin (MTDH) and lysine-rich CEACAM1 coisolated (LYRIC), has emerged as an important oncogene that regulates key cellular processes including apoptosis, migration, invasion, proliferation, and differentiation. It was reported that AEG-1 enhanced breast cancer cells migration in a NF-κB-dependent manner. Also, AEG-1 contributed cell proliferation through the PI3K-Akt/cyclin pathway. Besides, AEG-1 is implicated in diverse physiological and pathological diseases of the central nervous system (CNS), such as brain tumors, neuroblastomas, neurodegeneration, and neuronal development. However, the role of AEG-1 in the process of peripheral nervous regeneration after injury remains virtually unknown. In this study, we investigated the spatiotemporal expression of AEG-1 in a rat sciatic nerve crush model. At its peak expression, AEG-1 was expressed mainly in Schwann cells of the distal sciatic nerve segment from injury, but had few colocalizations in axons. Besides, the peak expression of AEG-1 was in parallel with proliferating cell nuclear antigen (PCNA). In vitro, we detected the increased expression of AEG-1 during the process of tumor necrosis factor α (TNF-α)-induced Schwann cell proliferation. Meanwhile, interference of AEG-1 inhibited both proliferation and migration of Schwann cells. In conclusion, we speculated that AEG-1 is involved in biochemical and physiological responses after sciatic nerve crush (SNC).

By simply describing a classic weakly hard real-time system's performance with the number of tasks meeting or missing deadlines, the system's real-time characteristics cannot be expressed accurately and its reliability cannot be established. The path real-time logic (RTL) is used to determine the reliability of real-time systems; though desirable, it cannot be used as a tool to configure an optimized real-time system. This paper introduces the notion of optimizing path RTL, where integer constants of arithmetic inequality in path RTL are replaced by integer constants or integer variables. With further modifications, optimizing path RTL can not only determine the reliability of a real-time system, but also be used to optimize the system. Furthermore, a unified framework for hard, soft and weakly hard real-time system is established based on optimizing path RTL. The process of transforming a weakly hard real-time system into this unified framework is demonstrated. Moreover, this work proposes and proves a theorem that if the directed ring of a constraint graph contains all elements of behaviour specification (SP) and only SP, then its value must not be greater than zero. This theorem can be used to quickly determine the reliability and safety of a real-time system. A case study is presented to show the validity and reliability of optimizing path RTL and the unified real-time system.

SCY1-like 1-binding protein 1 (SCYL1BP1) is first identified as an interacting protein with SCYL1. Since SCYL1BP1 is a soluble protein with coiled-coil domains known to be relevant with transcriptional regulation, it has been found to activate the transcription of murine double minute 2 (MDM2) and participate in neurite outgrowth and regeneration. However, the role and mechanism of SCYL1BP1 in peripheral nerve system lesion and repair are still unknown. Here in vitro, our work demonstrated that SCYL1BP1 inhibited cAMP-induced primary Schwann cell differentiation and suppressed nerve growth factor-mediated neurite outgrowth in PC12 cells by enhancing the RhoA pathway. Furthermore, we found that pretreatment with a Rho kinase inhibitor Y-27632 resulted in partial rescue of Schwann cell differentiation and neurite outgrowth. In vivo experiments showed that SCYL1BP1 could also suppress nerve fiber regeneration. In conclusion, we speculated that SCYL1BP1 participated in Schwann cell (SC) differentiation and neurite outgrowth in the sciatic nerve after crush by regulating the RhoA pathway.

With more copper and copper-containing compounds used as bactericides and fungicides in viticulture, copper homeostasis in grapevine (Vitis) has become one of the serious environmental crises with great risk. To better understand the regulation of Cu homeostasis in grapevine, grapevine seedlings cultured in vitro with different levels of Cu were utilized to investigate the tolerance mechanisms of grapevine responding to copper availability at physiological and molecular levels. The results indicated that Cu contents in roots and leaves arose with increasing levels of Cu application. With copper concentration increasing, malondialdehyde (MDA) content increased in roots and leaves and the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) increased to protect the plant itself from damage. The expression patterns of 19 genes, encoding transporters, chaperones, and P-type ATPases involved in copper homeostasis in root and leaf of grapevine seedling under various levels of Cu(2+) were further analyzed. The expression patterns indicated that CTr1, CTr2, and CTr8 transporters were significantly upregulated in response both to Cu excess and deficiency. ZIP2 was downregulated in response to Cu excess and upregulated under Cu-deficient conditions, while ZIP4 had an opposite expression pattern under similar conditions. The expression of chaperones and P-type ATPases in response to Cu availability in grapevine were also briefly studied.

