Search

The molecular mechanism of the heme protein, hemoglobin (Hb) interaction with sulfa molecule, sulfadiazine (SDZ) has been investigated through spectroscopic, neutron scattering and molecular modeling techniques. Absorption and emission spectroscopic studies showed that SDZ molecules were bound to Hb protein, non-cooperatively. The binding affinityof SDZ-Hb complex at standard experimental condition was evaluated to be around (4.2 ± 0.07) ×10 4 , M -1 with 1:1 stoichiometry. Drug induced structural perturbation of the 3 D protein moiety was confirmed through circular dichroism (CD), synchronous fluorescence and small angle neutron scattering methods. From the temperature dependent spectrofluorometric studies, the negative standard molar Gibbs energy change suggested the spontaneity of the reaction. The negative enthalpy and positive entropy change(s) indicated towards the involvement of both electrostatic and hydrophobic forces during the association process. Salt dependent fluorescence study revealed major contributions from non-poly-electrolytic forces. Molecular modeling studies determined the probable binding sites, types of interaction involved and the conformational alteration of the compactness of the Hb structure upon interaction with SDZ molecule. Overall, the study provides detailed insights into the binding mechanism of SDZ antibiotics to Hb protein.Communicated by Ramaswamy H. Sarma.

Arsenic present in water bodies causes devastating effects on aquatic organisms and indirectly poses a hazardous threat to human existence. There is an urgent need to develop potential and convincing technologies to troubleshoot this problem. In the present study, an adsorbent has been prepared using the waste red mud from hazardous aluminium industry and doping it with calcium-alginate beads (ARMCB) for the effective removal of As(III) from wastewater. The concentration of As(III) was reduced from 0.101 mg/L to 0.008 mg/L after adsorption which effectively met the economic and environmental conditions imposed by WHO (>0.01 mg/L). Further, the statistical Response Surface Methodology (RSM) is adopted to analyze the combined effects of four operational parameters namely: pH, sorbent dosage, contact time and initial concentration on the adsorption of As(III) from the synthetic contaminated water samples. A high correlation coefficient (R2) value of 0.9672 projected by ANOVA confirmed the satisfactory regression of the developed model. The maximum adsorption capacity is found to be 1.807 mg/g at optimum operating conditions. The surface characterization of the adsorbent before and after adsorption by SEM, EDX, XRD, and FTIR confirms the potentiality of the adsorbent towards As(III) ions. Thermodynamic, adsorption isotherms and kinetic analysis respectively projected the endothermic Langmuir model adsorption of As(III) and the pseudo-second-order rate kinetics of the sorption mechanism. The current study aids the implementation of the developed robust technique for the successful removal of As(III) from industrial and domestic polluted water samples.

The binding of proflavine, an acriflavine derivative, with the RNA polynucletodide polyadenylic acid-polyuridylic acid is investigated here to understand the structural and thermodynamic basis of the binding process. Such binding data are crucial for designing viable theraperutic agents. Spectroscopic studies clearly suggest a strong binding interaction between proflavine and polyadenylic acid-polyuridylic acid leading to efficient energy transfer between the poly AU base pairs and proflavine. The stoichiometry of proflavine polyadenylic acid-polyuridylic acid binding was independently estimated by continuous variation analysis of Job. An intercalative binding model is envisaged for the binding from hydrodynamic studies. Circular dichroism experiments revealed that the binding induced conformational changes in the RNA, and also led to induction of optical activity in the bound dye molecules. The binding affinity of the complex was deduced to be (6.57 ± 0.75) 10 5 M -1 at (298.15 ± 0.10) K from isothermal titration calorimetry experiment. Positive entropy and negative enthalpy changes characterized the complexation. The binding was observed to be weaker both at higher temperatures and increased [Na + ]. The affinity of binding decreased with increasing [Na + ]. When the Gibbs energy was parsed between polyelectrolytic and nonpolyelectropytic components, it surprisingly revealed a higher role for the non-polyelectrolytic forces. These results present new data for developing RNA targeted ligands.Communicated by Ramaswamy H. Sarma.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10 5  M -1 ], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10 5  M -1 , and that of BER was (0.98 ± 0.03) × 10 5  M -1 . Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

This manuscript describes the interaction of the topoisomerase I inhibitor anticancer drug topotecan with human serum albumin using microcalorimetry, circular dichroism, and atomic force microscopy imaging techniques. Conformational change in albumin was ascertained from circular dichroism and synchronous fluorescence study that revealed a small but definitive partial unfolding of the protein structure upon drug binding. Isothermal titration calorimetry study indicated a favorable exothermic interaction with a binding affinity of the order of ~10 5  M -1 at 293.15 K. A 1:1 binding stoichiometry was established. The binding reaction was largely enthalpy dominated with negative standard molar Gibbs energy change. Ionic strength variation study revealed that non-polyelectrolytic forces played dominant role in the interaction and remained almost invariant at all salt concentrations. Upon complex formation, the stabilization of the protein structure against thermal denaturation occurred. Atomic force microscopy study enabled imaging of fibrils of the protein and its complex with topotecan.