Nur77, together with Nurr1 and NOR-1, constitutes the NR4A subgroup of orphan nuclear receptors and plays critical roles in cell proliferation, differentiation, migration, and apoptosis. Among them, Nur77 is universally well known to contribute to neurite outgrowth. However, information regarding its regulation and possible function in the peripheral nervous system is still limited. In this study, we performed a sciatic nerve injury model in adult rats and detected an increased expression of Nur77 in the sciatic nerve, which was similar to the expression of Oct-6. Immunofluorescence indicated that Nur77 was located in both axons and Schwann cells. In vitro, we observed enhanced expression of Nur77 during the process of both basic fibroblast growth factor (bFGF)-induced Schwann cells differentiation and nerve growth factor (NGF)-induced PC12 cell neurite outgrowth. In vitro and in vivo experiments indicated that inhibiting the function of Nur77 by specific short hairpin RNA could depress Schwann cells myelinization and axons regeneration. Collectively, all these results suggested that upregulation of Nur77 might be involved in Schwann cells differentiation and neurite elongation following sciatic nerve crush.

Gene disruption in Pestalotiopsis microspora is blocked by the formation of extrachromosomal DNAs with telomeric repeats in transformants generated using the protoplast-PEG approach. In order to avoid this condition and to provide molecular tools, a highly efficient gene targeting method, mediated by single-stranded DNA homologous disruption of Agrobacterium tumefaciens-mediated transformation (ATMT) with one-step construction of Agrobacterium-recombination-ready-plasmids (OSCAR) was established for the first time in this fungus. Conditions affecting recombination for OSCAR were optimized. The polyketide synthase gene pks1—an essential gene for melanin biosynthesis—was selected as a target gene because of the clear phenotypic difference between the pks1 mutant and the wild-type strain. Disruption of pks1 by this method resulted in 80 % albino transformants compared with black colonies of the wild-type strain. Southern analysis and PCR amplification verified that a single-copy homologous recombination event had occurred at the pks1 locus. The pattern of secondary metabolites and the production of conidia were affected by the loss of pks1. This study demonstrated that ATMT with single-stranded DNA is an effective method for gene targeting in Pestalotiopsis microspora, which should facilitate genetic modification in this species. This study also indicates that crosstalk exists between the biosynthesis of melanin and other secondary metabolites in this fungus.

Carotenoids not only play indispensable roles in plant growth and development but also enhance nutritional value and health benefits for humans. In this study, total carotenoids progressively decreased during fruit ripening. Fifty-four genes involving in mevalonate (MVA), 2-C-methyl-D-erythritol 4-phosphate (MEP), carotenoid biosynthesis and catabolism pathway were identified. The expression levels of most of the carotenoid metabolism related genes kept changing during fruit ripening generating a metabolic flux toward carotenoid synthesis. Down regulation of VvDXS, VvDXR, VvGGPPS and VvPSY and a dramatic increase in the transcription levels of VvCCD might be responsible for the reduction of carotenoids content. The visible correlation between carotenoid content and gene expression profiles suggested that transcriptional regulation of carotenoid biosynthesis pathway genes is a key mechanism of carotenoid accumulation. In addition, the decline of carotenoids was also accompanied with the reduction of chlorophyll content. The reduction of chlorophyll content might be due to the obstruction in chlorophyll synthesis and acceleration of chlorophyll degradation. These results will be helpful for better understanding of carotenoid biosynthesis in grapevine fruit and contribute to the development of conventional and transgenic grapevine cultivars for further enrichment of carotenoid content.