The binding of the anilido aminoacridine derivative amsacrine with the heme proteins, hemoglobin, and myoglobin, was characterized by various spectroscopic and calorimetric methods. The binding affinity to hemoglobin was (1.21 ± .05) × 10 5  M -1 , while that to myoglobin was three times higher (3.59 ± .15) × 10 5  M -1 . The temperature-dependent fluorescence study confirmed the formation of ground-state complexes with both the proteins. The stronger binding to myoglobin was confirmed from both spectroscopic and calorimetric studies. The binding was exothermic in both cases at the three temperatures studied, and was favored by both enthalpy and entropy changes. Circular dichroism results, three-dimensional (3D) and synchronous fluorescence studies confirmed that the binding of amsacrine significantly changed the secondary structure of hemoglobin, while the change in the secondary structure of myoglobin was much less. New insights, in terms of structural and energetic aspects of the interaction of amsacrine with the heme proteins, presented here may help in understanding the structure-activity relationship, therapeutic efficacy, and drug design aspects of acridines.

Interaction of the food additive tartrazine with double-stranded DNA was studied by spectroscopic and calorimetric techniques. Absorbance studies revealed that tartrazine exhibited hypochromism in the presence of DNA without any bathochromic effects. Minor groove displacement assay of DAPI and Hoechst 33258 suggested that tartrazine binds in the minor groove of DNA. The complexation was predominantly entropy driven with a smaller but favorable enthalpic contribution to the standard molar Gibbs energy. The equilibrium constant was evaluated to be (3.68 ± .08) × 10(4) M(-1) at 298.15 K. The negative standard molar heat capacity value along with an enthalpy-entropy compensation phenomenon proposed the involvement of dominant hydrophobic forces in the binding process. Tartrazine enhanced the thermal stability of DNA by 7.53 K under saturation conditions.

The interaction of the plant alkaloid aristololactam-β-D-glucoside (ADG) and the anticancer agent daunomycin (DAN) with human hemoglobin was studied by different spectroscopic and calorimetric methods. The binding affinity values of ADG and DAN, estimated from spectroscopic experiments, were 3.79 × 10(4) and 6.68 × 10(4) M(-1), respectively. From circular dichroism, 3D fluorescence, and FTIR studies it was observed that, DAN induced stronger conformational changes than ADG in the protein. From synchronous fluorescence spectroscopy results, a pronounced shift in the maximum emission wavelength of tyrosine residues was observed in both cases suggesting that the drugs changed the polarity around tyrosine residues with marginal change around the tryptophan residues. The thermodynamics of the binding interaction analyzed using microcalorimetry presented single binding events that were exothermic in nature in both cases. The binding was driven by large positive standard molar entropy changes with small favorable enthalpy contributions. Negative heat capacity changes in both cases are correlated to the involvement of significant hydrophobic forces in the complexation process. The affinity of DAN to Hb was higher than that of ADG.

The interaction of the natural plant alkaloid and anticancer agent sanguinarine with tRNA(phe) has been investigated by spectroscopic and calorimetric techniques. Sanguinarine iminium binds to tRNA(phe) cooperatively; alkanolamine does not bind but in presence of large tRNA(phe) concentration, a conversion from alkanolamine to iminium occurs resulting in concomitant binding of the latter. The binding affinity of the iminium to tRNA(phe) obtained from isothermal titration calorimetry was of the order of 10(5) M(-1), which is close to that evaluated from spectroscopy. The binding was driven largely by negative enthalpy and a smaller but favourable positive entropy change. The binding was dependent on the [Na(+)] concentration, but had a larger non-electrostatic contribution to the Gibbs energy. A small heat capacity value and the enthalpy-entropy compensation in the energetics of the interaction characterized the binding of the iminium form to tRNA(phe). This study confirms that the tRNA(phe) binding moiety is the iminium form of sanguinarine.