The spatiotemporal distribution characteristics of soil temperature are a significant, but seldom described signal of climate warming. This study examines the spatiotemporal trends in soil temperature at depths of 10, 20, and 50 cm in the conterminous US during 1948- 2008. We find a warming trend of between 0.2 and 0.4 °C at all depths from 1948 to 2008. The lowest soil temperatures are in Colorado and the area where Wyoming, Idaho, and Montana meet. The coastal areas, such as Texas, Florida, and California, experienced the highest soil temperature. In addition, areas that experienced weak cooling in summer soil temperature include Texas, Oklahoma, and Arkansas. Warming was recorded in Arizona, Nevada, and Oregon. In winter, Mississippi, Alabama, and Georgia show a cooling trend, and Montana, North Dakota, and South Dakota have been warming over the 61-year period. Additionally, mix-forest areas experience slightly cooler soil temperature in comparison with air temperature. Shrubland areas experience slightly warmer soiltemperaturein comparison with air temperature. This study is among the first to analyze the spatiotemporal distribution characteristics of soil temperature in the conterminous US by using multiple site observational data. Improved understanding of the spatially complex responses of soil temperature shall have significant implications for future studies in climate change over the region.

Tetra Pak packages (Tetra paks) are one of typical paper/plastic/aluminum composites and widely used in soft drinks and dairy product markets. However, after its service life, serious environmental problems generate due to its non-biodegradable nature. In this paper, a novel electromagnetic interference (EMI) shielding board was developed using recycled Tetra paks waste with addition of iron fibers. The influence of fiber loading level, fiber length and number of iron fiber layer within the matrix on EMI shielding effectiveness (SE) and volume resistivity (VR) was investigated. The results indicated that fiber loading level, fiber length and number of iron fiber layer affected EMI shielding properties significantly. SE increased with the increasing fiber loading, fiber length and number of fiber layer, and VR had an opposite tendency. For the board with 5 mm thickness, the percolation threshold of fiber loading was between 0.008 and 0.02 % (weight of iron fiber/weight of Tetra paks). The boards had excellent total EMI shielding performance in range of 9000 Hz–200 MHz and 600–1500 MHz. This value-added product could be used in packaging, construction and other application fields and exhibited both environmental and economic advantages. It also could be considered as a step toward paper/plastic/aluminum composite waste management and preventing municipal solid wastes environmental pollution.

Chaetomium globosum is one of the most common fungi in nature. It is best known for producing chaetoglobosins; however, the molecular basis of chaetoglobosin biosynthesis is poorly understood in this fungus. In this study, we utilized RNA interference (RNAi) to characterize a polyketide synthase gene, pks-1, in C. globosum that is involved in the production of chaetoglobosin A. When pks-1 was knocked down by RNAi, the production of chaetoglobosin A dramatically decreased. Knock-down mutants also displayed a pigment-deficient phenotype. These results suggest that the two polyketides, melanin and chaetoglobosin, are likely to share common biosynthetic steps. Most importantly, we found that pks-1 also plays a critical role in sporulation. The silenced mutants of pks-1 lost the ability to produce spores. We propose that polyketides may modulate cellular development via an unidentified action. We also suggest that C. globosum pks-1 is unique because of its triple role in melanin formation, chaetoglobosin biosynthesis and sporulation. This work may shed light on chaetoglobosin biosynthesis and indicates a relationship between secondary metabolism and fungal morphogenesis.

Loss-of-function mutagenesis is an important tool used to characterize gene functions and the CRISPR-Cas9 system is a powerful method for performing targeted mutagenesis in organisms that present low recombination frequencies, such as the serotype D strains of Cryptococcus neoformans. However, when the CRISPR-Cas9 system persists in the host cells, off-target effects and Cas9 cytotoxicity may occur, which might block subsequent genetic manipulation. Here, we report a method of spontaneously eliminating the CRISPR-Cas9 system without impairing its robust editing function. We successfully expressed single guide RNA under the driver of an endogenous U6 promoter and the human codon-optimized Cas9 endonuclease with an ACT1 promoter. This system can effectively generate an indel mutation and efficiently perform targeted gene disruption via homology-directed repair by electroporation in yeast. We then demonstrated the spontaneous elimination of the system via a cis arrangement of the CRISPR-Cas9 expression cassettes to the recombination construct. After a system-mediated double crossover, the CRISPR-Cas9 cassettes were cleaved and degraded, which was validated by Southern blotting. This ‘suicide’ CRISPR-Cas9 system enables the validation of gene functions by subsequent complementation and has the potential to minimize off-target effects. Thus, this technique has the potential for use in functional genomics studies of C. neoformans.

Nature Plants http://dx.doi.org/10.1038/nplants.2015.203 (2015); published online 21 December 2015; corrected online 5 January 2016. In Supplementary Fig. 14 of this Article originally published, the second IR24 should have read IR26. This error has now been corrected.

Intercropping with aerobic rice or arbuscular mycorrhizal fungi (AMF) colonization alleviated watermelon wilt disease, which is likely attributed to rice root exudates or AMF depressing watermelon wilt pathogen. However, it is unclear whether rice root exudates transfers to watermelon rhizosphere soil and whether AMF affects the transfer of rice root exudates to watermelon rhizosphere soil. A rhizobox experiment, with aerobic rice under 14 CO2, was conducted to investigate the effect of AMF colonization on carbon (C) transfer from rice to watermelon and on phosphorus (P) uptake by both watermelon and rice. The rhizobox was separated into labelling side (L side) and sampling side (S side) by inserting nylon mesh in the middle of the box. The L side was planted with aerobic rice, and the S side was aerobic rice (monocropping) or watermelon (intercropping). When 14 CO2 was added to rice canopy at the L side, 14 C activities of rice roots and rhizosphere soils in the L side were increased by intercropping with watermelon or AMF colonization. The 14 C was detected in roots and rhizosphere soils of rice and watermelon in the S side, but no differences were found among different treatments. 14 C activities in leaves were improved by AMF inoculation in the S side, regardless of rice or watermelon. Mycorrhizal colonization stimulated P absorption and translocation to rice in intercropping system. These findings suggest that AMF colonization could increase C transfer from rice to watermelon while intercropping with watermelon could promote AMF colonization and P uptake by rice.

Community structure and leaf traits are important elements of terrestrial ecosystems. Changes of community structure and leaf traits are of particular use in the study of the influence of climate change on terrestrial ecosystems. Patterns of community structure (including species richness, above- and below-ground biomass) and leaf traits (including leaf mass per area (LMA), nitrogen content both on mass and area bases (N mass and N area), and foliar δ13C) from 19 grassland plots along an altitudinal transect at Hongchiba in Chongqing, China, were analyzed. Species richness along the altitudinal transect had a hump-shaped pattern. Above-ground biomass had a quadratic decrease along the altitudinal gradient whereas below-ground biomass had the opposite pattern. Change of above-ground biomass of various taxonomic groups with altitude was also studied. Poaceae showed strong negative relationships and Asteraceae showed a hump-shaped relationship with increase of altitude. Five common species of the grassland, Trifolium pratense, Geranium wilfordii, Aster tataricus, Leontopodium leontopodioides, and Spiraea prunifolia, were particularly studied for variation of leaf traits along the altitudinal gradient. Averaged for all species, LMA, N area and foliar δ13C had positive correlations with altitude. N mass did not change significantly as altitude increased. LMA and N area showed significant positive relationships with foliar δ13C. The adaptive features of leaf traits among different species were not consistent. The study highlights specific adaptation patterns in relation to altitude for different plant species, provides further insights into adaptive trends of community structure and leaf traits in a specific ecological region filling a gap in the definition of global patterns, and adds to the understanding of how adaptive patterns of plants may respond to global climate change.

Classically (M1) and alternatively (M2) activated macrophage subsets play differential roles in left ventricular remodeling after myocardial infarction (MI). The precise mechanism underlying the regulation of M1/M2 polarization during MI is unknown. We hypothesized that class A scavenger receptor (SR-A), a key modulator of inflammation, may steer macrophage polarization, which in turn influences cardiomyocytes necrosis after MI. MI was induced in wild type (WT) and SR-A deficient (SR-A(-/-)) mice by left anterior descending coronary artery ligation. Cardiac function deterioration, ventricular dilatation and fibrosis were all exacerbated in SR-A(-/-) mice following MI compared to WT littermates. Meanwhile, enhanced M1 macrophage polarization was observed in SR-A(-/-) mice, along with increased production of M1 signature cytokines including interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α) as demonstrated by immunohistochemistry, flow cytometry, quantitative real-time PCR, and ELISA assays. Moreover, activation of the activated apoptosis signal regulating kinase 1 (ASK1)/p38 mitogen-activated protein kinase (MAPK)/nuclear factor-κB (NF-κB) signaling pathway was markedly elevated in SR-A(-/-) animals post-MI. Most importantly, transplantation using bone marrow from SR-A(+/+) mice partially restored M1 macrophages and significantly augmented left ventricular fractional shortening in SR-A(-/-) mice. SR-A attenuated MI-induced cardiac remodeling by suppressing macrophage polarization toward a skewed M1 phenotype, reducing secretion of IL-1β, IL-6, and TNF-α, and dampening the ASK1/p38/NF-κB signaling pathway. Therefore, SR-A may exert a protective effect against MI, which may represent a new interventional target for treatment of post-infarct remodeling and subsequent heart failure.

This paper aims to address the problem of modeling human behavior patterns captured in surveillance videos for the application of online normal behavior recognition and anomaly detection. A novel framework is developed for automatic behavior modeling and online anomaly detection without the need for manual labeling of the training data set. The framework consists of the following key components. 1) A compact and effective behavior representation method is developed based on spatial-temporal interest point detection. 2) The natural grouping of behavior patterns is determined through a novel clustering algorithm, topic hidden Markov model (THMM) built upon the existing hidden Markov model (HMM) and latent Dirichlet allocation (LDA), which overcomes the current limitations in accuracy, robustness, and computational efficiency. The new model is a four-level hierarchical Bayesian model, in which each video is modeled as a Markov chain of behavior patterns where each behavior pattern is a distribution over some segments of the video. Each of these segments in the video can be modeled as a mixture of actions where each action is a distribution over spatial-temporal words. 3) An online anomaly measure is introduced to detect abnormal behavior, whereas normal behavior is recognized by runtime accumulative visual evidence using the likelihood ratio test (LRT) method. Experimental results demonstrate the effectiveness and robustness of our approach using noisy and sparse data sets collected from a real surveillance scenario.

Increasing crop yield is a major challenge for modern agriculture. The development of new plant types, which is known as ideal plant architecture (IPA), has been proposed as a means to enhance rice yield potential over that of existing high-yield varieties. Here, we report the cloning and characterization of a semidominant quantitative trait locus, IPA1 (Ideal Plant Architecture 1), which profoundly changes rice plant architecture and substantially enhances rice grain yield. The IPA1 quantitative trait locus encodes OsSPL14 (SOUAMOSA PROMOTER BINDING PROTEIN-LIKE 14) and is regulated by microRNA (miRNA) OsmiR156 in vivo. We demonstrate that a point mutation in OsSPL14 perturbs OsmiR156-directed regulation of OsSPL14, generating an 'ideal' rice plant with a reduced tiller number, increased lodging resistance and enhanced grain yield. Our study suggests that OsSPL14 may help improve rice grain yield by facilitating the breeding of new elite rice varieties.

The CLC chloride channel gene CLC-A of the pathogen yeast Cryptococcus neoformans was previously reported to be critical for multicopper laccase activity and growth at an elevated pH. This study reports that copper homeostasis was impaired in the clc-a mutant. This was demonstrated by the substantial decrease of the intracellular quantity of copper under copper-limited growth as determined by flame atomic absorption spectrometry. CLC-A is a critical factor in copper homeostasis which is required for copper acquisition of laccase in C. neoformans.

Grain-filling, an important trait that contributes greatly to grain weight, is regulated by quantitative trait loci and is associated with crop domestication syndrome. However, the genes and underlying molecular mechanisms controlling crop grain-filling remain elusive. Here we report the isolation and functional analysis of the rice GIF1 (GRAIN INCOMPLETE FILLING 1) gene that encodes a cell-wall invertase required for carbon partitioning during early grain-filling. The cultivated GIF1 gene shows a restricted expression pattern during grain-filling compared to the wild rice allele, probably a result of accumulated mutations in the gene's regulatory sequence through domestication. Fine mapping with introgression lines revealed that the wild rice GIF1 is responsible for grain weight reduction. Ectopic expression of the cultivated GIF1 gene with the 35S or rice Waxy promoter resulted in smaller grains, whereas overexpression of GIF1 driven by its native promoter increased grain production. These findings, together with the domestication signature that we identified by comparing nucleotide diversity of the GIF1 loci between cultivated and wild rice, strongly suggest that GIF1 is a potential domestication gene and that such a domestication-selected gene can be used for further crop improvement.

Ethanol tolerance is a key trait of microbes in bioethanol production. Previous studies have shown that soya flour contributed to the increase of ethanol tolerance of yeast cells. In this paper, the mechanism of this ethanol tolerance improvement was investigated in cassava ethanol fermentation supplemented with soya flour or defatted soya flour, respectively. Experiment results showed that ethanol tolerance of cells from soya flour supplemented medium increased by 4-6% (v/v) than the control with defatted soya flour. Microscopic observation found that soya flour can retain the cell shape while dramatic elongations of cells were observed with the defatted soya flour supplemented medium. Unsaturated fatty acids (UFAs) compositions of cell membrane were analyzed and the UFAs amounts increased significantly in all tested strains grown in soya flour supplemented medium. Growth study also showed that soya flour stimulated the cell growth rate by approximately tenfolds at 72-h fermentation. All these results suggested that soya fatty acids play an important role to protect yeast cells from ethanol stress during fermentation process.

Characterizations of hydroxyapatite (HA), biphasic calcium phosphate (BCP) and beta tricalcium phosphate (beta-TCP) ceramic particles were carried out using X-ray diffusion (XRD), Scanning electron micrograph (SEM), Particle Sizer and Zeta potential analyzer. Competitive adsorption of bovine serum albumin (BSA) and lysozyme (LSZ) on the three calcium phosphates were investigated by polyacrylamide gel electrophoresis (PAGE) method. The results showed that HA, BCP and beta-TCP ceramic particles with irregular shapes and similar size distributions all had negative surface net charges in pH7.4 phosphate buffered saline (PBS) solution and exhibited alike behaviors of BSA and LSZ adsorption. LSZ had higher affinity for calcium phosphate ceramics than BSA and its adsorption on them didn't be almost influenced by the increasing of BSA concentration in the solution. Electrostatic interaction played an important role on the competitive adsorption of BSA and LSZ on the surface of calcium phosphate ceramic particles.

RNA interference is a powerful genetic approach for silencing of target genes in which 21-23 nucleotide small interfering RNAs (siRNAs) work as sequence-specific RNA interference (RNAi) mediators. Production of siRNAs by in vitro transcription is a useful method that it is simple, effective, and inexpensive. Commonly used in vitro transcription promoters use guanine as the transcription start nucleotide. This method is, therefore, restricted to generating siRNAs with target sequences of 5'-NNGN17C. Here we report a modified in vitro transcription method, in which pre-siRNAs containing the 5' overhanging single-stranded leader sequence are first synthesized, then a DNA oligonucleotide complementary to the leader sequence is added to form a RNA-DNA hybrid, which is removed using RNase H to obtain desired siRNAs. Using siRNAs prepared with this method, we successfully inhibited the expression of both exogenous and endogenous genes.

Thrombospondin-1 (TSP-1) has been shown to play a role in angiogenesis in a variety of cancers, but some studies indicated a difference in the mechanism of TSP-1 on neovascularization according to organ or histological type. Wild-type p53 protein has been shown to induce TSP-1 expression. We examined the expression of TSP-1 protein in 80 gastric carcinomas using immunohistochemistry and studied the relationship with microvessel counts, p53 expression and clinicopathological factors. We also performed reverse-transcriptase polymerase chain reaction analysis for the TSP-1 mRNA expression in gastric carcinoma cell lines and gastric cancer tissue after laser capture microdissection. Strong expression of TSP-1 protein was detected in 30 (38%) of the 80 cases. Positive staining for TSP-1 was seen in the cytoplasm of the cancer cells. TSP-1 mRNA expression was confirmed in a majority of gastric carcinoma cell lines and carcinoma tissues. Microvessel counts were significantly higher in tumors with strong TSP-1 protein expression than in those without expression or weak expression of TSP-1 ( P=0.011). No significant correlation was found between TSP-1 expression and p53 staining and clinicopathological factors. Our results support an idea that increased TSP-1 expression may be associated with an angiogenic phenotype in gastric carcinoma and suggest that TSP-1 may play diverse roles in each organ.